ID: 1146019045

View in Genome Browser
Species Human (GRCh38)
Location 17:29259737-29259759
Sequence TGCTCTTGCATTATTGGGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146019045_1146019048 0 Left 1146019045 17:29259737-29259759 CCATTCCCAATAATGCAAGAGCA 0: 1
1: 0
2: 1
3: 7
4: 147
Right 1146019048 17:29259760-29259782 ACATACCAATCATGCTGCAATGG 0: 1
1: 0
2: 0
3: 3
4: 122
1146019045_1146019049 1 Left 1146019045 17:29259737-29259759 CCATTCCCAATAATGCAAGAGCA 0: 1
1: 0
2: 1
3: 7
4: 147
Right 1146019049 17:29259761-29259783 CATACCAATCATGCTGCAATGGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146019045 Original CRISPR TGCTCTTGCATTATTGGGAA TGG (reversed) Exonic
903388815 1:22948974-22948996 TTATCTTGGATTATTGGGATGGG - Intergenic
905541450 1:38763539-38763561 TCCTCTTGCATTAATGGGGGTGG + Intergenic
907916195 1:58872159-58872181 TGTTTTTGCATTGATGGGAATGG - Intergenic
908137872 1:61151603-61151625 TGAACTTCCAGTATTGGGAATGG - Intronic
911292401 1:96073051-96073073 TGATCTTGCACTTTTGGGAGAGG - Intergenic
912252679 1:108027480-108027502 TGCTCCTGGCTTATTGAGAATGG + Intergenic
912397975 1:109362564-109362586 TGTTTTATCATTATTGGGAAAGG + Intronic
916270413 1:162935245-162935267 TGCTCTTCCATACTAGGGAATGG + Intergenic
916801435 1:168220108-168220130 AGCTGTTTCAGTATTGGGAAGGG - Intergenic
918698273 1:187573494-187573516 TGCTCTGTCATTATTGGGCATGG - Intergenic
920076800 1:203343054-203343076 TGCTCTGGCAGTATTTAGAATGG - Intronic
1069745235 10:70710843-70710865 TGGTCATGCATTTCTGGGAACGG + Intronic
1071725774 10:88196918-88196940 AGCTCTTGCAGCATTTGGAAAGG - Intergenic
1073788333 10:106914563-106914585 TGCTCTGTCATTATTGTGCATGG + Intronic
1079017732 11:16883671-16883693 TGGTCTGGCATGATTAGGAAGGG - Intronic
1079247404 11:18762773-18762795 TGTTCTTGCTATATTGTGAATGG + Intronic
1086663134 11:89446700-89446722 TGGTCTGGCGTTAGTGGGAAAGG + Intronic
1087984452 11:104659876-104659898 TGCTCCTGTATTATTGGGGTAGG + Intergenic
1091841612 12:3625464-3625486 TGGTCTGGGATTAATGGGAATGG - Intronic
1092036182 12:5337010-5337032 TACTCTGGAATTGTTGGGAAAGG - Intergenic
1093588459 12:20871218-20871240 TGCTCCTCCATTTTTTGGAATGG + Intronic
1097314841 12:58160933-58160955 TGCACTGTCATTATTGGTAACGG - Intergenic
1097454515 12:59780835-59780857 TGCTCTTGCATTTTGTGGAAGGG - Exonic
1100793040 12:98151726-98151748 TGCTCTAGGATTAATGGGCACGG - Intergenic
1101680919 12:106964515-106964537 AGCTGATGCATTACTGGGAAAGG - Intronic
1110471147 13:75861662-75861684 TGCTAGTACATTATAGGGAAGGG - Intergenic
1113816522 13:113175525-113175547 TTCTCTTGCAGTGTTGGGTACGG - Intergenic
1120804854 14:88736445-88736467 TGCCCTTGCATAATTAGAAAAGG + Exonic
1121065110 14:90955791-90955813 TCTTTTTGCATTATTGAGAATGG + Intronic
1123064974 14:105613832-105613854 TGCTCCAGCATTATTGGAATCGG + Intergenic
1126173124 15:45710798-45710820 CACTCTTGCCTTATTAGGAATGG - Intergenic
