ID: 1146008905

View in Genome Browser
Species Human (GRCh38)
Location 17:29179269-29179291
Sequence CAGAATGAGCTAGAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008905_1146008916 27 Left 1146008905 17:29179269-29179291 CCCCCCACCTCTAGCTCATTCTG 0: 1
1: 0
2: 4
3: 20
4: 322
Right 1146008916 17:29179319-29179341 GACACATGTGCCTTGCAGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 122
1146008905_1146008915 26 Left 1146008905 17:29179269-29179291 CCCCCCACCTCTAGCTCATTCTG 0: 1
1: 0
2: 4
3: 20
4: 322
Right 1146008915 17:29179318-29179340 AGACACATGTGCCTTGCAGTAGG 0: 1
1: 0
2: 1
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008905 Original CRISPR CAGAATGAGCTAGAGGTGGG GGG (reversed) Intronic
902638779 1:17752815-17752837 CAGAGTGATCATGAGGTGGGAGG + Intergenic
903028093 1:20443663-20443685 CTCAAGGAGCTGGAGGTGGGTGG - Intergenic
903138080 1:21322319-21322341 AAGCATTTGCTAGAGGTGGGTGG - Intronic
903335006 1:22618897-22618919 CAGAAAGAGCTGGGGGTGAGAGG - Intergenic
904633874 1:31864527-31864549 AAGAATGAGCTAGCCCTGGGAGG + Intergenic
904916517 1:33974346-33974368 CAGAATGAGCACGCAGTGGGAGG - Intronic
905273144 1:36800208-36800230 CAGCATGGGACAGAGGTGGGAGG + Exonic
906042426 1:42798467-42798489 CACATTGAGCTTGAGGCGGGGGG - Intergenic
908647054 1:66289554-66289576 CAGAGTGAGCTAGGAGTGAGTGG + Intronic
909030319 1:70531502-70531524 CAGATTGAGTGGGAGGTGGGAGG + Intergenic
909492619 1:76242321-76242343 TGGGATGAGCTAGAGTTGGGGGG + Intronic
909497098 1:76290701-76290723 CAGTATGAGATAAGGGTGGGAGG - Intronic
909981615 1:82109001-82109023 TAGAATGAACTAGAGGAGTGTGG + Intergenic
910693835 1:89991695-89991717 CAGAATGGATTGGAGGTGGGAGG + Intergenic
912189620 1:107322658-107322680 CAAAATGAGCCAGGGGAGGGGGG - Intronic
913223276 1:116676547-116676569 GAGCAAGAGTTAGAGGTGGGAGG + Intergenic
914919317 1:151837112-151837134 CAGAAGGAGGTGGGGGTGGGGGG - Intergenic
916307882 1:163360062-163360084 AAGAATGAATTAGAGGTTGGTGG - Intergenic
917734064 1:177904544-177904566 TAGAAAGAGCTGGAGGTGGAGGG - Intergenic
919594483 1:199545269-199545291 CAGAATGAGCAAGAGGCGCTAGG + Intergenic
919950789 1:202361413-202361435 GAGAAAGAGAGAGAGGTGGGAGG + Intronic
920097183 1:203493937-203493959 GAGCAGGAGCTGGAGGTGGGGGG + Intergenic
920183815 1:204148407-204148429 CAGATTGAGGGAGAGCTGGGGGG + Intronic
920290774 1:204921529-204921551 CAGAAAGAGTTGGAGCTGGGGGG + Intronic
920310253 1:205044252-205044274 CATAATGGGCTGGAGGTGGGGGG + Intronic
920721051 1:208387185-208387207 CAGAAAGAGCCAGAGCTGTGTGG - Intergenic
921434431 1:215101286-215101308 CCTAATGAGATAGAGATGGGAGG + Intronic
922677625 1:227562184-227562206 CAGAAAGAGCACGAGGTGGAGGG - Intergenic
924576219 1:245283250-245283272 CAGATTGGGCTCGCGGTGGGTGG - Intronic
924604151 1:245517766-245517788 AAGAATGAGCAGGAGGTGGCTGG + Intronic
1063369489 10:5511942-5511964 CAGAATGGACCAGCGGTGGGGGG - Intergenic
1064410499 10:15099848-15099870 CAGCATGAGGCTGAGGTGGGAGG + Intronic
1064697441 10:17982499-17982521 CACTGTGAGTTAGAGGTGGGTGG - Intronic
1065322119 10:24519791-24519813 CAGAAGGAGGGATAGGTGGGAGG - Intronic
1066557075 10:36626039-36626061 GAGAAGGAGCTGGGGGTGGGGGG + Intergenic
1069335009 10:67338279-67338301 CAGCATGAGCAAGGTGTGGGGGG + Intronic
1069551444 10:69367162-69367184 GAGAAGGAGCCAGAGGTGGGGGG + Intronic
1069557404 10:69407206-69407228 CAGGATGAAGTAGAGGTGGTAGG + Exonic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1070771786 10:79086620-79086642 CAGCAGGAGGCAGAGGTGGGAGG - Intronic
1070887354 10:79915358-79915380 CAGATTCAGCTTGAGGAGGGTGG + Intergenic
1072549432 10:96466176-96466198 TAGCGGGAGCTAGAGGTGGGTGG + Intronic
1073053360 10:100683841-100683863 CAGAGGGAGCTAGAACTGGGGGG - Intergenic
1073434106 10:103505900-103505922 CAGAATGAGTGAGAAGCGGGTGG - Intronic
1073451153 10:103610141-103610163 CAGAGTGAGTGAGGGGTGGGAGG + Intronic
1075277318 10:121105898-121105920 GAGAAGGAGGTAGAGATGGGCGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076891966 10:133289249-133289271 CAGACTGAGCTGGTGGTGGCAGG + Intronic
1077382581 11:2251211-2251233 CAGCAGGTGCTGGAGGTGGGGGG - Intergenic
1078104298 11:8349076-8349098 CAGAGGGAGCTGGCGGTGGGAGG - Intergenic
1079244841 11:18744368-18744390 CAGAAAGAGCTAAGTGTGGGTGG + Intronic
1080608152 11:33881691-33881713 CAGAATGAGCTTGAGGTCTTTGG - Intronic
1081253224 11:40861255-40861277 CAGAAGAAGATAGAGGTGTGTGG + Intronic
1083255427 11:61492534-61492556 CAGCAGGAGCCAGGGGTGGGGGG - Intergenic
1083663712 11:64263792-64263814 CAGGGTGAGCTGGGGGTGGGCGG + Exonic
1084075432 11:66771584-66771606 CAGAATGAGAGAGATGTAGGAGG + Intronic
1085036741 11:73305515-73305537 CATAAGGAGCTGGGGGTGGGAGG + Intergenic
1085757406 11:79213131-79213153 AAAAGTGAGCTAGTGGTGGGAGG + Intronic
1087873990 11:103333505-103333527 CATAAGGAGGTTGAGGTGGGAGG - Intronic
1088171873 11:107007481-107007503 CAGATTGAGCTTGAGGTGTTTGG - Intronic
1089847480 11:121469842-121469864 CAGAATATGCATGAGGTGGGAGG + Intronic
1090150116 11:124375071-124375093 CAGAATGAGCTGGAAGATGGGGG - Intergenic
1090265278 11:125349583-125349605 GAAAATGAGGTGGAGGTGGGTGG - Intronic
1092387663 12:8048306-8048328 CACAGTGATCTAGAGGAGGGTGG + Intronic
1092419631 12:8319710-8319732 CTGACTGAGCTATAGGTGAGGGG + Intergenic
1093778434 12:23105119-23105141 CAAAATAATTTAGAGGTGGGAGG - Intergenic
1094190648 12:27694792-27694814 CAAATTGAGGTGGAGGTGGGCGG + Exonic
1094191352 12:27701460-27701482 CAGAGTGAGCTGGAGGCGAGAGG + Intergenic
1094669065 12:32551151-32551173 CAGCATGAGCAAGTGCTGGGTGG + Intronic
1095235888 12:39795186-39795208 CAGAGAGAGAGAGAGGTGGGGGG - Intronic
1095724965 12:45441591-45441613 GAGAATGAGGTTGGGGTGGGAGG + Intergenic
1096323233 12:50634058-50634080 CAGAATGAGCAAGAGATGGGAGG - Intronic
1099494353 12:83327934-83327956 CATAATGAGCGAGAGGAGTGGGG + Intergenic
1100441488 12:94621428-94621450 AAGAATGGGGTGGAGGTGGGAGG - Intronic
1101262723 12:103049014-103049036 GAGAATGAGTTAGAGGTGCAAGG - Intergenic
1101761335 12:107661256-107661278 CAGAAAGAACTAGAAGCGGGAGG - Intergenic
1102701916 12:114846667-114846689 CATAATCAGCTAGAGCTGAGTGG - Intergenic
1102961034 12:117093365-117093387 GAGAAGGAGCTAGAGATGGCAGG - Intronic
1103889820 12:124229991-124230013 CAGAATGAGGCAGAAGTGGCTGG + Intronic
1104617810 12:130285010-130285032 CAGGCTGAGGTGGAGGTGGGGGG + Intergenic
1107716241 13:43202207-43202229 AAGAATGAGAAAGATGTGGGGGG + Intergenic
1107757863 13:43645265-43645287 CAGAAGGAGTTTGAGATGGGAGG - Intronic
1107843180 13:44481268-44481290 CAGAAAAAGCTTGGGGTGGGAGG + Intronic
1107939909 13:45374366-45374388 GAGAAAGAGAAAGAGGTGGGGGG + Intergenic
1108591661 13:51917900-51917922 CTGAAACATCTAGAGGTGGGAGG - Intergenic
1109600915 13:64627453-64627475 GAGAAGGAGCAAGGGGTGGGGGG - Intergenic
1112787285 13:102965006-102965028 CAGAATGAGCATGAGCTGGGAGG - Intergenic
1113149466 13:107246054-107246076 CAGAATGAGATAGAGGAGGGTGG - Intronic
1113604262 13:111594488-111594510 GAGGAGGAGCTAGAGATGGGAGG + Intronic
1116437025 14:44907569-44907591 CAGAATAATCTACTGGTGGGGGG + Intergenic
1118416627 14:65544127-65544149 AAGAATGAGCCAAAGGTGGAAGG + Intronic
1118492407 14:66273883-66273905 GAGAGGGAGCTGGAGGTGGGGGG - Intergenic
1118709250 14:68506332-68506354 GAGAATGAGCTATGGGTGGCAGG - Intronic
1119425359 14:74531526-74531548 CAGCAAGAGCTATAGGAGGGGGG - Intronic
1120024997 14:79573331-79573353 CAGAATGGTAGAGAGGTGGGAGG + Intronic
1120073404 14:80128139-80128161 CAGATTAAGCTAGATCTGGGTGG - Intergenic
1120078603 14:80188756-80188778 CAGAAGGACCTAGTCGTGGGAGG + Intergenic
1121179499 14:91918079-91918101 TAGAATAAGGTAAAGGTGGGAGG + Intronic
1121651491 14:95562260-95562282 CAGGATGAGTTACAGGTGTGTGG - Intergenic
1122804473 14:104249680-104249702 CAGAAGGAGCTAGGAGTGGGAGG + Intergenic
1122886817 14:104713907-104713929 CAGAGGGTGCTAGAGGTGGCAGG + Intronic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1124965590 15:34430600-34430622 CAGAATCAGTTAGAGGCTGGAGG + Intronic
1124982219 15:34576807-34576829 CAGAATCAGTTAGAGGCTGGAGG + Intronic
1129324698 15:74793916-74793938 CAGAAGGACCTAAAGGTTGGGGG + Intronic
1129666043 15:77579919-77579941 CAGTGTGAGCTGGGGGTGGGGGG - Intergenic
1129676470 15:77634629-77634651 CAGAAGGACTTACAGGTGGGAGG + Intronic
1130710848 15:86279591-86279613 GAGAATAAGGGAGAGGTGGGAGG - Intronic
1133875011 16:9725819-9725841 CAGAGAGAGATGGAGGTGGGGGG - Intergenic
1133958295 16:10467130-10467152 CAGAGTGAACTAGAGGTAGAAGG - Intronic
1135408350 16:22214510-22214532 CATAATTAGCCAGATGTGGGTGG + Intronic
1135745470 16:25013197-25013219 AAGAATGAGCAAGAGGTGCCTGG + Intronic
1136183824 16:28573256-28573278 GAGGAGGAGCTGGAGGTGGGTGG + Intronic
1136272063 16:29154172-29154194 GAGAATGGGCAAGACGTGGGGGG + Intergenic
1137665794 16:50248223-50248245 CAGGAAGAGGGAGAGGTGGGCGG - Intronic
1138123357 16:54418650-54418672 CAGAATAGGCCAGAGGTGAGAGG - Intergenic
1139188916 16:64839063-64839085 CAAGATGAGCAAGAGGTGGCTGG - Intergenic
1139343225 16:66284976-66284998 CAGAGAGAGATTGAGGTGGGGGG - Intergenic
1140834586 16:78781404-78781426 GAGGGTGGGCTAGAGGTGGGAGG - Intronic
1141093026 16:81143392-81143414 CAAAAAGAGATAGAGGTCGGTGG - Intergenic
1141239091 16:82248461-82248483 CAGAAGCAGCAAGATGTGGGTGG + Intergenic
1142075662 16:88116153-88116175 GAGAATGGGCAAGATGTGGGGGG + Intronic
1142330417 16:89448862-89448884 TGGAGTGAGCCAGAGGTGGGTGG - Intronic
1142762064 17:2048592-2048614 CAGAATGAACGGGATGTGGGGGG - Intergenic
1142994177 17:3751195-3751217 CATGAGGAGCTGGAGGTGGGTGG + Intronic
1143165418 17:4895048-4895070 CAGAAGGAGGAGGAGGTGGGAGG - Intronic
1143386449 17:6534056-6534078 CAGAACAAGCCAGAGCTGGGAGG - Intronic
1143615103 17:8044987-8045009 CAGGCTGAGCTAGAGGTGAGGGG + Exonic
1143632248 17:8146074-8146096 CGGAAGGAGCCAGTGGTGGGAGG - Exonic
1143754039 17:9053557-9053579 CCGAATCTGCTGGAGGTGGGAGG - Intronic
1144519046 17:15942309-15942331 AAGCAGGAGCAAGAGGTGGGGGG - Intergenic
1146008905 17:29179269-29179291 CAGAATGAGCTAGAGGTGGGGGG - Intronic
1147266702 17:39238607-39238629 CAGGGTGAGCTGGAGGTGGTAGG + Intergenic
1147591660 17:41687867-41687889 CACAATGGGCTGGAGGTGAGCGG + Intergenic
1148152032 17:45402706-45402728 AAGAATGTGCTGGAGGTGAGTGG - Exonic
1148778302 17:50108195-50108217 GAGCATGTGGTAGAGGTGGGAGG - Exonic
1149372652 17:56010528-56010550 CAGAATGAGCTGGTGGTGTCAGG + Intergenic
1149603036 17:57905313-57905335 CAGAGTGACTTAGAGCTGGGTGG - Intronic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151829021 17:76538717-76538739 GAGATTGGGCCAGAGGTGGGGGG + Intronic
1152532476 17:80927137-80927159 CTGAGTGAGCCAGAGCTGGGAGG + Intronic
1152571178 17:81121933-81121955 GAGGATGAGCTAGAGGAGGTGGG - Exonic
1154337557 18:13477720-13477742 CAAAAGGAGCGAGAGGTGCGGGG - Intronic
1155356466 18:24958515-24958537 CTGAATGAGGGAGAGTTGGGAGG - Intergenic
1156453618 18:37280549-37280571 CAGAAGAGGCTAGAAGTGGGAGG + Intronic
1156490306 18:37492080-37492102 CAGAATTAGCCAGAGGAAGGTGG + Intronic
1156946690 18:42841914-42841936 CAGAATGTGCCAGACATGGGTGG - Intronic
1159703129 18:71654817-71654839 CAAACAGAGCTAGAGTTGGGAGG - Intergenic
1159931840 18:74320287-74320309 CAGCAAGAGAGAGAGGTGGGGGG + Intronic
1161285675 19:3467218-3467240 CAGAATGAGACTGGGGTGGGGGG - Intronic
1161509588 19:4663110-4663132 TAGAATGAGGATGAGGTGGGTGG - Intronic
1161509762 19:4663819-4663841 CAGAATGAGGATGGGGTGGGTGG - Intronic
1162062760 19:8106926-8106948 AAGAATGAGAGATAGGTGGGTGG + Intronic
1162152915 19:8658168-8658190 CAGAATGATCAAGAGGTAGCAGG + Intergenic
1163538703 19:17893794-17893816 CAGAAGGAGCTGGAGGGGGCTGG + Exonic
1164429452 19:28174562-28174584 CAGAAGCAGGTAGAGATGGGAGG + Intergenic
1164554322 19:29239241-29239263 CAGAATAAAGTAGAGCTGGGAGG - Intergenic
1164651828 19:29896175-29896197 GAGAAAAAGCTAGTGGTGGGAGG + Intergenic
1165099168 19:33428364-33428386 TAGAAGGTGCTAGAAGTGGGTGG - Intronic
1166060023 19:40320381-40320403 CAGCATGAGGCAGAGGTGGGTGG - Exonic
1166144114 19:40822523-40822545 GAGAATTAGCTAGAGCTGGCCGG + Intronic
1166183498 19:41124557-41124579 GAGAATTAGCTAGAGCTGGCCGG - Intronic
1166627482 19:44372071-44372093 CAGAATGAGCTGTAGGAAGGTGG - Intronic
1166840876 19:45696184-45696206 CAGAGTGAGCAAGAGGTGAGGGG - Intronic
1167488687 19:49779182-49779204 AAAAATTAGCTAGGGGTGGGTGG + Intronic
1168038584 19:53740006-53740028 CAGAAAGAGTCAGAGGTGGGCGG - Intergenic
1168337532 19:55605083-55605105 AAGAATGCTTTAGAGGTGGGAGG + Intergenic
1168462430 19:56570321-56570343 CAGGAAGAGGTAGAGGTGGCAGG + Exonic
925569194 2:5290879-5290901 CAGTATGAATTAGATGTGGGTGG - Intergenic
925585725 2:5462097-5462119 CAGGATGAGCTGAAGGTGGGAGG + Intergenic
927357293 2:22187816-22187838 CAGAATTAGCGGGAGGTAGGGGG + Intergenic
927692960 2:25221344-25221366 CAGAATAAGCTGGTGGTGGCCGG + Intergenic
928114640 2:28538316-28538338 CAGAATGGGCTTGCGGCGGGCGG + Exonic
928396658 2:30947830-30947852 CAGAATGAGTCACATGTGGGAGG - Intronic
928894693 2:36247268-36247290 GAGAATGAGCTAGAGGTGGCTGG - Intergenic
929344462 2:40864111-40864133 CAGCATGAGGGAGAGGAGGGTGG - Intergenic
930881993 2:56280704-56280726 AACAATGAGGTGGAGGTGGGAGG + Intronic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
932152774 2:69387687-69387709 AAGAATTAGGTTGAGGTGGGAGG + Intergenic
932357044 2:71075637-71075659 CAGAAGGTACTGGAGGTGGGGGG + Exonic
933651329 2:84852513-84852535 CAGAATGACCATGAGGTGGCAGG + Intronic
936724256 2:115293379-115293401 CAGAGTGGGCAAGAGTTGGGAGG + Intronic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
940242963 2:151583088-151583110 CAGAAAGAGAGAGAGATGGGGGG - Intronic
940243918 2:151593640-151593662 CAGAAAGAGAGAGAGATGGGGGG - Intronic
940244878 2:151604193-151604215 CAGAAAGAGAGAGAGATGGGGGG - Intronic
940282344 2:152000941-152000963 AAGAATCTGCTGGAGGTGGGAGG - Intronic
942005417 2:171694798-171694820 GAGCAAGAGCAAGAGGTGGGGGG + Intronic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
944718725 2:202402130-202402152 GGGAATGAGGTGGAGGTGGGAGG + Intronic
946700680 2:222410027-222410049 AAGATTGAGCTAGGTGTGGGGGG - Intergenic
947652815 2:231801709-231801731 AAGAGGGAGCCAGAGGTGGGAGG - Intronic
947738089 2:232468900-232468922 CAGCATGAGGTTGAGGTGGGCGG - Intergenic
947955591 2:234187775-234187797 GAGAAGGAGATGGAGGTGGGAGG - Intergenic
947965706 2:234279858-234279880 CAGAGGGAGCAAGAGGTGGTTGG + Intergenic
1169796482 20:9468463-9468485 GAGAAAGTTCTAGAGGTGGGTGG - Intronic
1170168090 20:13382138-13382160 CAGTATGAGCTGGAAGTTGGGGG + Intergenic
1170518966 20:17163382-17163404 CAGAATGAACTGTAGGTGTGTGG + Intergenic
1170838128 20:19902438-19902460 CGGAAAGAGGTAGTGGTGGGTGG - Intronic
1171138511 20:22720246-22720268 CGGAAGGAGCCAGAGGTGTGGGG - Intergenic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1172116616 20:32576903-32576925 CACCATGAGCCAGGGGTGGGTGG + Intronic
1172398487 20:34628237-34628259 CTCAAGGAGGTAGAGGTGGGAGG + Intronic
1172699757 20:36845825-36845847 CTGAAGGAGCTGGGGGTGGGGGG + Intronic
1173118456 20:40268781-40268803 TAGGATGAACTAGAAGTGGGAGG + Intergenic
1173311738 20:41902649-41902671 TAGAAAGAGCTGGAGCTGGGAGG + Intergenic
1173999287 20:47362604-47362626 CAGAGTGAGCCACAGGAGGGTGG - Intergenic
1174532004 20:51221731-51221753 CAGAGGGAGCAAGGGGTGGGAGG + Intergenic
1182883804 22:33756291-33756313 CAGTAGGTGCTAGAGGTGGAAGG + Intronic
1183286569 22:36968706-36968728 AAGAAAGAGAGAGAGGTGGGAGG - Intergenic
1183521565 22:38298698-38298720 CAGAGTGAGCTGGTGGCGGGAGG - Intronic
1183744942 22:39686724-39686746 CAGAAAGTGCTAAAGGTGGGAGG + Exonic
1184559445 22:45253476-45253498 CAGAGAGAGAGAGAGGTGGGGGG + Intergenic
1184916372 22:47571773-47571795 CATAAGGAGCTAGTGGTGGTAGG - Intergenic
1185341916 22:50294833-50294855 CAGCATGGGACAGAGGTGGGGGG - Intronic
949364915 3:3270583-3270605 AAAAAGCAGCTAGAGGTGGGTGG + Intergenic
949850203 3:8413007-8413029 CAGAATAAGCCAGAGAAGGGGGG - Intergenic
950893667 3:16428198-16428220 CAGAATGAACTCGAGAAGGGAGG + Intronic
951646064 3:24892286-24892308 GAGAATGGGCTGGAGGTAGGAGG + Intergenic
952874788 3:37935624-37935646 CAGAATTAGTGAGAGGTTGGTGG + Intronic
958258009 3:91347458-91347480 CACAGTGTGCTAGAGGTGGAAGG - Intergenic
959152247 3:102621191-102621213 GAGAAAGAGATAGAAGTGGGAGG + Intergenic
959158282 3:102693503-102693525 CAGAATGGGCTACTGGAGGGAGG + Intergenic
960640390 3:119817390-119817412 CAGACTGAACTGGGGGTGGGGGG - Exonic
960949670 3:122991166-122991188 TAGAAAGAGCTAGAGATTGGTGG + Intronic
960955114 3:123026430-123026452 AAGACTGGGCTCGAGGTGGGGGG + Intronic
961449606 3:126996573-126996595 CTGAAAGAGCTGGAGCTGGGGGG + Intronic
963726344 3:148926155-148926177 GAGAATGGGATAGAGGTGGAAGG - Intergenic
965383640 3:168020389-168020411 CAGAATCAGCTGGTGGTGGGCGG + Intronic
966700206 3:182841027-182841049 CAGGATGAGCTAGAGGTGGAAGG - Intronic
967376206 3:188804452-188804474 CAGAATGAAATAAAGGTGGGAGG + Intronic
967855650 3:194115454-194115476 CAGAATGAGTTGGGGTTGGGGGG + Intergenic
968312769 3:197697662-197697684 CAGGAAGAGCGAGAGCTGGGAGG + Intronic
968914271 4:3490374-3490396 CTGAATGAGCAGGGGGTGGGGGG - Intronic
968938084 4:3624070-3624092 CAGCCTGAGCCAGAGCTGGGAGG - Intergenic
970870413 4:20810675-20810697 CAGAAAGAGTTAGATCTGGGTGG + Intronic
971352443 4:25865369-25865391 CATCCTGAGCTAGAGGTGGTGGG + Intronic
976387674 4:84480220-84480242 CAGAAAGTACTAGAGGTGGGTGG + Intergenic
976805424 4:89040929-89040951 CAGAATGGGAGAGAGGTGGAGGG - Intronic
977163165 4:93662015-93662037 CAGAATGAGCAAGGGTTGGGGGG - Intronic
978037714 4:104016474-104016496 GAGAAAGAGCAAGAGGTGGAGGG + Intergenic
978336180 4:107672066-107672088 AAAAATGAGATGGAGGTGGGTGG + Intronic
981244366 4:142516709-142516731 CAGAATCAGTTAGAGGTGAAAGG + Intronic
981619322 4:146676249-146676271 GAGAATGAGGTAGAGGAGAGAGG - Intergenic
982039776 4:151385251-151385273 CAGACTGGGGTGGAGGTGGGGGG + Intergenic
983228204 4:165104919-165104941 GAGAATGAGCTAGAGGCAGAGGG - Intronic
985485474 5:146145-146167 CAGAATGGGGGAGAGGAGGGAGG - Intronic
986286784 5:6365146-6365168 GAGAATGTGCTAGAGGTGGAGGG - Intergenic
986543848 5:8874100-8874122 GACAGTGAGCTGGAGGTGGGGGG - Intergenic
988202596 5:28086618-28086640 GAGAATGAGCTACAGCAGGGCGG + Intergenic
988451286 5:31345863-31345885 CAGAAGGAAGTAGAGATGGGAGG - Intergenic
989706785 5:44343019-44343041 CAGATTCAAATAGAGGTGGGTGG + Intronic
990380744 5:55220487-55220509 CACAGTGAGCTGGAGGAGGGCGG - Exonic
990512380 5:56500299-56500321 CAGCCTGAGATGGAGGTGGGGGG - Intergenic
992272917 5:75084073-75084095 TAGAATTATATAGAGGTGGGTGG + Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993552483 5:89291092-89291114 CAGAATGTGCGGGAGGAGGGGGG - Intergenic
995239909 5:109873995-109874017 CAGAATGTGCGAGGGGTGAGGGG - Intergenic
996722835 5:126647029-126647051 CAAAATGCACTAGAGTTGGGTGG - Intergenic
