ID: 1146008799

View in Genome Browser
Species Human (GRCh38)
Location 17:29178727-29178749
Sequence TTCCCCACCCTTTTTAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008799_1146008803 9 Left 1146008799 17:29178727-29178749 CCTGAACTAAAAAGGGTGGGGAA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1146008803 17:29178759-29178781 AGGCCTGTTGCCACAACAACAGG 0: 1
1: 0
2: 1
3: 17
4: 130
1146008799_1146008804 10 Left 1146008799 17:29178727-29178749 CCTGAACTAAAAAGGGTGGGGAA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1146008804 17:29178760-29178782 GGCCTGTTGCCACAACAACAGGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008799 Original CRISPR TTCCCCACCCTTTTTAGTTC AGG (reversed) Intronic
901456987 1:9368662-9368684 TCGCCCTCCCTTCTTAGTTCTGG - Exonic
907519194 1:55012095-55012117 TTGCCCACCCTTTCCAGTTAAGG - Intergenic
909423886 1:75499174-75499196 TTCCCCAACCTTTTTGGCACCGG + Intronic
914718985 1:150273776-150273798 TTTCCTACCTTTTTTAGGTCTGG + Intronic
918912225 1:190589962-190589984 TTCTCCAGCCTTTTTGGTCCTGG + Intergenic
919327991 1:196133826-196133848 TTCCAGACCCTTTTTATCTCAGG - Intergenic
920514484 1:206574653-206574675 TTCCCAACCCTTTTAATTTTGGG + Intronic
920660604 1:207911206-207911228 CTCCCCTCCCTTTTTAGTCTTGG + Exonic
921432569 1:215082148-215082170 TTCCCCATCCTTTTCGGTCCCGG + Intronic
923081795 1:230664181-230664203 TTCCCCATCTTTTTTAGGACAGG - Intronic
1064366780 10:14715749-14715771 TTCCCCAGCCTTTGTACTCCAGG + Intronic
1065325161 10:24544403-24544425 TCCCCGACCCTTGCTAGTTCCGG + Exonic
1066450340 10:35522618-35522640 ATCCTCACCCTCTTTAGTTTTGG - Intronic
1067376010 10:45727853-45727875 TTTCCCACCCCATTTAGTCCAGG - Intronic
1067883710 10:50068541-50068563 TTTCCCACCCCATTTAGTCCAGG - Intronic
1068519932 10:58066984-58067006 TTCCCCACTCTTTTAAATTTTGG - Intergenic
1073211535 10:101807174-101807196 TTCCCCACACTTCCTTGTTCAGG - Intronic
1073439807 10:103545734-103545756 TGCCACACCCTTTTTCTTTCTGG + Intronic
1074073062 10:110092715-110092737 TTCCCCACCCCTTTTATGTTAGG - Intronic
1074585810 10:114767546-114767568 CTCCCCACCCATTTTCTTTCTGG - Intergenic
1080017314 11:27521132-27521154 TTCCACACCCCTTTGAGTTAAGG + Intergenic
1081581731 11:44356764-44356786 TTGGCCACCCTTTTTTTTTCTGG + Intergenic
1084452918 11:69250745-69250767 TGCCCCTCCCTTTTTCATTCAGG + Intergenic
1088467595 11:110158061-110158083 TTTCCCACCATTGTAAGTTCTGG - Intronic
1095181986 12:39156895-39156917 TTCCCTCCCCTTTCTTGTTCTGG - Intergenic
1095991901 12:48040707-48040729 TCCTCCATCCTTTTTATTTCCGG - Intergenic
1097107221 12:56632973-56632995 TTCCCCACCCATTTCCCTTCAGG + Intronic
1097990835 12:65831511-65831533 TTCACCACCCTTTTGACTTTAGG + Intronic
1100435594 12:94568494-94568516 TTCCCCACCCCTTTCATTTATGG - Exonic
1100844231 12:98643489-98643511 TTTCCCAGCCTTTTTTTTTCTGG - Intronic
1107536953 13:41344706-41344728 TTCCCCACCTATTTTTGTTTTGG + Intronic
