ID: 1146008431 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:29176873-29176895 |
Sequence | GCTGCGCCGGCCCAGCCGCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 268 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 19, 4: 247} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1146008431_1146008444 | 24 | Left | 1146008431 | 17:29176873-29176895 | CCCCGCGGCTGGGCCGGCGCAGC | 0: 1 1: 0 2: 1 3: 19 4: 247 |
||
Right | 1146008444 | 17:29176920-29176942 | GCGATCCCATCTCCCCCGGAAGG | 0: 1 1: 0 2: 0 3: 2 4: 54 |
||||
1146008431_1146008435 | -10 | Left | 1146008431 | 17:29176873-29176895 | CCCCGCGGCTGGGCCGGCGCAGC | 0: 1 1: 0 2: 1 3: 19 4: 247 |
||
Right | 1146008435 | 17:29176886-29176908 | CCGGCGCAGCCGCAGCCCCGCGG | 0: 1 1: 0 2: 7 3: 27 4: 354 |
||||
1146008431_1146008443 | 20 | Left | 1146008431 | 17:29176873-29176895 | CCCCGCGGCTGGGCCGGCGCAGC | 0: 1 1: 0 2: 1 3: 19 4: 247 |
||
Right | 1146008443 | 17:29176916-29176938 | CGCTGCGATCCCATCTCCCCCGG | 0: 1 1: 0 2: 0 3: 9 4: 117 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1146008431 | Original CRISPR | GCTGCGCCGGCCCAGCCGCG GGG (reversed) | Intronic | ||