997307859 5:132852673-132852695 CAGAAAGAGCTGGATGTGGCTGG - Intergenic
997751900 5:136354825-136354847 CAGAATGCGCCAGAGCAGGGAGG - Intronic
998662095 5:144250293-144250315 CAGAAAGAGCTAGAGTGTGGTGG - Intronic
998753545 5:145351654-145351676 TAGAATGAGCTAGACTTTGGGGG - Intergenic
999370504 5:151052314-151052336 CAGGCTGAGCTAGAGGATGGTGG + Intronic
1000128174 5:158268144-158268166 TAGAATGAGGTAGGTGTGGGCGG - Intergenic
1001081879 5:168673139-168673161 CAGAGGGAGGTAGAGGTGGTAGG + Intronic
1001229397 5:169972974-169972996 CAGAAACAACTAGAGGAGGGAGG + Intronic
1001752948 5:174145419-174145441 CAGAAGGAGCTGGATGGGGGAGG + Intronic
1003300222 6:4873881-4873903 CAGAATGAGCAAGCAGTGGCAGG - Intronic
1003482402 6:6545937-6545959 CAGGCTGAGCTGGGGGTGGGGGG + Intergenic
1004693368 6:18011701-18011723 CAGAACGAGCGAGAGCTGTGAGG + Intergenic
1006345014 6:33473862-33473884 CAGAACCAGCTAGATGTGTGTGG - Intergenic
1008458368 6:51738750-51738772 CAGCATGTGTGAGAGGTGGGTGG - Intronic
1008623060 6:53290855-53290877 AAGAAGAAGGTAGAGGTGGGAGG - Intronic
1013527005 6:110983632-110983654 TAAAATGAGCTAGGGCTGGGAGG - Intronic
1014239913 6:119005597-119005619 CACAATGAAGGAGAGGTGGGGGG - Intronic
1015846913 6:137530527-137530549 CAGAATTAGCAAGAGGAGAGTGG - Intergenic
1016118420 6:140317090-140317112 GACAATGTGCTAGAGGTGAGAGG - Intergenic
1018581461 6:165311594-165311616 CATAATGAGCTGCAGGTGAGGGG - Intergenic
1019376365 7:694616-694638 CAGAATGCACTGGAGGTGGGTGG - Intronic
1019497233 7:1346312-1346334 CGGAACGGGCTGGAGGTGGGTGG - Intergenic
1019719625 7:2560138-2560160 CAGAGTGAGGCTGAGGTGGGAGG + Intronic
1020937374 7:14484503-14484525 TAGCAGGAGCAAGAGGTGGGGGG - Intronic
1021360374 7:19705756-19705778 GAGAAAGACCTAGTGGTGGGAGG + Intronic
1021905903 7:25332810-25332832 CACGAGGAGCTAGAGGTGGTAGG + Intergenic
1023117954 7:36880980-36881002 GAGAATTAGCCAGAGGTAGGAGG - Intronic
1024525884 7:50348961-50348983 CAGCATGGCCTAGAGGTGGCAGG + Intronic
1025115062 7:56250626-56250648 CAGCATGAGGTAGAGATGGCAGG - Intergenic
1026123995 7:67563389-67563411 CAGAATGAGGTGGAAGTGGTAGG - Intergenic
1028136065 7:87224070-87224092 AAGAAGAAGCCAGAGGTGGGTGG - Intergenic
1028526295 7:91790656-91790678 CAGAAAGAGCAAGGGGTTGGGGG + Intronic
1028603280 7:92626810-92626832 CAGAATGAGATAGATGGAGGTGG + Intronic
1029479829 7:100805617-100805639 CAGCATGAGCTGGTGGAGGGAGG + Exonic
1029528246 7:101108615-101108637 CAGAAACAGCAACAGGTGGGGGG + Intergenic
1029889701 7:103914779-103914801 AAGAAGGAGCCAGATGTGGGGGG - Intronic
1030185630 7:106759027-106759049 CAGAATAAGGTGGTGGTGGGGGG - Intergenic
1032285052 7:130533437-130533459 AAGAATGAGGGAGAGGTGGGAGG + Intronic
1032341944 7:131082069-131082091 TACAAAGTGCTAGAGGTGGGAGG - Intergenic
1033274542 7:139961461-139961483 CATAATGAGCTGGAGGAGGTGGG - Intronic
1033595139 7:142854130-142854152 GAGAAGGGGTTAGAGGTGGGCGG + Intergenic
1034353064 7:150429765-150429787 GAGAAAGAGGGAGAGGTGGGGGG - Intergenic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1037574978 8:20193559-20193581 GAGTATCAGCTGGAGGTGGGGGG - Intergenic