1127535428 15:59885752-59885774 TGGTCTTGCAGTATGGGGCAGGG + Intergenic
1127543801 15:59970166-59970188 TGTTCTTGTATTATTTAGAAAGG + Intergenic
1137384553 16:48029626-48029648 CGCTGTTGCATTCTTGGGAGAGG - Intergenic
1139258968 16:65573853-65573875 TGACCTTGCCCTATTGGGAAGGG - Intergenic
1145903331 17:28501837-28501859 AGCTGCTGCAGTATTGGGAAAGG - Intronic
1146019045 17:29259737-29259759 TGCTCTTGCATTATTGGGAATGG - Exonic
1147050201 17:37788668-37788690 TGCTTTGGCATTCTTGGGAGAGG + Intergenic
1149295971 17:55263323-55263345 GGCACTTACATTATTAGGAAAGG - Intergenic
1151209206 17:72531455-72531477 AGCGGTTGCTTTATTGGGAATGG - Intergenic
1152524166 17:80878013-80878035 TGCTCCTGCCTCAGTGGGAAAGG + Intronic
1152862838 17:82705735-82705757 TGCTCTTCAACTGTTGGGAAGGG - Intergenic
1153113271 18:1620121-1620143 TGCTTTTTCCTTATCGGGAAAGG - Intergenic
1156313476 18:35946576-35946598 TGCTTTGGCATTAATGGGACTGG - Intergenic
1157115430 18:44858329-44858351 TGCTCTTGCATTAGTGTTACTGG - Intronic
1159683002 18:71378852-71378874 TGCTCTTGTGTTATATGGAAAGG - Intergenic
1159692413 18:71505315-71505337 TGCACTTGCACTACTTGGAATGG - Intergenic
1164356918 19:27446363-27446385 TGTTCTTGCAGTATCTGGAAAGG + Intergenic
925236631 2:2284552-2284574 TTCTCTTGAGTTAATGGGAATGG + Intronic
929734710 2:44535339-44535361 TCCTCTTGCATTTTTTGGAATGG - Intronic
932005403 2:67922354-67922376 TGCTCTTGGGTTCTTGGGAGGGG - Intergenic
939981580 2:148788871-148788893 TGATCTTGAATTATTGGGAAAGG - Intergenic
941643153 2:168010945-168010967 TACTCTAGCATTATTGGGGAAGG + Intronic
942378550 2:175362340-175362362 TTTTCTAGCATTAATGGGAAAGG - Intergenic
943086331 2:183316179-183316201 TACTCATTCATTATTGGAAATGG - Intergenic
944155422 2:196602274-196602296 TACACTCGCATTATTGGCAAAGG + Intergenic
945624148 2:212179815-212179837 TCCTATTGAATTACTGGGAATGG + Intronic
945896591 2:215489586-215489608 TGCTCTCCCATTATCGAGAAGGG - Intergenic
945944778 2:215984350-215984372 TGCTCTTACATTTTTGGTTAAGG - Intronic
946111532 2:217422730-217422752 TGCTCTTGTGTTTTTTGGAAGGG - Intronic
946683985 2:222248460-222248482 TGCTCTTGCAGTACAGAGAAGGG - Intronic
947202634 2:227628611-227628633 AGCTCTTGCCTGCTTGGGAATGG - Intronic
947954798 2:234179408-234179430 TTATCCTGCATTATTGGGAGGGG - Intergenic
1171918975 20:31082806-31082828 TGCACTTGAATGATTTGGAAAGG + Intergenic
1171927464 20:31200894-31200916 TGCACTTGAATGATTTGGAAAGG + Intergenic
1174134398 20:48369030-48369052 TGCTCTTGCCATCTTTGGAATGG + Intergenic
1177932172 21:27298591-27298613 TGCTTCTGCATGACTGGGAATGG + Intergenic
1178455920 21:32751079-32751101 TGCTCTGGCTTGTTTGGGAAGGG - Intronic
1182118428 22:27771672-27771694 TGCTTTTGCATGACAGGGAAAGG + Intronic
949768989 3:7557821-7557843 TGATCCTGCCTTATTTGGAAAGG - Intronic
952491059 3:33873115-33873137 TACTCTTTCATTAAAGGGAATGG - Intergenic
954576279 3:51678109-51678131 TGCCCTTGCATGACTGGGGAAGG + Intronic
954906120 3:54064464-54064486 TGCTGTGGCATTAGTGGGAGAGG + Intergenic
