ID: 1146018443

View in Genome Browser
Species Human (GRCh38)
Location 17:29252286-29252308
Sequence ATCATCAGTTATGCTGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146018443 Original CRISPR ATCATCAGTTATGCTGAATG TGG Intronic
901208690 1:7512268-7512290 ATCATCAGTTATGTAACATGTGG + Intronic
901955671 1:12783483-12783505 ACAATCAGTAATGCAGAATGAGG - Intergenic
905614707 1:39387674-39387696 ATCAAAGGCTATGCTGAATGAGG + Exonic
906502641 1:46352703-46352725 AGCATCAGTCATTCTGAGTGGGG - Intronic
907699046 1:56765503-56765525 ACCAACAGCAATGCTGAATGGGG - Intronic
909055774 1:70819222-70819244 TTCCTCAGTTATGCTGATTTGGG + Intergenic
913053919 1:115140196-115140218 ATCATTAGTTGTGCAGGATGGGG + Intergenic
916347800 1:163813871-163813893 AGCAGCTGTTATGCTGAATGTGG - Intergenic
917527474 1:175801843-175801865 AACATCAGTCATACTGAATTAGG + Intergenic
920994941 1:210980987-210981009 TTCATTAGGTATCCTGAATGTGG + Intronic
924127596 1:240871636-240871658 AGCATCAGTTATGATGAATTAGG - Intronic
1069587496 10:69618149-69618171 ACCATCAGTTTTGCAGAATATGG + Intergenic
1069910564 10:71756429-71756451 ATTATTAGTTATGCTGAAAATGG - Intronic
1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG + Intronic
1073230520 10:101965586-101965608 TTCATCTGTTATACTTAATGAGG + Intronic
1073834183 10:107421898-107421920 ATGTTCAGCTATGATGAATGTGG + Intergenic
1074061345 10:109968912-109968934 ACCTTCAGTTTTGCTAAATGAGG - Intergenic
1074140407 10:110667358-110667380 ATGATCATTTAGCCTGAATGAGG + Intronic
1074798325 10:116972327-116972349 ACCATCTGTTATGCTGAAAGGGG + Intronic
1076085558 10:127627066-127627088 ATCTTCAGATCTGCTGAATGAGG - Intergenic
1083303202 11:61749525-61749547 ATGGTCAGTTATGCAGTATGTGG + Intergenic
1085839794 11:79998675-79998697 ATGATCAGTTATACTGAATCAGG + Intergenic
1087632496 11:100666930-100666952 ATCATCAGCATTGCTGACTGTGG + Intergenic
1090384921 11:126352251-126352273 ATCATCTGAGATGCTGGATGGGG + Intergenic
1092054569 12:5498209-5498231 ATCATCATTAACGCTGAAGGAGG - Intronic
1093003234 12:14023810-14023832 ATCATCAGCTATACCCAATGTGG - Intergenic
1095568132 12:43650153-43650175 ATCAGCAGTTTTGCTGATTTGGG - Intergenic
1096024258 12:48347651-48347673 ATAATTAGTGATACTGAATGAGG - Intronic
1098797865 12:74915486-74915508 AACATCATTTGTACTGAATGTGG - Intergenic
1099704340 12:86131502-86131524 ATTAAAAGTTATGCTGAATTTGG + Intronic
1101492875 12:105225789-105225811 ATGAGCAGTTTTGCTGATTGTGG - Intronic
1102442468 12:112974318-112974340 ATTATCAGGTCTGCTCAATGTGG + Intergenic
1106822225 13:33477978-33478000 GTCATGAGTCATGATGAATGAGG - Intergenic
1107615812 13:42166664-42166686 ATAATCAGTTACCCTAAATGAGG - Exonic
1107617407 13:42184443-42184465 ATCATCAGGTATGTGAAATGTGG + Intronic
1109089045 13:58015864-58015886 ATGATCAGATATGATGAATGAGG - Intergenic
1109179300 13:59194343-59194365 AACATCAGAAATGCTGGATGAGG - Intergenic
1114332434 14:21650983-21651005 ACCAGCAGGAATGCTGAATGAGG - Intergenic
1114607991 14:24013655-24013677 ACAATCAGTAATGCAGAATGAGG - Intergenic
1120732736 14:88021348-88021370 ATCACCAATTATACTGACTGTGG + Intergenic
1121474765 14:94187929-94187951 ATCATCAGTTATGTTAATTTAGG + Intronic
1121944654 14:98107896-98107918 ATGATAAGTAATGCAGAATGTGG + Intergenic
1122725662 14:103749687-103749709 TTTATCAGTTATGGTGGATGGGG + Intronic
1125416951 15:39463725-39463747 AACATCAGTCATGTTGAATAAGG + Intergenic
1126683892 15:51230418-51230440 ATCTTCAATCATGCTTAATGAGG - Intronic
1130623537 15:85489371-85489393 ATCAACAGTAATACTTAATGGGG + Intronic
1133726581 16:8543088-8543110 GACATCAATTATGCTGAAAGGGG - Intergenic
