ID: 1146016963

View in Genome Browser
Species Human (GRCh38)
Location 17:29241465-29241487
Sequence TTGTGTGGGAATAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146016963_1146016967 1 Left 1146016963 17:29241465-29241487 CCATCCTGCTTATTCCCACACAA No data
Right 1146016967 17:29241489-29241511 AAAAGCGCTGCTCAGCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146016963 Original CRISPR TTGTGTGGGAATAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr