ID: 1146008434

View in Genome Browser
Species Human (GRCh38)
Location 17:29176886-29176908
Sequence CCGCGGGGCTGCGGCTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 435}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008434_1146008452 26 Left 1146008434 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1146008452 17:29176935-29176957 CCGGAAGGCAGCAATCCCGCGGG 0: 1
1: 0
2: 1
3: 3
4: 66
1146008434_1146008443 7 Left 1146008434 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1146008443 17:29176916-29176938 CGCTGCGATCCCATCTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 117
1146008434_1146008444 11 Left 1146008434 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1146008444 17:29176920-29176942 GCGATCCCATCTCCCCCGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 54
1146008434_1146008450 25 Left 1146008434 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1146008450 17:29176934-29176956 CCCGGAAGGCAGCAATCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008434 Original CRISPR CCGCGGGGCTGCGGCTGCGC CGG (reversed) Intronic