ID: 1146015405

View in Genome Browser
Species Human (GRCh38)
Location 17:29229158-29229180
Sequence AGGTCTTTGCAGATGAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146015399_1146015405 12 Left 1146015399 17:29229123-29229145 CCTGGAACCTCTGTTTATGACCT No data
Right 1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG No data
1146015398_1146015405 15 Left 1146015398 17:29229120-29229142 CCACCTGGAACCTCTGTTTATGA No data
Right 1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG No data
1146015396_1146015405 29 Left 1146015396 17:29229106-29229128 CCCAGAATGCAGGTCCACCTGGA No data
Right 1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG No data
1146015403_1146015405 -8 Left 1146015403 17:29229143-29229165 CCTTACTTGGAAACCAGGTCTTT No data
Right 1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG No data
1146015397_1146015405 28 Left 1146015397 17:29229107-29229129 CCAGAATGCAGGTCCACCTGGAA No data
Right 1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG No data
1146015400_1146015405 5 Left 1146015400 17:29229130-29229152 CCTCTGTTTATGACCTTACTTGG No data
Right 1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG No data
1146015394_1146015405 30 Left 1146015394 17:29229105-29229127 CCCCAGAATGCAGGTCCACCTGG No data
Right 1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146015405 Original CRISPR AGGTCTTTGCAGATGAAATA AGG Intergenic
No off target data available for this crispr