ID: 1146012345

View in Genome Browser
Species Human (GRCh38)
Location 17:29206111-29206133
Sequence CACTTGAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146012345_1146012349 8 Left 1146012345 17:29206111-29206133 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1146012349 17:29206142-29206164 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1146012345_1146012352 17 Left 1146012345 17:29206111-29206133 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1146012352 17:29206151-29206173 TCCCGAGTAGCTGGAATTACAGG 0: 2259
1: 55039
2: 219904
3: 255826
4: 192186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146012345 Original CRISPR CACTTGAATCCAGGAGACGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr