ID: 1146008434

View in Genome Browser
Species Human (GRCh38)
Location 17:29176886-29176908
Sequence CCGCGGGGCTGCGGCTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 435}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008434_1146008452 26 Left 1146008434 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1146008452 17:29176935-29176957 CCGGAAGGCAGCAATCCCGCGGG 0: 1
1: 0
2: 1
3: 3
4: 66
1146008434_1146008444 11 Left 1146008434 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1146008444 17:29176920-29176942 GCGATCCCATCTCCCCCGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 54
1146008434_1146008443 7 Left 1146008434 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1146008443 17:29176916-29176938 CGCTGCGATCCCATCTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 117
1146008434_1146008450 25 Left 1146008434 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1146008450 17:29176934-29176956 CCCGGAAGGCAGCAATCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008434 Original CRISPR CCGCGGGGCTGCGGCTGCGC CGG (reversed) Intronic
900096660 1:942657-942679 CCGAGGAGCTGCAGCGGCGCGGG + Exonic
900191559 1:1354339-1354361 CCGCGGAGGTGAGGCTGCCCCGG - Exonic
900237509 1:1599838-1599860 GCGCGGGGCTGCGGAAGCACAGG + Exonic
900418686 1:2546389-2546411 CCGGGAGGCGGCGGCGGCGCAGG - Intergenic
900555670 1:3279209-3279231 CCGAGGGCCTGCGCCTGGGCAGG - Intronic
901007633 1:6179651-6179673 CCGCGGGCCGGGGCCTGCGCTGG - Intronic
901506580 1:9689455-9689477 CCTCGGGGCTGGGGCGGGGCCGG - Intronic
902323650 1:15684505-15684527 CGGCGGGGCGGCGGCGGCGGTGG + Exonic
902435114 1:16393432-16393454 CCTCGGGGCTGGCGCTGCCCAGG - Exonic
902823251 1:18956262-18956284 CCGCCGGGCGGCGGCGGCGGGGG - Exonic
902846215 1:19112558-19112580 CCGAGGGGCTGCGGCCATGCGGG - Exonic
903055580 1:20633807-20633829 GTGCGGGCCTGGGGCTGCGCGGG + Exonic
903517309 1:23920145-23920167 GGGCTGGGCTGGGGCTGCGCAGG - Intergenic
904601096 1:31672972-31672994 CCGCAGGGATGCGGCTGGGGAGG - Intronic
905347083 1:37318597-37318619 GTGAGGGGCTGCGGCAGCGCGGG + Intergenic
905580886 1:39082000-39082022 CCGCGAGCCTGGGGCGGCGCGGG - Intronic
905881563 1:41467484-41467506 GCCCGGGGCTGCAGCTGGGCTGG + Intergenic
906276962 1:44523810-44523832 ACGAGGGGATGGGGCTGCGCTGG - Intronic
907038354 1:51236443-51236465 CCGCGGGGCGGCGGCGGCCACGG - Exonic
907136266 1:52142192-52142214 CCGCGTGGCTGCCGCGGCCCGGG + Exonic
907429926 1:54405897-54405919 CCGCCGGGCTGCGGGCGGGCGGG - Intronic
908128204 1:61050700-61050722 CCACGGGACAGCGGCCGCGCGGG + Intronic
908132057 1:61083362-61083384 GCGGGGGGCTGCGGCAGCGCAGG - Intronic
909958219 1:81802928-81802950 CGGCGGGGCTGCTGCTGCCAGGG + Intronic
910034725 1:82776845-82776867 CCGGGAGGCTCCGGCTGCACAGG + Intergenic
911348144 1:96721717-96721739 CCGCGCGGCAGCGGCGGCGGCGG - Intronic
912433720 1:109643793-109643815 CTGCGGGGCTGGGCCAGCGCGGG + Intergenic
912927898 1:113929700-113929722 GCGCGGGGCTGAGGCGGCGGCGG + Exonic
913131101 1:115838903-115838925 GCGCTGGTCTGGGGCTGCGCCGG + Exonic
913194530 1:116444670-116444692 CAGTGGGGCTGGGGCTGGGCTGG - Intergenic
915367331 1:155323528-155323550 GCGCCGGGCTGCGGCTGCTGGGG + Intronic
915519859 1:156435804-156435826 CCGCAGAGCCGCGGGTGCGCGGG + Intergenic
917359311 1:174159306-174159328 CTGCGTGGCCGCGGTTGCGCCGG - Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
919826481 1:201506969-201506991 CCCCGGGGCTGCGGCGGGGCTGG + Intronic
919861144 1:201740143-201740165 CTGGGGGGCTGCGGCGGGGCTGG - Intronic
921029786 1:211327036-211327058 GCGCGAGGCGGCGGCTGGGCCGG + Intronic
1064220918 10:13439844-13439866 CCGAGGGGCTGGGACGGCGCGGG - Intronic
1064645379 10:17454348-17454370 GCGCGGGGCTGCGGCCACGGCGG - Intergenic
1065092847 10:22252509-22252531 GCGCGGGGCTGGCGCTGCGCAGG - Intergenic
1065102006 10:22340723-22340745 CCGCGGGGCAGCCGCTCCTCCGG + Intergenic
1065549942 10:26860465-26860487 GCGCCGGGCTGCGGCAGCGGCGG + Intronic
1066464214 10:35639478-35639500 CCGGGGGGCGGCGGCGGCGGGGG - Exonic
1067033815 10:42898531-42898553 CACCGGGGCTGCACCTGCGCAGG - Intergenic
1067051877 10:43026328-43026350 GTGCTGGGCTGCGGCTACGCTGG - Intergenic
1069667099 10:70170256-70170278 CCGCGGGGCTGATTCTGGGCGGG - Intronic
1070877386 10:79826378-79826400 CGGCGGGGCGGCGGCGGCGGCGG + Intergenic
1070954350 10:80454508-80454530 CCGCGGGGCCGCTCCTGGGCAGG - Intronic
1071997535 10:91162930-91162952 GCGCGGGGCGGGGGCTGGGCCGG - Intergenic
1072454107 10:95561263-95561285 CCGCTCGGCGGCGGCAGCGCCGG - Intronic
1072503672 10:96043685-96043707 CGGCGGGGCTGGGGCTGTGAGGG + Exonic
1073465607 10:103693104-103693126 GCGCGGGGCTGCAGCTGCAGGGG + Intronic
1074121647 10:110497993-110498015 CCGCGGGGCTGCGGCCGCGACGG - Exonic
1074755869 10:116623762-116623784 CCTGGGGGCTGCGGCGTCGCGGG - Intronic
1075031993 10:119029901-119029923 CTGAAGGGCTGCGGGTGCGCCGG - Exonic
1075106392 10:119542674-119542696 CGGCGGCGCGGCGGCTGAGCCGG + Exonic
1075466530 10:122655655-122655677 CAGCATGGCTGCGGCTGCGTGGG - Intergenic
1076000105 10:126906632-126906654 GCGCGGGGCTGCTGCTGAGACGG - Intronic
1076750063 10:132537988-132538010 CCGCGGGGCGTCAGCTGCGCCGG - Exonic
1076945022 10:133640706-133640728 CCCCGGGGCTGTGGCTCCGCCGG + Intergenic
1077069352 11:660908-660930 CCGCAGGGAAGCGGCTGCTCTGG + Intronic
1077101362 11:823983-824005 CAGCAGGGCTGCGGGTGGGCGGG - Exonic
1077281696 11:1748977-1748999 CCGGGGGGCTGCGGCAGACCCGG - Intronic
1077329419 11:1977387-1977409 CCGCAGGGCAGGGGCTGGGCAGG + Intronic
1077542882 11:3155774-3155796 CCGCGGGTCTGGGGCTTGGCTGG + Intronic
1077677770 11:4212208-4212230 CTGCGGGGCTGCGGCAGGGAGGG + Intergenic
1077922974 11:6655484-6655506 CCCCTGGGCTGCGGCAGCGGCGG - Intronic
1083039126 11:59669080-59669102 CCCGGCGGCGGCGGCTGCGCAGG + Intergenic
1083340518 11:61955887-61955909 CTGCGGTGCTGACGCTGCGCAGG - Exonic
1083579095 11:63813552-63813574 CGGCGGGGAGGGGGCTGCGCGGG + Exonic
1083885767 11:65572807-65572829 CGTCGTGGATGCGGCTGCGCTGG - Exonic
1083899201 11:65635585-65635607 GCTCGGGGTTGCGGTTGCGCAGG - Exonic
1083903002 11:65652703-65652725 CCACGGGGCTCCGGCTCCGGGGG - Intergenic
1084129140 11:67119621-67119643 CCGGGGGGCCGGGGCGGCGCGGG + Intronic
1084295763 11:68212956-68212978 GGGCGGGGCTGCGGCCGGGCCGG - Intronic
1085346104 11:75768961-75768983 CCGCGGGGCCGTGACTGGGCGGG + Exonic
1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG + Intergenic
1089273195 11:117315661-117315683 CCCTGGGGCTGCGGCTGCCCCGG - Exonic
1089661463 11:119988765-119988787 CCTCGGTGCTGCGGCTGCCCCGG - Intergenic
1091000996 11:131910778-131910800 CGGCGGGGCAGGGGCTGCGGCGG - Intronic
1091277185 11:134360478-134360500 CCGCAGGGCTGTGGCTGTGTTGG + Intronic
1202812399 11_KI270721v1_random:32566-32588 CCGCAGGGCAGGGGCTGGGCAGG + Intergenic
1092256137 12:6927832-6927854 GCGCGGGGCTGCGGACGGGCTGG - Intronic
1092258146 12:6938148-6938170 CTGCGGGGCTGTGGCTGGGTGGG + Intronic
1094475859 12:30840061-30840083 CTGCGGGGCTGAGGCAGTGCGGG + Intergenic
1095261718 12:40105830-40105852 CCGGGGGGACGCGGCTCCGCGGG + Exonic
1095949282 12:47773192-47773214 GCGCGGGGCGCCGGCTGCTCTGG + Exonic
1096156751 12:49345432-49345454 CCGCGGGGCCGGGGCTTCGGCGG + Intergenic
1096482454 12:51951704-51951726 CTGCTGGGCTGCGGCGGCGGCGG + Exonic
1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG + Intronic
1097232891 12:57522962-57522984 CCTCTGGGCCGCGACTGCGCAGG + Exonic
1097278627 12:57830483-57830505 CCTTGGGGCTGGGGCTGCTCTGG - Intronic
1098369141 12:69738855-69738877 ACGCGGGACTGCGCCTGCGCCGG - Intronic
1100444817 12:94650581-94650603 CCCCGCGGCGGCGGCGGCGCAGG - Intergenic
1100565428 12:95790277-95790299 GCGCGCGGCTGCTGCTGCTCTGG - Exonic
1101466919 12:104958352-104958374 CGGCGCGGCTGCGCTTGCGCGGG - Intronic
1101716664 12:107318526-107318548 CCGCGGAGCTGCGGCGGCGGCGG + Exonic
1101970720 12:109310084-109310106 GGGCGGGGCAGCGGCGGCGCGGG - Intergenic
1102487259 12:113266738-113266760 CTGCGGGGCTGGGGCTGCCCAGG - Intronic
1103547529 12:121712758-121712780 GCGCGTGGCTCTGGCTGCGCAGG + Intronic
1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG + Intronic
1103807472 12:123584559-123584581 CAGCGGGGCGGCGGCGGCGGCGG + Exonic
1104967104 12:132513321-132513343 CAGTGGGGCTGCGCCTGCCCAGG + Intronic
1104980175 12:132570135-132570157 CCGCGGGGCTGCGGGGGTGGCGG - Exonic
1105031495 12:132887432-132887454 CTGCGGGGCTGCGTGGGCGCGGG - Intronic
1105240836 13:18609021-18609043 CCGCGGGGCTGCGACCGTGCGGG - Intergenic
1105512240 13:21060981-21061003 CGGCGGGGCAGGGGCGGCGCGGG - Intronic
1106498781 13:30307467-30307489 CCGCGCGGCCGCGGCTGCCATGG - Exonic
1106516955 13:30464706-30464728 CCTCGCGGCGGCGGCGGCGCAGG - Intronic
1110630144 13:77698065-77698087 GTGCGGGGCGGCGGCCGCGCTGG - Intronic
1112504930 13:99969855-99969877 CCGAGGGGCTGCGGGCGCGCTGG + Intronic
1113379219 13:109787022-109787044 GGGCGGGGCCGCGGCTGGGCGGG + Intergenic
1115545624 14:34462564-34462586 CCGCTGGGCTGCGGGGGCCCCGG - Intronic
1115752336 14:36505507-36505529 CGGCGGAGCCGCGGCTGGGCGGG + Intronic
1117647270 14:57865640-57865662 CCGCGGGGATGCGGACGGGCGGG - Intronic
1117842253 14:59871271-59871293 CCGCGGGGTTGCAGCTTCCCTGG - Intergenic
1119701923 14:76761539-76761561 CGGCGGGGCTGCAGCAGCGGCGG + Intergenic
1121408322 14:93732825-93732847 CGGCGGGGCTGGGGCTGGGAAGG + Intronic
1121521944 14:94592097-94592119 CCCCGTGGCTGCCGCTGCTCTGG - Exonic
1122077551 14:99245914-99245936 TCGCTGGGCTGCTGCTGGGCTGG + Intronic
1122162296 14:99793299-99793321 TCGCGCGGCTGCGGCGGCGGCGG + Intronic
1122254768 14:100468757-100468779 CCTGGGGGCTGTGGCTGCGGTGG - Intronic
1122599082 14:102912419-102912441 GGGCGGGGCTGGTGCTGCGCTGG - Intergenic
1122645159 14:103189233-103189255 CCGCGGGGCTGCGGGGTCGAGGG + Intergenic
1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG + Intergenic
1123077868 14:105678332-105678354 CCGCGGGGCTGCGCTCGGGCTGG + Intergenic
1123490520 15:20776119-20776141 TCGCGGGGCTGCGACCGTGCGGG + Intergenic
1125524834 15:40368300-40368322 CCGCCGGGCGGCGGCAGCGTGGG - Exonic
1125536063 15:40441607-40441629 CGGCCGGGCGGCGGCGGCGCGGG + Intronic
1127752589 15:62060462-62060484 GCGCGGGGGTGGGCCTGCGCCGG - Intronic
1128322466 15:66703172-66703194 CAGCGAGGCGCCGGCTGCGCGGG - Exonic
1128841430 15:70854092-70854114 TCGCGGGACTGCGGCGCCGCCGG + Exonic
1128982490 15:72197659-72197681 GCGAGGGGCTGCTGCCGCGCGGG - Intronic
1129231645 15:74200328-74200350 CAGCGTGGCTGGGGCTGGGCAGG + Intronic
1129440769 15:75579365-75579387 CCGCGGGGCGGCCGCAGCGTTGG - Intergenic
1129917158 15:79283733-79283755 CTCCGGGGCTCCGGCCGCGCCGG - Intergenic
1130531135 15:84748549-84748571 GGGCGGGGCTGCGGCTCCGGGGG - Intergenic
1132251919 15:100341122-100341144 CGGCGGGGCGGCCGCGGCGCCGG + Exonic
1132342352 15:101086516-101086538 CGGCGGAGCCGCGGCCGCGCAGG - Intergenic
1202955353 15_KI270727v1_random:72422-72444 TCGCGGGGCTGCGACCGTGCGGG + Intergenic
1132741356 16:1414805-1414827 GCGCGGGGCTGGGGCGGGGCCGG - Intergenic
1132778519 16:1610524-1610546 CCGCGGGGACTCGGCGGCGCCGG + Intronic
1132885879 16:2181703-2181725 GGGCGGGGCTGGGGCTGGGCTGG + Intronic
1133232159 16:4371972-4371994 CCGGGAGGCGGCGGCGGCGCAGG - Exonic
1133295530 16:4750110-4750132 CCTGGGGGCTCAGGCTGCGCTGG + Exonic
1133784579 16:8964080-8964102 CCGCGGGGCTGCGGCGCAGGCGG - Intronic
1134084192 16:11345506-11345528 CCGCGGGGGTGCGGCTTCCGAGG + Exonic
1134402187 16:13920365-13920387 CCGAGGAGGTGCGGCCGCGCTGG + Exonic
1135115329 16:19718589-19718611 CCGCCGGGCAGCGGCTCCGCGGG + Intronic
1135745806 16:25015283-25015305 CCGCGGGGCTCGGGCCGGGCAGG + Exonic
1135897329 16:26419635-26419657 CTGCTGGGCTGCAGCTTCGCAGG - Intergenic
1137721178 16:50628364-50628386 CTGCCTGGCTGGGGCTGCGCTGG + Intronic
1138178732 16:54928869-54928891 GCCAGGGGCTGCGGCTGCGGCGG + Intergenic
1138455591 16:57119008-57119030 CCAGGGGGCTGCAGCTGCCCTGG + Intronic
1138507698 16:57486392-57486414 CGGCAGGGCGGCGGCGGCGCCGG + Exonic
1139364862 16:66427117-66427139 GGGCGGGGCTGCGGCAGGGCAGG + Intergenic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139952787 16:70680171-70680193 CGGCGGGACTGCGGCTCGGCGGG - Intronic
1140528932 16:75647747-75647769 CGCCGCGGCTGCTGCTGCGCAGG + Intronic
1141554256 16:84826634-84826656 CTGCGAGGCTGGGGCTGCCCTGG + Intronic
1141680163 16:85539026-85539048 CCGCGGGGCTGGCACTGTGCAGG - Intergenic
1141839689 16:86566912-86566934 CCTCGGGGCTGCCGATTCGCTGG + Intergenic
1142130956 16:88431263-88431285 CTGCTGGGCGGCGGCTGCTCTGG - Exonic
1142145336 16:88490695-88490717 CCTCCTGGCTGCGGCTGCCCAGG - Intronic
1142265142 16:89061025-89061047 CAGCTGGGCTGCTGCTGGGCAGG - Intergenic
1142312404 16:89321496-89321518 CTGCGGGGCAGGGGCTGCCCAGG + Intronic
1142374983 16:89702012-89702034 CCGCGGGGAAGCAGGTGCGCGGG + Intergenic
1142671232 17:1488270-1488292 CCGCCGGGCGGTGGCTGCGGGGG - Intronic
1142764329 17:2057105-2057127 CTGCGGGGCGGCGGCGGCGGCGG + Exonic
1143016184 17:3892459-3892481 GCGCGCGGCTCAGGCTGCGCAGG - Intronic
1143063354 17:4222209-4222231 CCGCGGGGCGGCGGGGGCGGCGG - Intronic
