ID: 1146020147

View in Genome Browser
Species Human (GRCh38)
Location 17:29271052-29271074
Sequence TACTTCTTTACTGCAGCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146020145_1146020147 -10 Left 1146020145 17:29271039-29271061 CCCAAGTTGAAGATACTTCTTTA 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1146020147 17:29271052-29271074 TACTTCTTTACTGCAGCTTAAGG 0: 1
1: 0
2: 4
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146020147 Original CRISPR TACTTCTTTACTGCAGCTTA AGG Intronic
901110280 1:6787856-6787878 GATTTCTTTACTGCAGTGTAGGG + Intronic
904003653 1:27351970-27351992 TACCTCTGTACTGCAGCCTCTGG - Intronic
905696968 1:39981669-39981691 CACTACTGTACTCCAGCTTAGGG - Intergenic
906909334 1:49929496-49929518 TACTTATTTACTTCAGTTTTTGG - Intronic
907516871 1:54998382-54998404 TACTTCTTAACTGCAGCTTGAGG - Intergenic
908257260 1:62313293-62313315 TACTACTGTACTGCATTTTATGG + Intronic
909296306 1:73953646-73953668 TACTTTCTTACTGCAGCTCTAGG - Intergenic
911594582 1:99785895-99785917 TACTTCTTTCATTCAGTTTATGG + Intergenic
912582295 1:110731407-110731429 TACTTTGTTACAGCAGCTTTAGG + Intergenic
913290296 1:117265681-117265703 TACTTCGTTACAGCAGCCTTAGG - Intergenic
914421820 1:147535652-147535674 TTCTTCTATACTGGAGCTTTTGG + Intergenic
915879176 1:159647600-159647622 TACATATTTACTGCATCTCAGGG - Intergenic
918866618 1:189908258-189908280 TACATGTTTAATGAAGCTTATGG - Intergenic
920896690 1:210058111-210058133 TACCTCTTTATTCCAGCTTTCGG - Intronic
920922381 1:210308967-210308989 TACTTTGTTACTGCAGCTGTAGG - Intergenic
922557423 1:226543088-226543110 TTCTTCCTGACTGCAGCTGAAGG - Intergenic
1064850875 10:19707242-19707264 TTCTTCTTTCCTCCAGCTTAAGG + Intronic
1065765956 10:29029567-29029589 AACATCTTGACTGCAGCTTCAGG - Intergenic
1069091310 10:64202309-64202331 GACTTCCTGAGTGCAGCTTAGGG + Intergenic
1071827921 10:89343651-89343673 TACTTCTTCACTGTAGCTGTTGG - Intronic
1073727626 10:106252764-106252786 GAATTCTTTCCTGCAGCATATGG - Intergenic
1074351815 10:112745044-112745066 TACTTTTTTCCTGCATTTTATGG - Intronic
1075932442 10:126310927-126310949 GACTTCTTTCCTGCTCCTTAGGG - Intronic
1076227978 10:128796207-128796229 TACTGCTTTAATGCAGTTTGGGG - Intergenic
1076287707 10:129316250-129316272 TGCTTCTTTATTGTAGCATAGGG - Intergenic
1076775337 10:132692963-132692985 TATTGGTTAACTGCAGCTTATGG + Intronic
1078868386 11:15320579-15320601 TATTTGTTAACTGCAGGTTAGGG + Intergenic
1079871040 11:25798321-25798343 TACTTCTCTTCTGTAGCTTAGGG + Intergenic
1083913660 11:65726100-65726122 TACTTCTTTTCTGTCGCTTTGGG + Intergenic
1084551556 11:69846246-69846268 TCCTTGTTTTTTGCAGCTTAGGG - Intergenic
1085005377 11:73083639-73083661 TACTTCTTTTCCGTGGCTTAAGG - Intronic
1087084957 11:94208203-94208225 TACTTTTCTTCTGCAGCATATGG - Intergenic
1089310859 11:117557333-117557355 GCCTTCTTTCCTGCACCTTAGGG - Intronic
1089911120 11:122101692-122101714 TCCTTCTTCACTGAAGCCTAGGG - Intergenic
1096198633 12:49665334-49665356 TACATCTTTCCTGGTGCTTAAGG + Intronic
1098952543 12:76656391-76656413 TACTTTTTTACTACAGCTGCTGG - Intergenic
1099009688 12:77277089-77277111 TACTTCTCTCTTGTAGCTTAAGG + Intergenic
1099107350 12:78512723-78512745 TTCTTTTTTACTGCATTTTATGG - Intergenic
1099847346 12:88044674-88044696 GACATCTGTACTGAAGCTTAAGG + Intronic
1101664747 12:106801981-106802003 TAGTTCTTAACTGGAGCTGAAGG - Intronic
1108475006 13:50807051-50807073 TACTTCTTTACTAAAGTTTGCGG - Intronic
1109605793 13:64693440-64693462 TTTTTTTTTACAGCAGCTTAGGG + Intergenic
1110118695 13:71853083-71853105 CTCTTTTTAACTGCAGCTTAGGG + Intronic
1110308891 13:74023376-74023398 TACTTCCTTACTGCAGCCCTAGG - Intronic
1112664651 13:101555947-101555969 TACTTCTTCATTTAAGCTTAGGG + Intronic
1112748776 13:102558575-102558597 TAATTTGTTACTGCAGCTTCAGG - Intergenic
1115732569 14:36287224-36287246 TACTTCTTTACTGCAGTTCATGG + Intergenic
1115961683 14:38841035-38841057 TAGTTCTTTCATGCAGCTTCTGG + Intergenic
1117761095 14:59029487-59029509 AACTTCTTTACTTCAATTTAAGG + Intergenic
1119991800 14:79206527-79206549 TACTTGTATACTTCAGCTCATGG - Intronic
1124135030 15:27027711-27027733 CACTTCTTTGCTCCAGTTTAGGG - Intronic
1124798266 15:32803989-32804011 GACTTCTTTCCTGTAGCATAAGG - Intronic
1126590195 15:50331479-50331501 TACTTCTTCACTGTAGCTCAGGG - Intronic
1128849072 15:70933032-70933054 TAGTTCTTTTATGCAGTTTAGGG + Intronic
1131026502 15:89146604-89146626 TACTTCTTTACTAATCCTTATGG - Intronic
1132433141 15:101776458-101776480 AACTGCTTTACTGCGGCTCAAGG + Intergenic
1137462827 16:48680902-48680924 TGCTTCTTTCCTGCATTTTAAGG - Intergenic
1142475840 17:189085-189107 TACTTCATTTCTGCTGCTAAGGG + Intergenic
1142774313 17:2124237-2124259 AACTTCTTTACTGTAGCATTTGG - Intronic
1146020147 17:29271052-29271074 TACTTCTTTACTGCAGCTTAAGG + Intronic
1146792013 17:35756413-35756435 TTCTGCTTTACTGCAGCCTGAGG - Intronic
1153969151 18:10209252-10209274 TTGTTCTTTACTGCATCTTTTGG - Intergenic
1155851864 18:30783986-30784008 TACTTCTTTACTTCAGTTTAGGG - Intergenic
1158841677 18:61394660-61394682 TACTTTGTTACTGCAGCTCTAGG + Intronic
1159923993 18:74250514-74250536 TACTTGGTTACAGCAGCCTAGGG + Intergenic
1162236222 19:9311712-9311734 TACTTCTTCACTGCGGCTTGAGG + Intergenic
1163838312 19:19589947-19589969 CACTTCTTTGCTGCCTCTTAGGG - Intronic
925994097 2:9277723-9277745 TATATCTTTACTTCACCTTAGGG + Intronic
931945174 2:67298518-67298540 TGCTGCTTCACTGCAGATTATGG + Intergenic
933260138 2:80123228-80123250 TTCTTATTTTCTGCAGTTTATGG + Intronic
933838165 2:86262457-86262479 TACTCCTTCACTACAGCTTGAGG + Intronic