1137498194 16:48987394-48987416 CTCATCAGTTAGGCTGTGTGTGG - Intergenic
1138941606 16:61798054-61798076 ATCATGAGTCAAACTGAATGTGG - Intronic
1139315711 16:66066451-66066473 ATCTTCAGTTTTGCTGAGCGGGG + Intergenic
1140080955 16:71746922-71746944 ACCATCATTGTTGCTGAATGGGG - Intronic
1140448138 16:75048270-75048292 AACACCAGTTATGTTGAATTAGG + Intronic
1140619351 16:76709438-76709460 ATCACCTGTGATGCTGAAAGAGG + Intergenic
1146018443 17:29252286-29252308 ATCATCAGTTATGCTGAATGTGG + Intronic
1147786483 17:42981811-42981833 ATCATTAGGCATTCTGAATGAGG + Intronic
1152060368 17:78068917-78068939 AAATTCAGTCATGCTGAATGTGG - Intronic
1153314823 18:3711513-3711535 ATCATCAGCTGTGTTGACTGTGG + Intronic
1153541327 18:6159135-6159157 AGCATCAGCAATGCTGCATGAGG - Intronic
1153700990 18:7693092-7693114 AAGATCAGTTATGATGACTGTGG + Intronic
1154247560 18:12713206-12713228 ATCATCAGTGCTGCTGTTTGTGG - Intronic
1155230807 18:23773140-23773162 TTCGTCAGTTCTTCTGAATGAGG + Intronic
1155979817 18:32168400-32168422 ATCATCCATTATGCTGAATTTGG - Intronic
1156071495 18:33216496-33216518 ATTAGCAGCCATGCTGAATGTGG - Intronic
1157417043 18:47512345-47512367 ACCATCAATTATGCTGCATTTGG - Intergenic
1159171931 18:64781820-64781842 CTCATCAGTTATCCCGAAGGCGG + Intergenic
1161216847 19:3098901-3098923 GTAATCAGTTATGATGATTGTGG + Intronic
1166484252 19:43199352-43199374 ATTTTCAGTTATGCAGGATGAGG + Intronic
928675954 2:33651468-33651490 ATGATCAGATATCATGAATGGGG + Intergenic
929327928 2:40640383-40640405 ATCACCAGTTATTCTGAATTTGG + Intergenic
934131182 2:88950600-88950622 ATCTTCAGTTATCCTGAGTCAGG + Intergenic
934133056 2:88968172-88968194 ATCTTCAGTTATCCTGAGTCAGG + Intergenic
934146838 2:89103174-89103196 ATCTTCAGTTATCCTGAGTCAGG + Intergenic
934222424 2:90097418-90097440 ATCTTCAGTTATCCTGAGTCAGG - Intergenic
934560780 2:95312298-95312320 AGCAGCAGCTATGCTGAGTGGGG + Intronic
935544381 2:104385403-104385425 ACCATAACTTATGCTGAATGAGG + Intergenic
941454590 2:165700375-165700397 TTCCTCAGTTAGGGTGAATGTGG - Intergenic
942200937 2:173570439-173570461 AACAGCAGTTTTGCTGATTGCGG + Intergenic
942919545 2:181354840-181354862 ATCATCATTCATGCTGTCTGTGG + Intergenic
943044794 2:182847693-182847715 GTCATCAGCTATGGGGAATGAGG + Intronic
943828507 2:192427537-192427559 ATCACCATTTATGCTGCATTGGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
947698056 2:232209429-232209451 ATCATCAGTGTTGATGAATGAGG + Intronic
1171440783 20:25161090-25161112 ATCATCAGTTCTGCTAAACAAGG + Intergenic
1175857760 20:62131796-62131818 ACCGTGAGGTATGCTGAATGTGG - Intronic
1176893373 21:14346158-14346180 AACGTCACTTATGGTGAATGGGG + Intergenic
1177499202 21:21929983-21930005 AAAATCAGTTCTGCTCAATGAGG - Intergenic
1181152070 22:20891635-20891657 ATCTTCAGCTCTGATGAATGCGG + Intergenic
1181535437 22:23540238-23540260 ACAATCAGTGATGCAGAATGAGG + Intergenic
1185099923 22:48834161-48834183 ATCCTCTGATATGATGAATGGGG - Intronic
956251894 3:67242723-67242745 ATCATAAATTATACTAAATGAGG + Intergenic
957069225 3:75552764-75552786 ACAATCAGTAATGCAGAATGAGG + Intergenic
959070117 3:101694225-101694247 ACAATCAGTGATGCAGAATGAGG + Intergenic
962711473 3:138090259-138090281 ATTATGAGTTTTGGTGAATGAGG - Intronic
967037183 3:185656677-185656699 ATCATCAGAGAAGCTGAAAGGGG - Intronic
968396440 4:242881-242903 AAAATCAGTAATGCAGAATGAGG + Intergenic
972369865 4:38412775-38412797 AGCATCAGTTATAATCAATGTGG + Intergenic
972912488 4:43834778-43834800 ATCATCAACTAATCTGAATGGGG + Intergenic
973027103 4:45285639-45285661 ATAATCAGTTATTCTCTATGAGG + Intergenic