1143321323 17:6070758-6070780 CGGCGGGGCTGCACCTGCTCCGG + Intronic
1144109970 17:12021361-12021383 GCTCGGGGCTGCGGCGGAGCGGG + Intronic
1144623104 17:16830884-16830906 CCTGGGGGCTGCTGCTGTGCCGG + Intergenic
1144695795 17:17303313-17303335 CCCCGGGGCTCCGCCTCCGCCGG + Exonic
1144883327 17:18441832-18441854 CCTGGGGGCTGCTGCTGTGCCGG - Intergenic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1145815703 17:27793641-27793663 CCGCCGGGCCCCGGCTGTGCAGG - Intronic
1146008434 17:29176886-29176908 CCGCGGGGCTGCGGCTGCGCCGG - Intronic
1146481120 17:33205776-33205798 CCGCAGGGCTGGGACTGCGCTGG + Intronic
1147044739 17:37744274-37744296 CCGCGGGGCTGGGGCTGGGCCGG - Intronic
1147612808 17:41811715-41811737 AGGCGGCGCTGCGGCTGCACCGG - Exonic
1147996751 17:44363774-44363796 GCGCAGAGCTGGGGCTGCGCGGG - Exonic
1148054814 17:44787659-44787681 CAGTGGGGCTGCGGAGGCGCTGG - Intergenic
1148086697 17:44997940-44997962 CCTCTGGGCTGCGGCTCCCCTGG - Intergenic
1148113714 17:45162359-45162381 CAGCGGGGCTGCTGCTGCCACGG - Intronic
1148487986 17:48003553-48003575 CTGCCGGGCTGCTGGTGCGCAGG + Intergenic
1148568463 17:48647480-48647502 TCGCTGGGCTGCGGCTGGGGCGG - Intergenic
1148778678 17:50109864-50109886 CAGCTGGGCTGCCGCTGAGCTGG + Intronic
1148786896 17:50149998-50150020 CCGCGGCGCGGCGGCTGCTGAGG - Exonic
1148945756 17:51260491-51260513 CCCCGGGGCTTCGGCGGCGGCGG + Intergenic
1149806201 17:59620070-59620092 CTGCGGGGCAGTGGCTGCCCGGG - Exonic
1149994810 17:61400844-61400866 CCGCGGGGCCTCCTCTGCGCTGG - Intronic
1150137521 17:62703955-62703977 CCGCGTGGCTTCCGCTGGGCAGG - Intronic
1150217129 17:63477038-63477060 CCGCAGGGCGGCCGCGGCGCAGG + Intergenic
1150562072 17:66302801-66302823 CCGGGGAGCTGCGGCCGCGGAGG - Intronic
1151783787 17:76265440-76265462 ACGCGGGGCTGCGCGGGCGCGGG - Exonic
1151830212 17:76544994-76545016 CAGCGGGGCTGTGGCTGCCTGGG + Intronic
1151854360 17:76710695-76710717 CCGCGGGGCTGGGGGAGCTCGGG - Exonic
1152049225 17:77959215-77959237 CCGCGGGGCTCCGGTGGCGCGGG - Intergenic
1152368580 17:79871266-79871288 CCGAGGGGCGGAGGCTGCGGCGG - Intergenic
1152542137 17:80981753-80981775 CGGAGGGGCTGCGGCAGCGCCGG - Intergenic
1152600156 17:81258272-81258294 CTGCCGGGCTGAGGCTGAGCTGG - Intronic
1152817855 17:82418719-82418741 TCGCGGGACCGCGGCGGCGCAGG + Exonic
1153457565 18:5296400-5296422 CCCCGGCGCTGCGCCGGCGCCGG - Intronic
1154448133 18:14450886-14450908 CCGCGGGGCTGAGACCGTGCGGG + Intergenic
1155507787 18:26549029-26549051 GGTCGGGGCGGCGGCTGCGCCGG + Exonic
1158648798 18:59269066-59269088 CCGCGATGCTGCTGTTGCGCGGG + Exonic
1158954160 18:62523599-62523621 CCCCGGGGCGGCGGCGGCGGCGG - Exonic
1160025335 18:75211493-75211515 CCGCCGCGCTGCTGCTGGGCGGG - Intronic
1160408636 18:78659925-78659947 CTGCGAGGCTGCGGCTGGCCAGG + Intergenic
1160453444 18:78980153-78980175 CGGGGCGGCGGCGGCTGCGCGGG - Intergenic
1160691051 19:460840-460862 CCGCGGCCCGGCGGCGGCGCGGG - Exonic
1160930665 19:1568192-1568214 GGGCGGGGCGGCGGCGGCGCGGG + Intergenic
1160943559 19:1630984-1631006 CCGGGGGTCTGCGGCTGGGTGGG - Intronic
1161101591 19:2424469-2424491 ACACGGGGCTGGGGCTGCGAAGG + Intronic
1161389619 19:4014388-4014410 CCTGGGGGCTGGGGCTGCGGAGG - Intronic
1161450643 19:4343633-4343655 GCGCGGGGCTGCAGGGGCGCGGG + Intronic
1161808728 19:6459587-6459609 ACGCGGAGCGGCGGCAGCGCTGG - Exonic
1162341852 19:10096144-10096166 CCGCGGCGCTGGCGCTGCTCGGG - Exonic
1162398344 19:10430749-10430771 CCGCGGGCCCGGGGCTGGGCAGG + Intronic
1162591981 19:11597821-11597843 ACGCGGGGCTGCGGGGCCGCAGG - Intronic
1162730400 19:12715215-12715237 CCGCTGGGCTGGGGGTGGGCAGG - Intronic
1163017220 19:14463870-14463892 CCACGTGGGTGCGGCTGCTCCGG + Exonic
1163441297 19:17323822-17323844 GCGCGGGGCTCCGGCTGCGGCGG + Exonic
1163555915 19:17992898-17992920 CCGAGGGGCTGCCGTTGCTCTGG - Intronic
1163727682 19:18932027-18932049 CCACTGGGCTGCGGCGGCGTTGG + Exonic
1164595864 19:29530329-29530351 GCGCAGGGCTAGGGCTGCGCCGG + Intronic
1164835084 19:31350767-31350789 CCGGGCGGCGGCGGCTGAGCGGG + Intergenic
1165204519 19:34172454-34172476 CCGCGGCGCGGCGGCGGCGGCGG - Intergenic
1165349397 19:35268129-35268151 CAGGCGGGCGGCGGCTGCGCGGG - Intergenic
1165350558 19:35272873-35272895 TCGTGGGGCTGGGGCTGCTCTGG - Intronic
1165956950 19:39507067-39507089 CGGCGCGGCAGCGGCAGCGCAGG - Exonic
1166047077 19:40235936-40235958 CCTCGGGGCTGAGCGTGCGCGGG + Exonic
1166351672 19:42201765-42201787 CCTGGGGGCTGAGGCTGGGCAGG - Intronic
1166358667 19:42242487-42242509 CTGCGGGGCTCGGGCTGCCCGGG + Exonic
1166660449 19:44643822-44643844 CCGCGCGCCTGCGCCTGCGCAGG - Exonic
1166931416 19:46303774-46303796 GTGCTGGGCCGCGGCTGCGCAGG - Intronic
1167291229 19:48626157-48626179 CTGAGGGGCTGCGGCTTCGCAGG - Exonic
1167633490 19:50639820-50639842 GCGCGGGGCTGCGGCGGCGGCGG - Intronic
1168687315 19:58356757-58356779 TGGCGGGGCTGCGGCAGCACCGG - Exonic
925419945 2:3703700-3703722 CCGAGAGGCTGCGGCAGCGCGGG - Exonic
925976063 2:9142921-9142943 TCGCGGGGCAGAGGCGGCGCCGG - Intergenic
926202569 2:10812492-10812514 CGGCGGAGGTGCGGGTGCGCGGG - Intronic
926217114 2:10912390-10912412 GCGCGGGGCGGAGGCTGCGAGGG + Exonic
929242508 2:39666462-39666484 GCGCGGGGCCGCGGCTGGGAGGG - Intronic
930222103 2:48755527-48755549 CCGTGGGGCCGGGGCAGCGCAGG + Exonic
932178320 2:69622338-69622360 CGGGGAGGCTCCGGCTGCGCAGG - Intronic
932581688 2:72996269-72996291 ACGCGGGGCTGTGCCTGTGCTGG - Intronic
933886135 2:86720484-86720506 CAGGCGGGCTCCGGCTGCGCGGG + Exonic
933924046 2:87076222-87076244 CAGGCGGGCTCCGGCTGCGCGGG - Intergenic
934079054 2:88452279-88452301 CCGGGGGGCGGCGGCGGCGGCGG + Exonic
934954748 2:98608359-98608381 CCGCAGGGCGGCGCGTGCGCGGG - Exonic
935137727 2:100322096-100322118 CCGCGGGGCTGCGACGACGCGGG + Exonic
935591846 2:104852338-104852360 CTGCCTGGCTGCGGCTGGGCAGG + Intergenic
935672046 2:105564285-105564307 CCGCTGTGCTGCTGCTGCGCTGG - Intergenic
936126698 2:109794579-109794601 CCGGGGGGCGGCGGCGGCGGCGG + Intronic
936433182 2:112482009-112482031 CCCGGGGGCGGCGGCGGCGCAGG - Intergenic
937329355 2:121016158-121016180 CCGCGGGCCTGGGGCTGGGCTGG + Intergenic
938018394 2:127885990-127886012 CGGCGGGGCGGCGGCGGCGGCGG + Intergenic
938895242 2:135742487-135742509 TCGCGGGGGTCTGGCTGCGCAGG - Intronic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
941029217 2:160493104-160493126 GCGCGGGGCGGCGGCTTCCCTGG - Intronic
941104868 2:161341075-161341097 CCGCGGGGCTGGGGGAGCTCGGG - Intronic
942314199 2:174682939-174682961 CGGCGGGGGGGCGGCGGCGCCGG - Intergenic
944069894 2:195657100-195657122 CGGACGGGGTGCGGCTGCGCAGG + Intronic
947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG + Exonic
948116037 2:235494634-235494656 GCGCGGGGCGGCGGCGGCGGGGG + Exonic
948822653 2:240557804-240557826 CCGTGGGGCGGCGGGTGCGGGGG - Intronic
948835218 2:240623101-240623123 CCGCGGGGCTGCGAGTGCCGGGG - Intronic
1169486982 20:6042051-6042073 CCGGGTGGCGGGGGCTGCGCTGG + Exonic
1170629633 20:18056449-18056471 CCGCAGGGTAGCTGCTGCGCAGG - Intronic
1172083224 20:32358689-32358711 GCGCGGGGCTGGGGCGGCGGCGG - Exonic
1172604123 20:36203067-36203089 CTGCGGGGCTGCGGCTACCTGGG + Intronic
1172644551 20:36461622-36461644 TCGCGGGGCCGCGGCTGCTCCGG - Intronic
1173736145 20:45363107-45363129 GGGCGGGGCTGAGGTTGCGCAGG - Exonic
1173807420 20:45934946-45934968 CCGCGGGTGGGCGGCCGCGCCGG + Intronic
1174506942 20:51023090-51023112 CCGCCGGGCTCCGAGTGCGCCGG + Exonic
1175429527 20:58891680-58891702 CGGCCGGGCTGCGGCGGCGGCGG - Intronic
1176077393 20:63254582-63254604 ACCCGGGGCTGGGGCTGGGCCGG - Intronic
1176207194 20:63895438-63895460 CCCCCGGGCCGGGGCTGCGCGGG + Intronic
1176221137 20:63969824-63969846 CAGCGGGGCTGCGGCCGGGCCGG + Intronic
1176274455 20:64255880-64255902 CCGAGGGGCGGCGGCGGCGGCGG - Intronic
1176294099 21:5061409-5061431 CGGCAGGGCTGGGGCTGTGCTGG - Intergenic
1176448100 21:6839806-6839828 CCGCGGGGCTGCGCCCCTGCGGG - Intergenic
1176550031 21:8217039-8217061 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1176568958 21:8400074-8400096 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1176576872 21:8444309-8444331 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1176826270 21:13704828-13704850 CCGCGGGGCTGCGCCCCTGCGGG - Intergenic
1178791973 21:35708900-35708922 CCGTGGGGCAGAGGCTGAGCTGG - Intronic
1179561579 21:42219186-42219208 CTGCGGGGCCGAGGCTGCGCTGG - Exonic
1179563966 21:42234920-42234942 CCGCGGCGGAGCGGCGGCGCGGG + Intronic
1179863160 21:44202239-44202261 CGGCAGGGCTGGGGCTGTGCTGG + Intergenic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1180216090 21:46324543-46324565 GGGCGGGGCTGCGCCTGCGTCGG + Intronic
1180741043 22:18053579-18053601 CCCCGGGCCAGCGGCTGCGGAGG - Intergenic
1182337998 22:29598128-29598150 CGGGGAGGCTCCGGCTGCGCAGG + Intergenic
1183411784 22:37659153-37659175 CCGCGGGGCTGCGCCTGGCCGGG + Exonic
1183444476 22:37844084-37844106 GCGCTGGGCGGCGGCGGCGCGGG - Exonic
1183601659 22:38843743-38843765 CCGCCGGGCAGCGCCCGCGCCGG + Exonic
1183903347 22:41022188-41022210 GCGCGGGGCGGCGGAGGCGCGGG + Intergenic
1184258117 22:43298583-43298605 CGGCAGGGCAGCGGCTGGGCTGG - Intronic
1184282063 22:43442896-43442918 CCGCGGGGCTGTGACTGCTGGGG + Intronic
1184556110 22:45233944-45233966 GAGCGGGGCTGGGGCTGCACAGG + Intronic
1184766890 22:46576951-46576973 CCGCGGGGGCGCGCCTGCCCTGG - Intronic
1184766913 22:46576987-46577009 CCGCGGGGCGGGGGCGGGGCCGG + Intronic
1185268160 22:49915740-49915762 CCTTGGTGCTGAGGCTGCGCTGG - Intronic
1185279039 22:49962159-49962181 CAGCCGGGCTGGGTCTGCGCCGG + Intronic
1203254921 22_KI270733v1_random:133365-133387 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1203262977 22_KI270733v1_random:178444-178466 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
949089614 3:11737-11759 CGCCGGCGCTGCGCCTGCGCCGG - Intergenic
949105765 3:198064-198086 CCGCGCGGCTGCTGCTCCTCCGG - Intronic
950008060 3:9704122-9704144 CCGCGGGGCTCAGCCTGGGCAGG + Intronic
950316308 3:12004651-12004673 CCGGGGGGCGGCGGCGGCGGCGG - Exonic
950534325 3:13570533-13570555 CAGCAGGGCTGCGCCTGCGAGGG + Exonic
950773589 3:15331915-15331937 CCGCGGTGCCGCGGCCGGGCAGG + Intronic
953484952 3:43286527-43286549 CCGGGTAGCTGCGCCTGCGCGGG - Exonic
953867111 3:46593618-46593640 CCCCGGGGATGCGGCTGGCCAGG - Intronic
953947673 3:47163660-47163682 CCGCGGGCCTGCTGCGGCCCCGG + Intronic
954367651 3:50154961-50154983 CCCCGGGGGTGGGGCTGGGCGGG + Intergenic
954793440 3:53149176-53149198 CCTGGGGGCAGGGGCTGCGCCGG + Intergenic
955387569 3:58491884-58491906 CCGCGCGGCTCCGACTGCGCTGG + Intergenic
957083143 3:75655690-75655712 CCCCGTGGCTGTGGCTCCGCCGG - Intergenic
960952526 3:123008888-123008910 CTGGGGGGCTGCAGCTGCCCAGG + Intronic
961389202 3:126542417-126542439 CCCCGGGGCCGCGGCGGCCCAGG - Exonic
961692663 3:128681153-128681175 ACGCGGGGCTGCGGAGGCGGCGG + Intergenic
961827314 3:129605955-129605977 CCTCCAGGCTGCGGTTGCGCGGG + Exonic
963236844 3:142964030-142964052 GCGGGGAGCTGCGGCTGCGGGGG + Intergenic
963882680 3:150546227-150546249 CCTCGGCGCTCCGGCGGCGCGGG - Exonic
965576404 3:170222490-170222512 CCGCGCGGTTCCGGCTGCTCCGG + Exonic
965597055 3:170419959-170419981 CTGCGGGGCTGCGGTGACGCCGG + Intronic
966808762 3:183825637-183825659 GGGCGGTGCTGCGGCGGCGCGGG - Intergenic
968258176 3:197297952-197297974 CCGCGGGGGTGCGGCGGCCCAGG - Intronic
968565385 4:1309849-1309871 CCGCGGTGCTGACGCTGCTCAGG - Intronic
969415535 4:7055516-7055538 CCGCGTGCCCGGGGCTGCGCTGG - Exonic
970397336 4:15681877-15681899 CCGGGTCGCTGCGGCTGGGCTGG + Exonic
970810587 4:20088875-20088897 GCAGGAGGCTGCGGCTGCGCAGG - Intergenic
970824093 4:20252655-20252677 CCGCGGAGCTGCGGCTTATCTGG + Intergenic
971272152 4:25160197-25160219 CCCCGGGGCTCTGGCTCCGCCGG - Intronic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
972396527 4:38663745-38663767 CGGCGGCGCGGCGGCTGGGCCGG + Intergenic
972740363 4:41881755-41881777 CCGCGCGGCTGCGGCACCGTGGG - Intergenic
975219446 4:71797411-71797433 CTGCGAGGCTGCAGCTGAGCGGG - Intronic
976765336 4:88592614-88592636 CGGCGGAGCTGCAGCCGCGCTGG + Intronic
977206567 4:94170143-94170165 CTGGGAGGCTGGGGCTGCGCAGG - Intergenic
978777047 4:112515259-112515281 CGGCGTGGCTGCGGGTGCGGAGG - Exonic
978777060 4:112515292-112515314 GCGCGGGGCTGAGGCCGGGCAGG - Exonic
978778358 4:112524102-112524124 CCGCGGGGCTTCGGGGCCGCGGG + Intergenic
979785575 4:124712431-124712453 CCGGGGGGCGGCGGCGGCGGTGG - Intronic
980115249 4:128672917-128672939 CAGCGAGGCTGGGGCTGCACAGG - Intergenic
982729051 4:158935888-158935910 CGCCGGGGCTGCTGCTGAGCTGG + Intronic
982745979 4:159103994-159104016 CCGCGGGGGGGCGGCTCGGCTGG - Intergenic
984734956 4:183099691-183099713 GCGGGGGGCTGGGGCGGCGCCGG + Intronic
985448405 4:190041216-190041238 CCCCGGGGCTGTGGCTCCGCCGG + Intergenic
985792492 5:1937711-1937733 CCTCAGGGCTGCAGCTGCCCGGG + Intergenic
987374014 5:17217833-17217855 CCCCGGGTCCGCGGCGGCGCGGG - Intronic
988437585 5:31194048-31194070 GCGCGCGGGTCCGGCTGCGCGGG + Intronic
988577837 5:32444245-32444267 CAGCGGGGCGGCGGCGGCGGCGG - Exonic