934734144 2:96679920-96679942 TACTTGTTTTCTGAAGTTTACGG + Intergenic
936923913 2:117717377-117717399 TATTTCATTAGTGCAGCTGAGGG - Intergenic
937091034 2:119206413-119206435 TCCTTCTTGAGTGCAGCTTATGG + Intergenic
937896268 2:126978885-126978907 TGATTCTTTTCTGCAGCTTTGGG - Intergenic
941688624 2:168474338-168474360 TACTTCTTTATGTCAGTTTAGGG - Intronic
1169845769 20:9989880-9989902 GACTTCCTTACTGCAGCCTCAGG - Intronic
1170327298 20:15171021-15171043 TCCTACTTTACTCTAGCTTAGGG - Intronic
1171947372 20:31390309-31390331 TCCTTCTCTCCTGCAGCTTCGGG - Intronic
1177873800 21:26606692-26606714 TAAATCTTTACTGCTGCTTTTGG - Intergenic
1181312573 22:21953049-21953071 TGCTTCTCTTCTGCAGCTTTGGG + Intergenic
949269747 3:2200829-2200851 TGCTTCTCTACTGAAGCATAAGG - Intronic
949676189 3:6456107-6456129 TATTTTATTACTGCAGCTTCAGG - Intergenic
950315360 3:11997155-11997177 TCCTTCTTTACTGCAAATTTGGG + Intergenic
951801998 3:26606101-26606123 TAATTCTCTAATGCAGCTCAAGG - Intergenic
952935182 3:38392039-38392061 CACTTCTTTACTTTAGCTTGGGG + Intronic
959882052 3:111455040-111455062 TTCTTTTTAACTGCACCTTAAGG + Intronic
964921176 3:161897566-161897588 TACTTATTTTCTGCAGCTACAGG + Intergenic
965487888 3:169300842-169300864 TACTTCTATACTGGAGCCTGGGG + Intronic
969861673 4:10040729-10040751 CACTCCTTTTCTGAAGCTTAGGG + Intronic
972534177 4:39985841-39985863 TACTTCTTTACTACAGTTATGGG - Intergenic
978343378 4:107740313-107740335 GACATCCTTACTGCAGCTCAAGG + Intergenic
979369323 4:119864493-119864515 TATTTATTTACTGCAGATTTTGG + Intergenic
980511893 4:133802574-133802596 TGTTTATTTACTGCAGCATAAGG + Intergenic
981226362 4:142299198-142299220 TACTACTATACTCCAGCCTAGGG - Intronic
983868232 4:172793562-172793584 TATATCTTTGCTGCAGCTCAAGG + Intronic
983997437 4:174201758-174201780 TTCACATTTACTGCAGCTTATGG - Intergenic
985116694 4:186599024-186599046 TACTCCTTTACTCCTGCTTCGGG + Intronic
986205487 5:5621188-5621210 TTCTCATTTGCTGCAGCTTAAGG + Intergenic
987796957 5:22640244-22640266 TACTTTTTTGCTTCAGCTCATGG + Intronic
991520911 5:67495685-67495707 TACTTCTTTGCTGCAGAATATGG - Intergenic
994496805 5:100523006-100523028 TACTTCTTTTCTGCTGGTTTTGG - Intergenic
994817706 5:104605381-104605403 TGCTTACTTACTGGAGCTTAAGG - Intergenic
996097323 5:119412535-119412557 TACTCTTTTACTTCAGCTGAGGG + Intergenic
996512041 5:124327561-124327583 CACCTATTTGCTGCAGCTTAAGG - Intergenic
1000028294 5:157379266-157379288 TACATCTCTACTGCTGCTTTTGG + Intronic
1001136914 5:169110327-169110349 TACTTTGTTACAGCAGCTTTAGG - Intronic
1001137048 5:169111268-169111290 TACTTTGTTACAGCAGCTTTAGG + Intronic
1001689059 5:173618746-173618768 TCCTTCTTTTCTGAAGATTATGG - Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1008950504 6:57153106-57153128 AACTTGTTGACTGCAGCTTATGG + Intronic
