ID: 1146014253

View in Genome Browser
Species Human (GRCh38)
Location 17:29219781-29219803
Sequence TTGTATCCACGGATGAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146014253_1146014257 18 Left 1146014253 17:29219781-29219803 CCTATTTTCATCCGTGGATACAA No data
Right 1146014257 17:29219822-29219844 GCAATTGGACAAATTTCACCTGG No data
1146014253_1146014256 3 Left 1146014253 17:29219781-29219803 CCTATTTTCATCCGTGGATACAA No data
Right 1146014256 17:29219807-29219829 CATCAGTTTCAAGCTGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146014253 Original CRISPR TTGTATCCACGGATGAAAAT AGG (reversed) Intergenic
No off target data available for this crispr