ID: 1146017697

View in Genome Browser
Species Human (GRCh38)
Location 17:29247085-29247107
Sequence TGCCCTAGCAACTAAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146017690_1146017697 11 Left 1146017690 17:29247051-29247073 CCCCAAGAGGAGTCACTTATATA 0: 1
1: 1
2: 0
3: 9
4: 130
Right 1146017697 17:29247085-29247107 TGCCCTAGCAACTAAGGCTGGGG 0: 1
1: 0
2: 1
3: 9
4: 120
1146017692_1146017697 9 Left 1146017692 17:29247053-29247075 CCAAGAGGAGTCACTTATATAGC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1146017697 17:29247085-29247107 TGCCCTAGCAACTAAGGCTGGGG 0: 1
1: 0
2: 1
3: 9
4: 120
1146017688_1146017697 24 Left 1146017688 17:29247038-29247060 CCTTCTCTTGTCACCCCAAGAGG 0: 1
1: 0
2: 1
3: 26
4: 156
Right 1146017697 17:29247085-29247107 TGCCCTAGCAACTAAGGCTGGGG 0: 1
1: 0
2: 1
3: 9
4: 120
1146017691_1146017697 10 Left 1146017691 17:29247052-29247074 CCCAAGAGGAGTCACTTATATAG 0: 1
1: 1
2: 0
3: 7
4: 102
Right 1146017697 17:29247085-29247107 TGCCCTAGCAACTAAGGCTGGGG 0: 1
1: 0
2: 1
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146017697 Original CRISPR TGCCCTAGCAACTAAGGCTG GGG Intronic
900991156 1:6099052-6099074 TGCCCCAGCAACCAAGGCCCTGG - Exonic
903093348 1:20943911-20943933 TGCCCTGTCAACTTAGTCTGAGG - Intronic
903548476 1:24141716-24141738 TGCCGAAGCAACACAGGCTGAGG - Intronic
904203652 1:28838328-28838350 TGACCTAGGAACTAAGTCTCAGG - Intronic
910623875 1:89285474-89285496 TGTCTTAGTCACTAAGGCTGTGG - Intergenic
914724477 1:150316175-150316197 TTCCCTAATAACTAATGCTGTGG + Intergenic
916310851 1:163397415-163397437 GGCCAAAGCAACAAAGGCTGAGG + Intergenic
920842501 1:209566384-209566406 TGCCCCAGGAACTAAAGTTGAGG - Intergenic
922479332 1:225928150-225928172 TGCCTTAGAAACCAAGGCAGTGG - Intergenic
924250513 1:242128395-242128417 TGCCCTCTCTACTGAGGCTGGGG + Intronic
1063018120 10:2098386-2098408 TGCCCAAGCGATGAAGGCTGGGG - Intergenic
1069644118 10:69979697-69979719 TGTCATAGCAGCTCAGGCTGTGG - Intergenic
1074675156 10:115840065-115840087 TTCCCTGGCACCTAAGACTGAGG - Intronic
1076479898 10:130778068-130778090 TGCCCCAGCATCTTGGGCTGCGG + Intergenic
1076992518 11:282871-282893 TGACCTAGGAAAGAAGGCTGAGG + Intronic
1078551271 11:12281975-12281997 TCCCAGGGCAACTAAGGCTGTGG - Intronic
1078593339 11:12664991-12665013 AGTCCTAGCTACTCAGGCTGAGG + Intergenic
1080212700 11:29805480-29805502 TGCCCTGGCTACTCAGGCTGAGG - Intergenic
1081152380 11:39648186-39648208 TGCCTTAGCACCTCAGGCTCTGG - Intergenic
1081431647 11:42983023-42983045 TTCCCTAGAAACTATGTCTGTGG + Intergenic
1082035026 11:47638428-47638450 AGTCCTAGCTACTCAGGCTGAGG + Intronic
1083734629 11:64672350-64672372 TGCCTTAGGAAGAAAGGCTGAGG + Intronic
1083989726 11:66239402-66239424 GGTCCTAGCTACTCAGGCTGAGG + Intronic
1089600545 11:119611764-119611786 TGCCCTAGATTCTATGGCTGAGG - Intergenic
1091816970 12:3446076-3446098 TGCCCAAGGAACTGAGGGTGGGG - Intronic
1092228132 12:6762116-6762138 AGTCCTAGCTACTGAGGCTGAGG + Intronic
1092290432 12:7156971-7156993 GGCACTAGCACCTGAGGCTGGGG - Intronic
1096160655 12:49374245-49374267 AGTCCTAGCTACTGAGGCTGAGG - Intronic
1096198849 12:49666679-49666701 AGCCCTGGCTACTTAGGCTGAGG + Intronic
1096656250 12:53094334-53094356 TGCCCTGGGTACTAAGGCAGAGG + Intergenic
1098526220 12:71490012-71490034 TGTCCCAGCTACTTAGGCTGAGG + Intronic
1107323557 13:39215344-39215366 TGCCTAAGCAACTAAGTTTGTGG - Intergenic
1108593154 13:51928243-51928265 TGCTCCAGGAACAAAGGCTGAGG + Intergenic
1110080217 13:71300068-71300090 TGACATAGAAACAAAGGCTGTGG - Intergenic
1117748035 14:58891404-58891426 GGCACCAGCAACTAAAGCTGGGG - Intergenic
1119209046 14:72816194-72816216 TGCACCAGCAGCTAAGCCTGTGG + Intronic
1120503115 14:85321691-85321713 TGCCCTAGCTATTGAGGCTGAGG - Intergenic
1124873532 15:33567635-33567657 TGGCCTAGCTACTAGGGCTCAGG + Intronic
1128120318 15:65141370-65141392 TACCCTAGAAGCTAAGGCGGGGG - Intergenic
1133103541 16:3493375-3493397 TGCCCTGGCAACTAAGAGTGGGG + Intergenic
1138024375 16:53511337-53511359 TGCCCACGCAATTAAGGATGAGG + Intergenic
1139169879 16:64617000-64617022 TGCCCCAGCCACTAATGCTTTGG - Intergenic
1141122885 16:81375450-81375472 TGTCCCAGCTACTCAGGCTGAGG - Intronic
1141303737 16:82841313-82841335 TGCCCTTGGAACAAAGCCTGTGG + Intronic
1141879934 16:86851048-86851070 TGACCCACCCACTAAGGCTGAGG - Intergenic
1144225738 17:13143655-13143677 TGCCCTCACAAATAAGGCTGTGG - Intergenic
1146017697 17:29247085-29247107 TGCCCTAGCAACTAAGGCTGGGG + Intronic
1148911511 17:50945416-50945438 AGTCCTAGCTACTCAGGCTGAGG - Intergenic
1149301649 17:55309679-55309701 TCCTCTATCAATTAAGGCTGAGG - Intronic
1151211846 17:72550307-72550329 CCCCCTAGCTACTAGGGCTGTGG + Intergenic
1160974324 19:1785225-1785247 TGGCGTAGAAACCAAGGCTGAGG + Exonic
1164429014 19:28170383-28170405 TGCCTTAGTCACTAAGGCTGAGG + Intergenic
1167070762 19:47221034-47221056 GGCCCTGGGGACTAAGGCTGGGG + Exonic
1167398043 19:49244438-49244460 AGTCCTAGCTACTCAGGCTGAGG - Intergenic
928520476 2:32083560-32083582 TTCCCTAACAACTAATGATGTGG + Intronic
929576256 2:43054742-43054764 TGCCCTAGCAGAGAGGGCTGAGG - Intergenic
930247177 2:48996063-48996085 TTTCCTAGTAACCAAGGCTGAGG + Intronic
930806747 2:55498019-55498041 TGTCCTAGCAACTAGGGCCTTGG + Intergenic
935830896 2:106999841-106999863 TCCCCTACCAACTGAGTCTGGGG - Intergenic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
937483754 2:122292145-122292167 TCCCCTAGAAAGTAAGGCTCAGG - Intergenic
937678224 2:124615325-124615347 TGCTTTAGCAACTAAGCTTGTGG + Intronic
938549750 2:132369129-132369151 TGCACTAACTACTAAGGGTGTGG - Intergenic
944804409 2:203267039-203267061 TGTCCCAGCTACTGAGGCTGAGG + Intronic
948867543 2:240783373-240783395 TGCCCAAGCATCTAGTGCTGAGG + Intronic
1169944792 20:10977248-10977270 TGCCCTAGACTCCAAGGCTGAGG - Intergenic
1170733566 20:18994271-18994293 TGTCCTGGTAACTATGGCTGTGG + Intergenic
1170892781 20:20390311-20390333 TGCCTCAGCAACAAAGTCTGCGG - Intronic
1174126034 20:48307267-48307289 TACCCTAGTCAATAAGGCTGTGG - Intergenic
1175056001 20:56198867-56198889 TGCCCAAGCAACTAAAAATGTGG - Intergenic
1175095649 20:56539351-56539373 GGCACTAGCAACTAAAGATGGGG + Intergenic
1177207722 21:18029721-18029743 TGCCCTAGCAGCTAGGGCTCAGG + Intronic
1182937636 22:34240837-34240859 TGCCTTTGCAACTCAGGATGGGG + Intergenic
949980803 3:9500737-9500759 TGCACCAGCAACTAGTGCTGAGG + Exonic
950075402 3:10183366-10183388 GGCCTTGGCAACTAAGGCTGAGG - Intronic
954433874 3:50485744-50485766 TGCCCTGGTAACTGAGGCTCAGG + Intronic
954830528 3:53417684-53417706 AGCCGCAGCAACAAAGGCTGTGG - Intergenic
960118160 3:113918809-113918831 GGTCCCAGCAACTGAGGCTGAGG - Intronic
962910748 3:139847473-139847495 AGCCCTAGCAACTAAGAGAGAGG + Intergenic
963657973 3:148083773-148083795 TGCCCTAACAACGAAGGTTCAGG + Intergenic
968245339 3:197140599-197140621 TGCCCTACCAAACATGGCTGAGG - Intronic
968392208 4:203076-203098 TGTCCCAGCCACTATGGCTGTGG + Intergenic
970401214 4:15719589-15719611 TGCCCCAGCCCCTAAGACTGTGG + Intronic
970546955 4:17139579-17139601 TCCACTATCAAGTAAGGCTGAGG - Intergenic
971000342 4:22315769-22315791 TGCCATAGCAGCAAAGGCTCAGG + Intergenic
974923672 4:68272204-68272226 AGTCCTAGCTACTAAGGATGAGG + Intergenic
975204071 4:71624203-71624225 TGTCCTAGCAACTCCAGCTGTGG - Intergenic
976691825 4:87876654-87876676 TGCTCTCTCAACTAAGGATGAGG + Intergenic
976753153 4:88471085-88471107 AGCCCCAGCTACTCAGGCTGAGG - Intronic
977188234 4:93967390-93967412 TGCCCCAGCATCTTAGTCTGTGG + Intergenic
977570039 4:98619891-98619913 TGCCCTTATAACTGAGGCTGGGG - Intronic
977582009 4:98735863-98735885 TGGCCTAGCAGCTGGGGCTGTGG - Intergenic
986219719 5:5757079-5757101 TGCCCCAGCAAAGCAGGCTGTGG + Intergenic
990777568 5:59320031-59320053 TATCCTAGCATCTATGGCTGTGG - Intronic
991975107 5:72177493-72177515 ATCCCTGGCAACTAACGCTGGGG - Intronic
994894746 5:105688411-105688433 TGCCATAGCCACTAGGGGTGGGG - Intergenic
996781292 5:127189535-127189557 TTCCCAAGCAACAAAGGCTCAGG + Intergenic
1000484997 5:161830485-161830507 TGCCCTAGATACTGAGGATGTGG - Intergenic
1002472501 5:179444615-179444637 GGCCCCAGCAACTAATGCTTAGG - Intergenic
1004562750 6:16766250-16766272 TGCACTCACAAATAAGGCTGGGG + Intergenic
1005655633 6:27933609-27933631 TTCCCTAGAACCTTAGGCTGTGG + Intergenic
1006282878 6:33069384-33069406 TGCCATAAAATCTAAGGCTGAGG - Intronic
1007621703 6:43219392-43219414 TGCCCTGGCATCTCAGTCTGGGG - Intronic
1010556177 6:77282126-77282148 TCCCCTACCAACTGAGCCTGGGG + Intergenic
1012592262 6:100996575-100996597 TGCCATATCAAGTAAGGATGTGG + Intergenic
1012745787 6:103086790-103086812 TGCCCTACTAAGTTAGGCTGTGG + Intergenic
1014925672 6:127267179-127267201 TGCCCCAGCAGCCAAGGCGGGGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1021841087 7:24722509-24722531 TGCCCTCACAACTAAGGCATGGG + Intronic
1022596996 7:31722218-31722240 TGCAATAGCAACTAAAGATGGGG - Intergenic
1026223783 7:68423120-68423142 TCACATAGCAGCTAAGGCTGTGG + Intergenic
1029218228 7:98967981-98968003 TGCCCTAGAAAATAAAACTGTGG + Intronic
1034401798 7:150866707-150866729 TGCTCTAGCAAATAAGCATGAGG - Intergenic
1034546157 7:151790840-151790862 TGCTCTAACAACTGAGGCCGAGG + Intronic
1035432557 7:158833233-158833255 AGTCCCAGCTACTAAGGCTGAGG + Intergenic
1036170048 8:6475235-6475257 TGCCCTAACAGCAAATGCTGGGG + Intronic
1037878441 8:22561017-22561039 TGCCCTCACCACTCAGGCTGGGG - Intronic
1038296875 8:26300733-26300755 TGTCCCAGCTACTCAGGCTGAGG + Intronic
1044387821 8:91610896-91610918 TGCCCTTGGAAGTAAGCCTGTGG + Intergenic
1045656679 8:104394214-104394236 AGCCCTTCCAAATAAGGCTGGGG - Intronic
1046846167 8:118919131-118919153 TGCCCAAGAAAATAAGGATGGGG + Intergenic
1050726755 9:8658750-8658772 TACCCTAGCTACAAAGGATGAGG + Intronic
1057552282 9:96060843-96060865 TGCCCTTGCCCCTAAGGGTGTGG + Intergenic
1060920905 9:127419647-127419669 TGCCTTAGCAACTATGGCTGGGG + Intergenic
1062664390 9:137660214-137660236 GGTCCTAGCTAATAAGGCTGAGG + Intronic
1191090987 X:56621136-56621158 TGCCCTAGCTAGTAAGTCTCAGG + Intergenic
1192252594 X:69425200-69425222 TGCCCAATCACTTAAGGCTGAGG - Intergenic
1193964732 X:87971697-87971719 TGCCCTGGCAAATAAGGCAGAGG - Intergenic
1195113950 X:101677009-101677031 TGCCCTTGGAAATCAGGCTGAGG + Intergenic
1196634999 X:117992137-117992159 AGCCCTAGCAACTTTGGATGGGG + Intronic
1197130582 X:123001256-123001278 GGGCCTAGCAAAAAAGGCTGAGG - Intergenic