1109189800 13:59310557-59310579 TTACCCAACTTTTCTAGTTCAGG + Intergenic
1112537727 13:100276496-100276518 TTCTCCACCATTATTACTTCTGG + Intronic
1113180160 13:107615663-107615685 CACCCCACCCTTTTTATATCAGG - Intronic
1114304513 14:21409846-21409868 CTTACCACCCTTTTGAGTTCTGG + Exonic
1125287143 15:38105821-38105843 CTCCACACCATTTTTTGTTCAGG + Intergenic
1126142429 15:45449127-45449149 TTCCCCACCATCATTAATTCTGG + Intergenic
1126489921 15:49225596-49225618 GTCCCCAACCTTTTTAGCACAGG - Intronic
1126693872 15:51309516-51309538 TTCACTTCCCTTTTGAGTTCTGG + Intronic
1127366864 15:58299467-58299489 TTCCCCAGCCCTCTTAGGTCAGG + Intronic
1129947428 15:79551500-79551522 TTTCCCATCCTTTTTAGTTCTGG - Intergenic
1141220394 16:82064030-82064052 GTCCCCACCCTTTTGTGTTCTGG - Intronic
1144351833 17:14403920-14403942 TTCTCCACCCTTTTGCCTTCTGG - Intergenic
1146008799 17:29178727-29178749 TTCCCCACCCTTTTTAGTTCAGG - Intronic
1147792384 17:43021706-43021728 TCCCCAACCATTTTTAGTTGTGG - Intronic
1148398357 17:47329278-47329300 CCCCCCACCCTTTTGTGTTCTGG - Intronic
1148408439 17:47442588-47442610 TTCCCTCCCTTTTTTATTTCTGG + Intergenic
1148551788 17:48554899-48554921 TTCCCCACCCCCTCTTGTTCTGG - Intronic
1148823755 17:50377167-50377189 TTCCCCACACTTTTTACTCTGGG + Intronic
1150661794 17:67087231-67087253 TTCCCCGCCCTTTTTCTTTTTGG - Intronic
1155687584 18:28574371-28574393 TCCCCCACCCTTTTCTCTTCAGG - Intergenic
1161791446 19:6362323-6362345 TTCCCCATCCCTTTTACTTTGGG + Intronic
1162634179 19:11953690-11953712 TTCCCCACCTTTTTTATTGTGGG - Intronic
1165667057 19:37640836-37640858 TCCCCCACCCCTTTTTTTTCTGG + Intronic
1166659776 19:44639040-44639062 TCCCCCACACTTTTGAGGTCAGG - Intergenic
926328300 2:11804262-11804284 TTCCCCACCCTTCCTTGTTCTGG - Intronic
927392871 2:22615196-22615218 TTCCTAAGTCTTTTTAGTTCAGG - Intergenic
927908386 2:26878958-26878980 TTCCCCACCCTTTCTGGTACCGG + Intronic
928793643 2:34990274-34990296 TGCCCCACCCATTTTATTCCTGG - Intergenic
931430786 2:62207513-62207535 GTCCCCAGCCTTTTTAGCACTGG + Intronic
935635172 2:105244239-105244261 TTTCCCACCCTCTTCAGATCTGG - Intergenic
939745996 2:145968530-145968552 TTCCTGGCCCTTTTGAGTTCAGG + Intergenic
941875106 2:170424028-170424050 TTCCCCACGCTTTTTGGTCATGG - Intronic
942798522 2:179849521-179849543 TACCCCACCCATTCTATTTCAGG - Intronic
946521210 2:220467012-220467034 TTCTCCAGCCTTTTTTCTTCAGG - Intergenic
947935747 2:234002018-234002040 TTTCCCACACTTTTTAATTAAGG - Intronic
948168748 2:235883488-235883510 TTCCCCACAGTGTTTAGTTGAGG - Intronic
948433878 2:237939042-237939064 TTCTCCTCCCTTTGGAGTTCAGG - Intergenic
1168851096 20:977729-977751 TTCCCCATCCTTCTTAGCCCTGG - Intronic
1168914098 20:1472244-1472266 TTCCCCACCCTTTCTATCTGTGG + Intronic
1169093337 20:2874315-2874337 GTCCCCTCCCTTTTTACTTTCGG + Intronic
1171155399 20:22867966-22867988 TTTCCCTTCCTTTTTAGTTTGGG - Intergenic
1172787194 20:37476486-37476508 TTCCCAACCCTTTTCCTTTCTGG + Intergenic