955462830 3:59203634-59203656 TACTCTGCCATTTTTGGGAAGGG + Intergenic
958098407 3:88976826-88976848 TTCTCTTCAATTATTTGGAATGG - Intergenic
962111031 3:132448466-132448488 TGCTGTTACATTACTGGAAAAGG - Intronic
962908760 3:139828662-139828684 TGCTGTTACATAATGGGGAAGGG + Intergenic
968468451 4:764873-764895 CGTTCTTGCATGATTGGGGAGGG + Intronic
969197820 4:5577130-5577152 TTCTCTTGCTTTATAGGTAAAGG + Intronic
971930674 4:33078653-33078675 TGCTCTGGTATCACTGGGAAAGG - Intergenic
972185012 4:36518217-36518239 TGGTCTTGCTTTATTGCAAAGGG - Intergenic
972303735 4:37811685-37811707 TGTAGTTGCATTATTGGAAATGG - Intergenic
973649560 4:52984863-52984885 GTCTCCTGCATTATTGGAAAAGG - Intronic
974285485 4:59860934-59860956 TCCTCTTAGATTATTTGGAATGG + Intergenic
976157873 4:82167131-82167153 TGCTCTTGCTCTACTGGCAAAGG + Intergenic
977101310 4:92818912-92818934 TGCTATAGAATTATTGTGAAGGG - Intronic
977889587 4:102293383-102293405 TTCTCTTGTTTTATTGGCAAGGG - Intronic
979825047 4:125222371-125222393 TGTTCTAGTAATATTGGGAAGGG - Intergenic
980276628 4:130660358-130660380 AGGTCTTGCATTAGTGAGAATGG + Intergenic
981138432 4:141238965-141238987 TGCTCTTACATGATGGGGATAGG + Intergenic
982241734 4:153306679-153306701 TGCTGTAGGGTTATTGGGAATGG - Intronic
983490103 4:168378985-168379007 TGCTCATGCGTTATGGGGAGTGG - Intronic
984210712 4:176844314-176844336 TGCTCAAGCATTATTGGAACTGG - Intergenic
984766124 4:183401828-183401850 TGCTCTTGTATTCTTGAAAAGGG + Intergenic
985989830 5:3546684-3546706 TGCTCTTGCATGTTTCAGAATGG - Intergenic
988088508 5:26503605-26503627 TGCTCTTGCGGCAGTGGGAATGG + Intergenic
988669455 5:33365365-33365387 TGGTCTTGCCATATCGGGAATGG - Intergenic
989853237 5:46242661-46242683 TGTTTTTGCAGTATTGGCAAAGG - Intergenic
990172768 5:53072899-53072921 TGCTATTGTATTAGAGGGAATGG - Intronic
992001934 5:72444280-72444302 TGCTCTTGCAGGTCTGGGAAGGG - Exonic
994023719 5:95058170-95058192 TGTATTTGAATTATTGGGAAGGG - Intronic
994411663 5:99414197-99414219 TGCTCTTCTATCATTGGGAGGGG + Intergenic
994482161 5:100351053-100351075 TGCTCTTCTATCATTGGGAGGGG - Intergenic
1000257450 5:159553461-159553483 TGGTCTAGCATTACTGGGGAGGG - Intergenic
1000478964 5:161747081-161747103 TTCTCTTTCTTTTTTGGGAAAGG + Intergenic
1001366017 5:171140826-171140848 TACTCTTACATTACTGTGAAGGG + Intronic
1003363949 6:5455004-5455026 GGCACTTGCAGTCTTGGGAAGGG - Intronic
1004827725 6:19441848-19441870 TACTCATGCAGTATTGTGAATGG + Intergenic
1008148117 6:47916531-47916553 AGCTCTTTCATAATTGGGAATGG - Intronic
1008834755 6:55812091-55812113 ATATCTGGCATTATTGGGAAAGG - Intronic
1009842545 6:69094392-69094414 TGCTCCTGTTTTATTGAGAAAGG + Intronic
1009904349 6:69850026-69850048 TGCTCTTTCAATAGTGAGAAGGG - Intergenic
1010795339 6:80111441-80111463 TGCTCTCGCATTTTTGGCAGGGG + Intronic
1011960525 6:93083247-93083269 TGCTCTTTTAGTATTTGGAATGG + Intergenic
