ID: 1146008450

View in Genome Browser
Species Human (GRCh38)
Location 17:29176934-29176956
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 62}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008442_1146008450 -4 Left 1146008442 17:29176915-29176937 CCGCTGCGATCCCATCTCCCCCG 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1146008450 17:29176934-29176956 CCCGGAAGGCAGCAATCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 62
1146008437_1146008450 10 Left 1146008437 17:29176901-29176923 CCCCGCGGCGCCTCCCGCTGCGA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1146008450 17:29176934-29176956 CCCGGAAGGCAGCAATCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 62
1146008439_1146008450 8 Left 1146008439 17:29176903-29176925 CCGCGGCGCCTCCCGCTGCGATC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1146008450 17:29176934-29176956 CCCGGAAGGCAGCAATCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 62
1146008434_1146008450 25 Left 1146008434 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1146008450 17:29176934-29176956 CCCGGAAGGCAGCAATCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 62
1146008440_1146008450 0 Left 1146008440 17:29176911-29176933 CCTCCCGCTGCGATCCCATCTCC 0: 1
1: 0
2: 1
3: 16
4: 194
Right 1146008450 17:29176934-29176956 CCCGGAAGGCAGCAATCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 62
1146008438_1146008450 9 Left 1146008438 17:29176902-29176924 CCCGCGGCGCCTCCCGCTGCGAT 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1146008450 17:29176934-29176956 CCCGGAAGGCAGCAATCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 62
1146008441_1146008450 -3 Left 1146008441 17:29176914-29176936 CCCGCTGCGATCCCATCTCCCCC 0: 1
1: 0
2: 3
3: 12
4: 271
Right 1146008450 17:29176934-29176956 CCCGGAAGGCAGCAATCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 62
1146008436_1146008450 16 Left 1146008436 17:29176895-29176917 CCGCAGCCCCGCGGCGCCTCCCG 0: 1
1: 0
2: 6
3: 63
4: 497
Right 1146008450 17:29176934-29176956 CCCGGAAGGCAGCAATCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type