1173152579 20:40580503-40580525 CTACTCACCCTTGTTAGTTCTGG + Intergenic
1173761324 20:45563121-45563143 CTCCCCAACCTTTTTTGTTGGGG + Intronic
1179138802 21:38704169-38704191 TTCCTCACCCTTTTCCGGTCTGG + Intergenic
1179366766 21:40765952-40765974 TTCCCCACCCTGTGCAGCTCTGG + Intronic
1183307050 22:37088149-37088171 GTCCCCACCCTTTTTGGACCTGG + Intronic
950884706 3:16353233-16353255 TTCCCCACCCTTTTGGCCTCTGG - Intronic
955567417 3:60262452-60262474 ATCCCCACCCTTTTTGGTTCTGG + Intronic
957194656 3:77051801-77051823 GTCCCCTCCCCTTATAGTTCAGG - Intronic
960123179 3:113968452-113968474 TTCCCCCCCCTTTTTTTTTTAGG + Intronic
962649844 3:137477489-137477511 CTCCCCACCCCCTTTAATTCTGG + Intergenic
964237785 3:154554178-154554200 TTCCCCAACCTGTCTAGTCCTGG - Intergenic
964898231 3:161623727-161623749 TTCCCCACTCTTTTATGTCCTGG + Intergenic
966895326 3:184440587-184440609 TCCCCCACCTTTTTTTTTTCAGG + Intronic
967472539 3:189879123-189879145 TTCCCCATCCATTTTTATTCGGG + Intronic
972558208 4:40201647-40201669 CTCCCCACCTTTTTTTTTTCGGG + Intronic
973059956 4:45711275-45711297 TTCTCAACTCTTGTTAGTTCTGG - Intergenic
974818020 4:67031152-67031174 TTCCCCACCCTTTTTGTCCCAGG - Intergenic
976958513 4:90935677-90935699 TTCCCAACCCAATTTAGTCCTGG - Intronic
977406933 4:96611401-96611423 CTCACTACCCTTTCTAGTTCAGG - Intergenic
978238265 4:106486976-106486998 TTCCTCTCCCTTTTGAGTGCTGG + Intergenic
979741073 4:124151797-124151819 TCCCCCACCCTCTTTATATCTGG - Intergenic
982166871 4:152621289-152621311 TTCCCCACCTTCATTAGTACAGG - Exonic
983477643 4:168234303-168234325 TTCTCCACCATTTTTTTTTCTGG + Intronic
983648115 4:170012206-170012228 TTCCCCACTGCTTTTGGTTCAGG - Intronic
984411111 4:179399207-179399229 TTCCCCACCATTTGTGGTTTGGG + Intergenic
993708240 5:91195823-91195845 TACCCCAACCTTTGTAGTCCTGG + Intergenic
999654998 5:153802557-153802579 TTCCCCACCCTTTCTAGCAAAGG - Intronic
1000983221 5:167839375-167839397 TTCTGCACCCTTTTTAATTATGG - Intronic
1003087909 6:3076225-3076247 TCCCTCAGCCTTTTTATTTCTGG - Intronic
1004511495 6:16287550-16287572 TTCCCAACCATTTTCATTTCGGG - Intronic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1010813507 6:80327694-80327716 TTCCCCACCCATTTTGTTTATGG + Intronic
1012566634 6:100664233-100664255 TTCCCTACACTTTTTACTTAAGG + Intronic
1014012682 6:116494327-116494349 TTCCCCACCCCTTTAAAATCAGG - Intergenic
1015579430 6:134707397-134707419 GTCAGCAGCCTTTTTAGTTCTGG - Intergenic
1017808042 6:157963326-157963348 TTTCCCACTCTCTTTACTTCCGG - Intergenic
1019724005 7:2590756-2590778 TTCCCTACACTTTTGAGTTGAGG - Intronic
1021240651 7:18196736-18196758 CCCTACACCCTTTTTAGTTCAGG - Intronic
1021827759 7:24572593-24572615 AACCCCACCCTTTTGAGGTCTGG + Intergenic
1022656105 7:32320503-32320525 TTCCCCCCACTTTTAAGTTCAGG - Intergenic
1022793020 7:33707457-33707479 TTCCCTCCCCTTTTTAATTCAGG - Intergenic
1023974457 7:45017737-45017759 TTCCCTCCCTTTTGTAGTTCAGG - Intronic