1012023005 6:93949845-93949867 TTCCCTTGTATTATTGAGAAAGG - Intergenic
1014014637 6:116516192-116516214 TGCTCTTGCATTGGTGGAGAGGG + Exonic
1015119274 6:129683727-129683749 TGTTATTGCATTGTTGTGAAAGG - Intronic
1015846126 6:137522749-137522771 TTCTCTGACATTATTGGGAGGGG - Intergenic
1016077012 6:139807644-139807666 TTCTCTTGTATTTTTTGGAAGGG + Intergenic
1021076848 7:16315606-16315628 TGCTCTAGCATTTTTCAGAATGG + Intronic
1024602862 7:51000193-51000215 TTCTCTTGAATCCTTGGGAATGG + Intergenic
1024909683 7:54431697-54431719 TGCTCTTTCATTATTAAGTATGG - Intergenic
1027849356 7:83429778-83429800 AGCTGTTTGATTATTGGGAAGGG + Intronic
1028327960 7:89550034-89550056 TGCTCCTGCATCATGGGCAAAGG - Intergenic
1034860932 7:154594171-154594193 TAATCTTGCATTATTAGAAATGG + Intronic
1035602781 8:906546-906568 TGTTCTTGCACTGTTGGGCATGG + Intergenic
1035771394 8:2149906-2149928 TGCACTTTCATTTTTGGAAAAGG + Intronic
1037112324 8:15178248-15178270 TGCTCTTGCATTATCATCAAAGG - Intronic
1039441603 8:37598901-37598923 TGCCCTTGCTTTCTGGGGAAAGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1041937938 8:63355644-63355666 TGCTCTAGAACAATTGGGAAGGG + Intergenic
1045917578 8:107490642-107490664 TCCTCTTGCAATATAGGGCAGGG + Intronic
1046190304 8:110786410-110786432 TCCTCTTGCATCTTTGGCAATGG + Intergenic
1047102724 8:121695730-121695752 TGCTCTTGGATTATTGACCAAGG + Intergenic
1047997688 8:130352340-130352362 TGCACTTGCATTCTTGAGCAAGG + Intronic
1058755160 9:108076996-108077018 TGCCCGTTCATTATTGGTAAAGG - Intergenic
1060761887 9:126259827-126259849 TTCTCTTGAATTATTTTGAAGGG + Intergenic
1061741988 9:132713812-132713834 TGTTCTTAAATTAATGGGAATGG + Intergenic
1061757549 9:132826015-132826037 TGCCCTTGCCTTTTTGGGCAGGG + Intronic
1186154414 X:6710662-6710684 AGCTCCTGCACTATTTGGAATGG - Intergenic
1188269414 X:28120183-28120205 TGCTTTTGCAATATGGGGAAGGG + Intergenic
1188321551 X:28744509-28744531 TGCTTTTGCAGTTTTGGAAAAGG + Intronic
1188370104 X:29359328-29359350 TTCTGTTGTATTTTTGGGAAGGG - Intronic
1189555706 X:42143091-42143113 GGCTCTTGTAGTATTGTGAAAGG + Intergenic
1190050014 X:47142510-47142532 TGTTCCTGCACCATTGGGAATGG - Intronic
1192031938 X:67523252-67523274 TGTACTTTCATTAGTGGGAAAGG - Intergenic
1195850296 X:109275563-109275585 TGATCTAGTATTATTGAGAATGG + Intergenic
1196690197 X:118550793-118550815 AGCTCTTGGATAATTGGAAAAGG + Intronic
1196990456 X:121323197-121323219 TGCTTTTGCATTATAGTGAGAGG - Intergenic
1201781906 Y:17732053-17732075 TTCTCATGCATAAGTGGGAATGG - Intergenic
1201819647 Y:18173937-18173959 TTCTCATGCATAAGTGGGAATGG + Intergenic
1201932725 Y:19370867-19370889 TGCTCTTGCATTAGTTGGCAAGG + Intergenic
1202173424 Y:22074964-22074986 TTCTCATGCATAAGTGGGAATGG - Intronic
1202217936 Y:22511410-22511432 TTCTCATGCATAAGTGGGAATGG + Intronic
1202325249 Y:23684649-23684671 TTCTCATGCATAAGTGGGAATGG - Intergenic
1202545522 Y:25985405-25985427 TTCTCATGCATAAGTGGGAATGG + Intergenic