ID: 1146022496

View in Genome Browser
Species Human (GRCh38)
Location 17:29292531-29292553
Sequence CCGGGGAGCTGGGTTCCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146022489_1146022496 -1 Left 1146022489 17:29292509-29292531 CCTGTGGCAGAGAAACTCGTGAC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1146022496 17:29292531-29292553 CCGGGGAGCTGGGTTCCCGCTGG 0: 1
1: 0
2: 1
3: 16
4: 176
1146022487_1146022496 18 Left 1146022487 17:29292490-29292512 CCTGGCAGGAGACGAGGTTCCTG 0: 1
1: 0
2: 1
3: 13
4: 162
Right 1146022496 17:29292531-29292553 CCGGGGAGCTGGGTTCCCGCTGG 0: 1
1: 0
2: 1
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146022496 Original CRISPR CCGGGGAGCTGGGTTCCCGC TGG Intronic