1028118376 7:87027875-87027897 TTCCCCCCTCTTTCTAGTTTGGG - Intronic
1030095151 7:105892058-105892080 TTCCCCACCTCTTCCAGTTCCGG - Intronic
1030957496 7:115873020-115873042 TTGCCTATCCTTTTCAGTTCTGG + Intergenic
1034026394 7:147708745-147708767 TTCCCCTTCCTTTTTTGTTTTGG + Intronic
1034108242 7:148510478-148510500 TACACCTCCCTTTTTAGTACAGG + Intergenic
1035518317 8:255466-255488 ATCCCCACTGTTTTTACTTCGGG - Intergenic
1036038151 8:5042846-5042868 CTCCCCATCCTTTTTGGTCCAGG + Intergenic
1039042905 8:33425024-33425046 TTCATCACACTTTTGAGTTCTGG - Intronic
1040472561 8:47747074-47747096 CTCCCCTCCCTTTTTTTTTCTGG + Intergenic
1041542036 8:58996098-58996120 TTCCACTCTCTTTTTAGTCCTGG + Intronic
1045937895 8:107704002-107704024 TTCCCCTCCCTGTTTATTTCAGG - Intergenic
1046410753 8:113839466-113839488 TTCACCACCCTTGTTAATTGTGG + Intergenic
1046645694 8:116783057-116783079 CTCCCCTCCCTTTTTAGTTGTGG - Intronic
1047922885 8:129653759-129653781 TTTCTCACCCTTTATAGATCTGG + Intergenic
1049191657 8:141291462-141291484 TTGCCCCCCCTTTTTTGTTTTGG - Intronic
1050145965 9:2568048-2568070 TTCCCCACCCCTTTTAAGTCTGG + Intergenic
1050406142 9:5310211-5310233 TTTTGCACCCTATTTAGTTCTGG + Intergenic
1050862108 9:10448175-10448197 TTTTCCACCCTATTTAGTTATGG - Intronic
1053455516 9:38230561-38230583 TTCCCCATCCCTTCCAGTTCAGG - Intergenic
1055552417 9:77444152-77444174 TGCCCCACCATGTTTGGTTCTGG + Intronic
1056453121 9:86735577-86735599 GTCTCCACCCTTTGGAGTTCAGG + Intergenic
1057360292 9:94367158-94367180 TTCCCCAAACTTTTAGGTTCAGG + Intergenic
1057468208 9:95335435-95335457 TTCCTCACCTTTCTTAGTTCTGG + Intergenic
1057663048 9:97020919-97020941 TTCCCCAAACTTTTAGGTTCAGG - Intergenic
1058320952 9:103630064-103630086 TGCGCCTCCCTGTTTAGTTCTGG + Intergenic
1059060858 9:111034388-111034410 TTCCCCTCTCTTTTTTGTTTAGG - Intronic
1186148617 X:6650501-6650523 GCCCCCACACTTTTGAGTTCCGG - Intergenic
1186413781 X:9365866-9365888 TGCCCCACACTTTTCAGGTCTGG - Intergenic
1186654163 X:11594757-11594779 ATCCCCAACCTTTTTGGTACCGG - Intronic
1187903245 X:24043880-24043902 TTCCCCCGACTTTTAAGTTCAGG - Intergenic
1188397319 X:29701706-29701728 TTCTCCACCCTTTGGAGGTCAGG - Intronic
1189588274 X:42484303-42484325 TTCCTCAGCCTTTTTGCTTCTGG + Intergenic
1191963452 X:66729050-66729072 CTCCCCACCCTCTGTAGTTGGGG + Intergenic
1192024920 X:67439618-67439640 TTCCTCACAATTCTTAGTTCTGG + Intergenic
1192607706 X:72536742-72536764 TTCCCAACCTTTTTTGGCTCTGG + Intronic
1193177086 X:78406950-78406972 TTCCCCACCATTTTTATATTTGG - Intergenic
1195124326 X:101790490-101790512 CTCCCCACCATGTATAGTTCAGG + Intergenic
1196073798 X:111552552-111552574 TTCCCCACCCTTTTATATTCTGG + Intergenic
1199080192 X:143568272-143568294 ATCACCACCCTTTTCTGTTCTGG + Intergenic
1199295156 X:146148932-146148954 TTCCCTACCCTTTTTCTGTCAGG - Intergenic
1201535006 Y:15037711-15037733 TTCCCCACCCTAGTCACTTCAGG - Intergenic