ID: 1146008428

View in Genome Browser
Species Human (GRCh38)
Location 17:29176862-29176884
Sequence CCTTGGCGTTTCCCCGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008412_1146008428 13 Left 1146008412 17:29176826-29176848 CCAGCCCTCACGCCGCCGCGCGG 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1146008428 17:29176862-29176884 CCTTGGCGTTTCCCCGCGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1146008417_1146008428 8 Left 1146008417 17:29176831-29176853 CCTCACGCCGCCGCGCGGGGAGC 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1146008428 17:29176862-29176884 CCTTGGCGTTTCCCCGCGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1146008416_1146008428 9 Left 1146008416 17:29176830-29176852 CCCTCACGCCGCCGCGCGGGGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1146008428 17:29176862-29176884 CCTTGGCGTTTCCCCGCGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1146008422_1146008428 -2 Left 1146008422 17:29176841-29176863 CCGCGCGGGGAGCCGGGCGGCCC 0: 1
1: 0
2: 4
3: 35
4: 258
Right 1146008428 17:29176862-29176884 CCTTGGCGTTTCCCCGCGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1146008420_1146008428 1 Left 1146008420 17:29176838-29176860 CCGCCGCGCGGGGAGCCGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 256
Right 1146008428 17:29176862-29176884 CCTTGGCGTTTCCCCGCGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008428 Original CRISPR CCTTGGCGTTTCCCCGCGGC TGG Intronic