ID: 1146008431

View in Genome Browser
Species Human (GRCh38)
Location 17:29176873-29176895
Sequence GCTGCGCCGGCCCAGCCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008431_1146008443 20 Left 1146008431 17:29176873-29176895 CCCCGCGGCTGGGCCGGCGCAGC 0: 1
1: 0
2: 1
3: 19
4: 247
Right 1146008443 17:29176916-29176938 CGCTGCGATCCCATCTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 117
1146008431_1146008435 -10 Left 1146008431 17:29176873-29176895 CCCCGCGGCTGGGCCGGCGCAGC 0: 1
1: 0
2: 1
3: 19
4: 247
Right 1146008435 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 7
3: 27
4: 354
1146008431_1146008444 24 Left 1146008431 17:29176873-29176895 CCCCGCGGCTGGGCCGGCGCAGC 0: 1
1: 0
2: 1
3: 19
4: 247
Right 1146008444 17:29176920-29176942 GCGATCCCATCTCCCCCGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008431 Original CRISPR GCTGCGCCGGCCCAGCCGCG GGG (reversed) Intronic