ID: 1146008435

View in Genome Browser
Species Human (GRCh38)
Location 17:29176886-29176908
Sequence CCGGCGCAGCCGCAGCCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 7, 3: 27, 4: 354}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008431_1146008435 -10 Left 1146008431 17:29176873-29176895 CCCCGCGGCTGGGCCGGCGCAGC 0: 1
1: 0
2: 1
3: 19
4: 247
Right 1146008435 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 7
3: 27
4: 354
1146008427_1146008435 1 Left 1146008427 17:29176862-29176884 CCTTGGCGTTTCCCCGCGGCTGG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1146008435 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 7
3: 27
4: 354
1146008424_1146008435 10 Left 1146008424 17:29176853-29176875 CCGGGCGGCCCTTGGCGTTTCCC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1146008435 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 7
3: 27
4: 354
1146008420_1146008435 25 Left 1146008420 17:29176838-29176860 CCGCCGCGCGGGGAGCCGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 256
Right 1146008435 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 7
3: 27
4: 354
1146008426_1146008435 2 Left 1146008426 17:29176861-29176883 CCCTTGGCGTTTCCCCGCGGCTG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1146008435 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 7
3: 27
4: 354
1146008422_1146008435 22 Left 1146008422 17:29176841-29176863 CCGCGCGGGGAGCCGGGCGGCCC 0: 1
1: 0
2: 4
3: 35
4: 258
Right 1146008435 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 7
3: 27
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008435 Original CRISPR CCGGCGCAGCCGCAGCCCCG CGG Intronic