973722009 4:53733403-53733425 ATCATCAGGAATGCTGCGTGTGG + Intronic
974124785 4:57682760-57682782 AACATCAGTCATACTGAATTAGG + Intergenic
977155703 4:93570302-93570324 GTCAACAGTGAGGCTGAATGAGG - Intronic
977254395 4:94725028-94725050 TTTATCACTTATGCTGGATGTGG + Intergenic
977797445 4:101183857-101183879 ATCATAATTTATGATGAATCAGG - Intronic
978957827 4:114636505-114636527 ATAAGCATTTGTGCTGAATGTGG + Intronic
979795649 4:124843514-124843536 ATCAGCAGTTAAGCTGTATTTGG + Intergenic
981010988 4:139924913-139924935 ATCATCAGTAATGCAGATTTGGG - Intronic
981204756 4:142026910-142026932 ACCATTTGATATGCTGAATGAGG + Exonic
981879166 4:149588586-149588608 GTCATCAGTCCTGCTGAATTAGG - Intergenic
982913609 4:161177034-161177056 ATCCTCAGTTTTGCTGATTAAGG + Intergenic
983829640 4:172309656-172309678 ATCATGAGTTATGAAGAAAGAGG + Intronic
983950645 4:173636448-173636470 AACATCAGTTGTCCTGAGTGGGG - Intergenic
984386606 4:179067733-179067755 AACAGCACTTATTCTGAATGAGG - Intergenic
986336957 5:6762533-6762555 ATCAGTAGTTATGCAAAATGTGG + Intergenic
987506824 5:18784252-18784274 ATCAGTAGTTATGCTCAAGGTGG + Intergenic
994357991 5:98816559-98816581 AAGATCAGTTATGCTCAATCTGG + Intergenic
997345481 5:133188430-133188452 ATCATCAGGGATGCAGAAGGGGG - Intergenic
999752797 5:154642179-154642201 ACAATCAGTAATGCAGAATGAGG - Intergenic
1003357334 6:5386078-5386100 ATCTTCCATTATGCTGACTGTGG - Intronic
1004280907 6:14278832-14278854 AACATCAGTTTTGCTAAATCCGG + Intergenic
1005604808 6:27465807-27465829 TTTATCAGTTATTCTGAAAGGGG - Intronic
1007218730 6:40261889-40261911 AGCATCAGTATTGCTGATTGGGG + Intergenic
1009641642 6:66344990-66345012 AACATCTGTTATTTTGAATGTGG + Intergenic
1009902496 6:69824903-69824925 TTCATCAGTTATGCTGGAGAAGG + Intergenic
1011362420 6:86541741-86541763 ATCATCAGCTATGCTATATAAGG - Intergenic
1011430769 6:87284211-87284233 AGCCTCAGATATGTTGAATGTGG - Exonic
1012818055 6:104049553-104049575 ATCCTCTGTTAAGCTCAATGGGG + Intergenic
1015391083 6:132682561-132682583 ATCATCAGTCATATTGAATTAGG + Exonic
1015721834 6:136250365-136250387 ATCTTCAGTTTTGCCCAATGAGG - Intergenic
1016026887 6:139296673-139296695 ATCCTCAGGTATCCTGAAAGGGG + Intergenic
1017058004 6:150455183-150455205 ATCATCAGGGAACCTGAATGAGG + Intergenic
1018540148 6:164870841-164870863 TTCACCTGTTATGCTTAATGAGG + Intergenic
1020507620 7:9013673-9013695 ATCATTAGCTAGGCTGATTGTGG - Intergenic
1021454650 7:20816514-20816536 GTATTCAGTCATGCTGAATGAGG - Intergenic
1028289542 7:89047571-89047593 ATAGTAATTTATGCTGAATGAGG + Intronic
1030313709 7:108092995-108093017 ATCATCAGTTATGCTCAATCTGG + Intronic
1030818116 7:114061500-114061522 TACACCAGATATGCTGAATGTGG + Intronic
1031508701 7:122621434-122621456 ATCATCATTTATGCTGTCAGAGG + Intronic
1036914204 8:12789029-12789051 ATCAACTGTTATGCTTAGTGTGG + Intergenic
1041503205 8:58561900-58561922 AGCATCAGTAATGCAGTATGGGG + Intronic
1043167224 8:76919030-76919052 ATCATCAGTTGTCTAGAATGGGG + Intergenic
1044538665 8:93385711-93385733 GTCATCAGTTAGGCTCAATTTGG + Intergenic
1050208640 9:3227678-3227700 ATCATCAGTGTTGCTTTATGTGG + Intronic
1061681924 9:132246840-132246862 ATTAACAGTTATGCTGGACGTGG - Intergenic
1188031976 X:25274235-25274257 ACCACCAGACATGCTGAATGAGG - Intergenic
1194423793 X:93711036-93711058 ATCATCAGTTATATAGAATATGG - Exonic
1195695926 X:107667406-107667428 ATCATCAATGAAACTGAATGAGG - Intergenic
1197156019 X:123271344-123271366 ATCATCATTCATACTTAATGAGG + Intronic
1198591822 X:138191688-138191710 CCTATCAGTTATGTTGAATGTGG + Intergenic