ID: 1146008443

View in Genome Browser
Species Human (GRCh38)
Location 17:29176916-29176938
Sequence CGCTGCGATCCCATCTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008437_1146008443 -8 Left 1146008437 17:29176901-29176923 CCCCGCGGCGCCTCCCGCTGCGA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1146008443 17:29176916-29176938 CGCTGCGATCCCATCTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 117
1146008433_1146008443 18 Left 1146008433 17:29176875-29176897 CCGCGGCTGGGCCGGCGCAGCCG 0: 1
1: 0
2: 1
3: 18
4: 299
Right 1146008443 17:29176916-29176938 CGCTGCGATCCCATCTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 117
1146008431_1146008443 20 Left 1146008431 17:29176873-29176895 CCCCGCGGCTGGGCCGGCGCAGC 0: 1
1: 0
2: 1
3: 19
4: 247
Right 1146008443 17:29176916-29176938 CGCTGCGATCCCATCTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 117
1146008438_1146008443 -9 Left 1146008438 17:29176902-29176924 CCCGCGGCGCCTCCCGCTGCGAT 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1146008443 17:29176916-29176938 CGCTGCGATCCCATCTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 117
1146008436_1146008443 -2 Left 1146008436 17:29176895-29176917 CCGCAGCCCCGCGGCGCCTCCCG 0: 1
1: 0
2: 6
3: 63
4: 497
Right 1146008443 17:29176916-29176938 CGCTGCGATCCCATCTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 117
1146008432_1146008443 19 Left 1146008432 17:29176874-29176896 CCCGCGGCTGGGCCGGCGCAGCC 0: 1
1: 0
2: 4
3: 29
4: 329
Right 1146008443 17:29176916-29176938 CGCTGCGATCCCATCTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 117
1146008439_1146008443 -10 Left 1146008439 17:29176903-29176925 CCGCGGCGCCTCCCGCTGCGATC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1146008443 17:29176916-29176938 CGCTGCGATCCCATCTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 117
1146008434_1146008443 7 Left 1146008434 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1146008443 17:29176916-29176938 CGCTGCGATCCCATCTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008443 Original CRISPR CGCTGCGATCCCATCTCCCC CGG Intronic