988856138 5:35229756-35229778 CCGCGAGGCTGCTGCGGCGGCGG + Intronic
988856224 5:35230209-35230231 GCGCGCGGCAGGGGCTGCGCGGG - Intronic
989576459 5:42992664-42992686 CCGGGCGGCGGCGGCGGCGCTGG + Intergenic
990954734 5:61331251-61331273 CCGAGGGGCTGAGGCAGCGAGGG + Intergenic
993486031 5:88486870-88486892 CCGAGGGGCTGCGAATGGGCTGG + Intergenic
993803502 5:92374955-92374977 CCGGGAGGCTGGGGCTGTGCAGG + Intergenic
995724812 5:115170830-115170852 CCGCGGGGGTGCGGGGGTGCCGG - Intronic
996862652 5:128083708-128083730 CGGCGGGGCTGCGGCGGCGGCGG - Intergenic
996894567 5:128464765-128464787 CGGCAGGGCTGAGGCTGGGCTGG + Exonic
997305065 5:132830618-132830640 CCGCGCGGCTGCGACGGCCCAGG - Exonic
998797521 5:145835497-145835519 CCGCGGGGCCCCGGGTGCTCTGG - Intergenic
1000212392 5:159119427-159119449 CCAGGAGGCTGGGGCTGCGCAGG - Intergenic
1001065152 5:168529837-168529859 CCGCGGGGCGGAGGACGCGCTGG + Exonic
1001586758 5:172838036-172838058 CCTCGGGGGTGCCGCTGCACTGG + Intronic
1002006429 5:176238410-176238432 CGGCGGGGCGGCGGCAGCGGCGG - Exonic
1002209859 5:177592179-177592201 GCGGCCGGCTGCGGCTGCGCAGG + Exonic
1002327952 5:178421953-178421975 GGGCGGGGCTGAGGCTGCCCAGG + Intronic
1002895679 6:1378810-1378832 GCGCGTGGCTGCCGCGGCGCCGG - Intergenic
1002927147 6:1611180-1611202 CGGCGGCGCTGCCGCTGCCCAGG - Exonic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1003212337 6:4079105-4079127 GGCCGGGGCTGCGGCTCCGCGGG + Exonic
1003362668 6:5443667-5443689 CTGCGGGGCTGGGGCTCAGCTGG - Intronic
1003402185 6:5799782-5799804 CCATGGGGATGCGGCTGCCCAGG - Intergenic
1003911491 6:10747768-10747790 CCCCGGGGCCGCGGCAGGGCGGG - Exonic
1005385249 6:25279306-25279328 CTGCCGGGCTCCGGCTGGGCGGG - Intronic
1005526861 6:26659734-26659756 TTGCGGGGGTGGGGCTGCGCCGG - Exonic
1006114186 6:31766505-31766527 CAGCGGGGCGGCGCCTGCACAGG - Exonic
1006170209 6:32087909-32087931 CCGCGGGGCTGGGGCTGGCCGGG + Intronic
1006472510 6:34236743-34236765 CCGCGCGGCAGCGGCGGCGGCGG + Intergenic
1006642453 6:35496381-35496403 GCGCGGTGCCGCGGCTGCGCTGG - Intronic
1007072835 6:39049175-39049197 CCGCGGGGCAGCGGGTGCCCGGG - Intronic
1007739557 6:44002459-44002481 GCGCGGGGCTGGGGCTGGGAGGG - Intronic
1008932524 6:56955114-56955136 CGGCCAGGCTGCGGCAGCGCGGG + Intronic
1011983473 6:93416693-93416715 CCGAGGGACTGCGCCTCCGCGGG - Intronic
1012243191 6:96897544-96897566 CCGAGCGGCTGCGGCCGAGCAGG + Intronic
1012410245 6:98948015-98948037 CCGCGGGGTTGGGGCGGGGCCGG + Intergenic
1013117650 6:107115042-107115064 CCGCGCGGCGGCGGCAGCGTTGG - Intronic
1013242805 6:108261292-108261314 CCGCGGGGCTGCGGCCGAGGAGG + Intergenic
1013978210 6:116100812-116100834 GGGCGGGGCTGCGGCTGCCAGGG - Intergenic
1017053678 6:150419005-150419027 CAGAGGGGCTGGGGCTGCGCTGG - Intergenic
1017103174 6:150865993-150866015 CGCCGGGGCTGCAGCTGCTCCGG - Exonic
1017527694 6:155256596-155256618 CCGTGGGGCAGCCGCTGCTCTGG - Exonic
1017671863 6:156777254-156777276 CCGCGAGGCTGCGCCGGGGCGGG + Intergenic
1017819514 6:158039274-158039296 CAGCGGGGCTGCCGCTTCGCAGG - Intronic
1018727760 6:166627035-166627057 CCCCGGCCCTGCGGCTGCTCCGG - Intronic
1018974764 6:168556144-168556166 CCGGGGGTCCGCGGCTGTGCGGG + Intronic
1019111924 6:169724006-169724028 CCGCGCGGCGGCGGCGGCGGCGG - Exonic
1019440645 7:1044618-1044640 CCGCCCGGCGGCGACTGCGCCGG + Intronic
1019475152 7:1241003-1241025 CCGCGGGGCAGGGGCTGACCCGG - Intergenic
1020278333 7:6637573-6637595 CCGCGGGGAGGCGGCGGGGCCGG + Intronic
1021231105 7:18086900-18086922 CCGCGCGGCGGCGGCGGCGGCGG + Intergenic
1023773691 7:43583343-43583365 CCGCGGGCCTGGGGCGGCGGCGG - Exonic
1023984963 7:45088967-45088989 CCGAGGGGCGGTGGCCGCGCAGG - Intergenic
1026858374 7:73769522-73769544 CCGCGGCGCTGCAGCTGCTGGGG - Exonic
1027001487 7:74657608-74657630 GGGCGGCGCTGCGGATGCGCAGG + Intergenic
1027152053 7:75739566-75739588 CCGCGGGGCTGCGCTTTCCCGGG - Intergenic
1027654943 7:80919112-80919134 GCGCGCGGCTCCGGCTGCCCCGG + Exonic
1029280236 7:99430680-99430702 CCCCAGGGCTGCTGCTGGGCAGG - Intronic
1029437273 7:100570264-100570286 CCGCCAGGCTCAGGCTGCGCTGG - Intergenic
1029459236 7:100685934-100685956 CAGCGGGCCTGGGGCTGGGCCGG - Intronic
1029570195 7:101363606-101363628 CCGCGGGGCTGCGGGGCTGCGGG + Intronic
1029834760 7:103297494-103297516 CCGCGGCGCGGCGGCGGCTCTGG + Exonic