1037580043 8:20239653-20239675 CAGAAGGAGAACGAGGTGGGGGG + Intergenic
1037716940 8:21408769-21408791 CAGATGGAGACAGAGGTGGGTGG - Intergenic
1039275207 8:35927400-35927422 CAGAATGACATAGAGATGAGTGG + Intergenic
1039346596 8:36712000-36712022 CAGAATGGGATACAGGTGGAAGG - Intergenic
1040399682 8:47036299-47036321 AAGAATGAGAGTGAGGTGGGAGG + Intergenic
1041682069 8:60604133-60604155 GAGAAAGAGAAAGAGGTGGGAGG - Intronic
1043302359 8:78749788-78749810 TAAAATAAGCCAGAGGTGGGAGG + Intronic
1044397604 8:91731228-91731250 CAGAAGGAGCTCTGGGTGGGTGG - Intergenic
1045135960 8:99218719-99218741 CAGAATGAATGGGAGGTGGGTGG + Intronic
1046502848 8:115100479-115100501 AATAATGAGCTAGTGGTGAGTGG + Intergenic
1047306131 8:123654489-123654511 CAGCTTGAGCTAGAGGCAGGAGG + Intergenic
1047522197 8:125603463-125603485 CATAGGGGGCTAGAGGTGGGGGG - Intergenic
1047813277 8:128433931-128433953 GAGAAGGAGCAAGAGGTGGAAGG - Intergenic
1048064491 8:130953768-130953790 CAGAGTGAAGTAGAGGTGAGAGG - Intronic
1049404321 8:142444944-142444966 CAGGCTGAGCTGGGGGTGGGAGG + Intergenic
1052193542 9:25684763-25684785 AAGCAGGAGCAAGAGGTGGGGGG - Intergenic
1052713898 9:32091573-32091595 AAGAATGATCTAGAAGTAGGAGG - Intergenic
1054453088 9:65413636-65413658 CAGCCTGAGCCAGAGCTGGGAGG + Intergenic
1054793978 9:69281529-69281551 CACAAAGAGCTACAGGAGGGAGG - Intergenic
1055596956 9:77875011-77875033 CTGAACCAGTTAGAGGTGGGAGG - Intronic
1058767344 9:108194647-108194669 GAGAATGAGCTGGAGGAGGCAGG - Intergenic
1058785379 9:108381561-108381583 CAGTATGAGCTAGGGTGGGGAGG + Intergenic
1059372904 9:113857457-113857479 CAGAGTGTGTTAGAGTTGGGAGG - Intergenic
1060812520 9:126617895-126617917 CAGGATGTGCTGGGGGTGGGGGG + Intronic
1061242800 9:129384053-129384075 CAGAAAGAGAGAGAAGTGGGTGG - Intergenic
1061617633 9:131790767-131790789 GAGACAGAGCTAGAGATGGGAGG + Intergenic
1061755967 9:132812813-132812835 CAGAATGAGGTGGATGTAGGAGG - Intronic
1062186886 9:135223075-135223097 CAGAAGGCGCTAGAGGAGGGAGG + Intergenic
1185870449 X:3660552-3660574 CAGAGTGAGGTAGATGGGGGAGG - Intronic
1186357993 X:8807415-8807437 CAGAATGACTTCGAGGTGGCTGG + Intergenic
1187913409 X:24131527-24131549 CACACTGAGCTTGAGGTGAGAGG - Intergenic
1188816566 X:34722245-34722267 CAGAATGAGCTTGATGGGGAAGG + Intergenic
1189715496 X:43860785-43860807 TAGAATGAGCAAGGGGTGGTAGG - Intronic
1193248351 X:79257802-79257824 CAAAATGAGCTAGATGTGTGTGG - Intergenic
1195651491 X:107289585-107289607 CAGAATGAGCTGCAGGCTGGGGG - Intergenic
1196315571 X:114219027-114219049 GAGAATGAGCTACTGGTAGGTGG + Intergenic
1196375482 X:115028305-115028327 CATAAGGAGCTATAGCTGGGAGG + Intergenic
1196601296 X:117604449-117604471 CAGAAAGAGAGAGAGGGGGGAGG - Intergenic
1196940240 X:120768464-120768486 CAGAAGGAGTTAGAGGTCAGAGG + Intergenic
1198006800 X:132503238-132503260 CAGAATAAGCCAGAGGAGGAGGG + Intergenic
1198544866 X:137680645-137680667 AGGAATGAGCTAGAGGTTGCTGG + Intergenic
1198801161 X:140449071-140449093 CAGAAAGAGCCTGAGGGGGGAGG - Intergenic
1199186242 X:144919086-144919108 CAAAATGTGCTAGTTGTGGGTGG + Intergenic
1201289612 Y:12410296-12410318 CAGGATTAGATAGAGGTGGTGGG - Intergenic