1012532928 6:100260411-100260433 TACACCTTTACTGCAGATAAAGG - Intergenic
1012625344 6:101398704-101398726 TACTTCTTTCTTGCAACTCAAGG + Intergenic
1012792534 6:103715086-103715108 TTTTTCTTAACAGCAGCTTAGGG - Intergenic
1014472911 6:121837894-121837916 TTTTTTTTTACAGCAGCTTAAGG + Intergenic
1014501736 6:122199226-122199248 TACTTCTTTCCTCTATCTTAAGG + Intergenic
1015386134 6:132625676-132625698 TACCCCTTTTCTTCAGCTTAAGG - Intergenic
1015798744 6:137039494-137039516 GATTTCTGTACTGCAGCTAATGG - Intronic
1015900696 6:138062566-138062588 TACTTTGTTACTGCAGCTACAGG - Intergenic
1017594613 6:156015003-156015025 TATGTCATTACTGCAGCTTCAGG - Intergenic
1019142759 6:169958622-169958644 TACTTCTTCACTGTTGTTTAGGG - Intergenic
1019788113 7:2992410-2992432 TAATTTTTTACTGCAGCTCTAGG - Intronic
1022226699 7:28370990-28371012 TACTTCTTTCCTTCAGTCTAGGG - Intronic
1023185178 7:37525469-37525491 TATTTCTTTAAGGAAGCTTATGG + Intergenic
1023273716 7:38495363-38495385 TACTTACTTACTCCAGTTTAGGG + Intronic
1027866526 7:83654871-83654893 AACTTCTTTACTGAAGTTTATGG - Intergenic
1028464430 7:91134463-91134485 TATTTCTTATCTGCAGCTAAGGG + Intronic
1028955024 7:96679586-96679608 TACTTTTTTATTGCTGCCTATGG - Intronic
1032884339 7:136121758-136121780 TACTTGTGTGCTGCAGCTTAGGG + Intergenic
1033592057 7:142817392-142817414 TACTTTATTACAGCAGCTCAAGG - Intergenic
1039096590 8:33893567-33893589 TTCTTCTTCACTGCAGCCAAGGG + Intergenic
1042319482 8:67459982-67460004 TACTTCTTTAGAGCAGTTTTTGG - Intronic
1043679542 8:83005242-83005264 ATCTTTTTTACTGCAGCTTTAGG + Intergenic
1044713995 8:95083645-95083667 TACATATTTACTGCATCATAAGG - Intronic
1044869582 8:96605857-96605879 TACTTCTTTTCTGCACCTTAAGG - Intronic
1046209438 8:111048591-111048613 GAATCCTTTACAGCAGCTTAAGG + Intergenic
1057740186 9:97704480-97704502 TACTACATGAATGCAGCTTAAGG - Intergenic
1058300569 9:103366904-103366926 TACTCCTATACTGCTTCTTAAGG + Intergenic
1185754079 X:2638737-2638759 TATTTCTTTATAGCAGCGTAAGG + Intergenic
1185830282 X:3295309-3295331 TATTTCTTTATTCCAGATTAGGG - Intergenic
1186512573 X:10141032-10141054 GGCTTCTTTCCTGCAGCTGAGGG + Intronic
1187852338 X:23603427-23603449 TATTTGTTTACTCCAGCTTCAGG - Intergenic
1188190147 X:27162731-27162753 TACATCTCTGCTGCTGCTTAGGG - Intergenic
1188866536 X:35320003-35320025 TCCTTCTTCACTGCAACTGAGGG - Intergenic
1189140168 X:38596264-38596286 TACTTCCTTAATGCTGCTAATGG + Intronic
1192051195 X:67725404-67725426 TCCTTCTTTAGAGCAGCTAAAGG + Exonic
1194453399 X:94072993-94073015 TACATCTTTACAGCACCATAAGG - Intergenic
1195295818 X:103475587-103475609 TAATACTTTACTGAAGCTTGAGG - Intergenic
1201787208 Y:17797996-17798018 CACTTCTTTACTGATGTTTATGG - Intergenic
1201814345 Y:18107992-18108014 CACTTCTTTACTGATGTTTATGG + Intergenic