1030980653 7:116182044-116182066 CGGGGAGGCTGCGGCCGCGCAGG + Intergenic
1032525707 7:132577099-132577121 GCGCGGGGCTGCGGCGGTGGTGG + Exonic
1033333726 7:140435319-140435341 CTGGGTGGCTGCGGCTGTGCTGG + Intergenic
1033477165 7:141702115-141702137 ACGCGGCGCCGCTGCTGCGCTGG - Exonic
1034159647 7:148983365-148983387 CCGCGGGGGTGGGGCCGGGCGGG - Intergenic
1034343422 7:150371883-150371905 CCGCGGGGCGGCCCCTGGGCCGG - Exonic
1034446114 7:151115097-151115119 CCCCGCGGGTGCGGCTGCGCCGG - Intronic
1034478697 7:151303586-151303608 CGCAGGGGCTGCGGCTGGGCGGG + Intergenic
1034967512 7:155400326-155400348 CAGCGGGGCTGCAGCTGGGGTGG - Intergenic
1036454199 8:8893412-8893434 CCGCGGGACCGCGGCTGCGAGGG - Exonic
1036482478 8:9151060-9151082 CCCGGGAGCTGCGGCTGCGGCGG - Intronic
1036910569 8:12754671-12754693 GCGCGGGGATGCGGCGGGGCCGG - Intronic
1038828543 8:31033162-31033184 GCGGGGGGCGGCGGCTGCGGCGG - Exonic
1040804379 8:51377813-51377835 CCGGGAGGCTGGGGCTGCGCAGG - Intronic
1042155732 8:65842143-65842165 CCTGGGCGCTGCGGCGGCGCGGG - Intronic
1044934279 8:97278001-97278023 CGCCGCCGCTGCGGCTGCGCAGG + Intergenic
1045231433 8:100310277-100310299 CAGCGGGGCGGCTCCTGCGCGGG - Intronic
1045743304 8:105387393-105387415 CGGGGAGGCTCCGGCTGCGCAGG + Intronic
1047100150 8:121667507-121667529 CTGGGAGGCTGGGGCTGCGCAGG + Intergenic
1049222273 8:141433568-141433590 CCTGGGGGCTGGGGCTGGGCAGG - Intergenic
1049336669 8:142090206-142090228 AGGCGGGGCCGCGGCTGCACAGG + Intergenic
1049615630 8:143574711-143574733 CTCCCGGGCTGCGGCTGGGCTGG - Intergenic
1049799437 8:144510935-144510957 CCACGGGGCTGGGGCTGTGTGGG + Intronic
1051459303 9:17294737-17294759 CGGGGAGGCTGTGGCTGCGCAGG + Intronic
1051780580 9:20684400-20684422 CTGCGGGGCTGGGGCTGAGCTGG + Intronic
1053178325 9:35945554-35945576 CAGCTGGGCTGCGGCTGGGTCGG + Intergenic
1053475277 9:38377829-38377851 CAGGGAGGCTCCGGCTGCGCAGG - Intergenic
1057488542 9:95505855-95505877 GCGCGGGGCTGCGGAGGCGGCGG - Intronic
1057494955 9:95553496-95553518 CGGCGGGGCGGCGGCTGGGGCGG - Intergenic
1057547260 9:96027609-96027631 GCGCTGGGCGGCGGCGGCGCCGG - Intergenic
1058348980 9:103999353-103999375 CCGCGGGCCGGCGGGTGAGCTGG + Intergenic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1059305403 9:113349767-113349789 CCGAGGAGCTGCGGGTGAGCGGG + Exonic
1060106664 9:120877090-120877112 CCGCGAGGCTGCGTGTCCGCCGG + Exonic
1060531555 9:124349990-124350012 CCCGGGGGCTACTGCTGCGCAGG - Intronic
1060661675 9:125408408-125408430 CCGCTGGGCCTCGGCTGCGAAGG + Intergenic
1060811750 9:126614323-126614345 CCGCAGGGCAGGGGTTGCGCCGG - Intergenic
1060814318 9:126626773-126626795 CCGCGGGGCTGGGGGTGGGGCGG - Intronic
1060986045 9:127819566-127819588 CCCAGGGGCTGCTGCTGGGCCGG - Intronic
1061299660 9:129697378-129697400 CAGCTGGGCGGCGGCGGCGCGGG + Intronic
1061299675 9:129697447-129697469 CCGCGGGACTGCGGCGAGGCAGG + Intronic
1061330692 9:129890418-129890440 CCGCAGGGATGGGGCTGCGGAGG + Exonic
1061541074 9:131278022-131278044 CCGCGGGGATGCAGGTCCGCAGG + Intergenic
1061883008 9:133577360-133577382 CCGGGGGGCCGGGGCTGCGAGGG + Intergenic
1062022520 9:134326234-134326256 TCGCGGGGCGGCGGCGGCGGAGG + Intronic
1062022562 9:134326358-134326380 CCGCGGCGCTGCGGCGCCGGCGG - Intronic
1062068417 9:134541146-134541168 CAGAGGGGCTGCGGCTTTGCAGG + Intergenic
1062162469 9:135087829-135087851 GCGCGGGGCGGCGGCGGCGGCGG + Exonic
1062230606 9:135479813-135479835 GCGCGGGGCGGCGGCAGCGGCGG + Exonic
1062462115 9:136666362-136666384 CTGCGGGGCTGCTGCCGGGCAGG + Intronic
1062501731 9:136854710-136854732 CCACTGGGCTGTGGCTGCGTGGG - Intronic
1203521090 Un_GL000213v1:44712-44734 CCGCGGGGCTGCGCCCCTGCGGG + Intergenic
1203471323 Un_GL000220v1:116511-116533 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1203479144 Un_GL000220v1:160483-160505 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1203613246 Un_KI270749v1:28143-28165 CCCCGGTGCTGCGGCTGTGAGGG + Intergenic
1185736495 X:2500483-2500505 GCGCGGGGGGGCGGCTGCACGGG + Intronic
1190440492 X:50470651-50470673 CCGCGGAGCTGCCGCAGCCCAGG - Exonic
1195954797 X:110317833-110317855 CCCCAGGGCTGCGGCGGCGGCGG - Exonic
1196886531 X:120251190-120251212 CCGAGGGGCTGCCGGTGCCCTGG + Intronic
1200098202 X:153673901-153673923 CTGCGGCGCCGCGGCCGCGCTGG - Intronic
1201304843 Y:12541660-12541682 CTGCAGGGCTGAGGCTGGGCTGG - Intergenic