ID: 1146022563

View in Genome Browser
Species Human (GRCh38)
Location 17:29292726-29292748
Sequence GGAGCGGGAAACGCGGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 145}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146022557_1146022563 -10 Left 1146022557 17:29292713-29292735 CCCGCCGCACCCGGGAGCGGGAA 0: 1
1: 0
2: 3
3: 8
4: 129
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1146022543_1146022563 19 Left 1146022543 17:29292684-29292706 CCGGCTCCCCGCCCCGACTGCCC 0: 1
1: 0
2: 5
3: 77
4: 710
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1146022545_1146022563 12 Left 1146022545 17:29292691-29292713 CCCGCCCCGACTGCCCGCGCCTC 0: 1
1: 0
2: 1
3: 30
4: 379
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1146022552_1146022563 -2 Left 1146022552 17:29292705-29292727 CCGCGCCTCCCGCCGCACCCGGG 0: 1
1: 0
2: 3
3: 57
4: 489
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1146022547_1146022563 8 Left 1146022547 17:29292695-29292717 CCCCGACTGCCCGCGCCTCCCGC 0: 1
1: 0
2: 1
3: 30
4: 294
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1146022554_1146022563 -7 Left 1146022554 17:29292710-29292732 CCTCCCGCCGCACCCGGGAGCGG 0: 1
1: 0
2: 1
3: 18
4: 222
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1146022544_1146022563 13 Left 1146022544 17:29292690-29292712 CCCCGCCCCGACTGCCCGCGCCT 0: 1
1: 0
2: 2
3: 26
4: 285
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1146022546_1146022563 11 Left 1146022546 17:29292692-29292714 CCGCCCCGACTGCCCGCGCCTCC 0: 1
1: 0
2: 4
3: 33
4: 498
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1146022550_1146022563 -1 Left 1146022550 17:29292704-29292726 CCCGCGCCTCCCGCCGCACCCGG 0: 1
1: 1
2: 4
3: 70
4: 598
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1146022549_1146022563 6 Left 1146022549 17:29292697-29292719 CCGACTGCCCGCGCCTCCCGCCG 0: 1
1: 0
2: 1
3: 32
4: 275
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1146022542_1146022563 30 Left 1146022542 17:29292673-29292695 CCGCTTCGAGGCCGGCTCCCCGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1146022548_1146022563 7 Left 1146022548 17:29292696-29292718 CCCGACTGCCCGCGCCTCCCGCC 0: 1
1: 1
2: 0
3: 29
4: 390
Right 1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146022563 Original CRISPR GGAGCGGGAAACGCGGCCGC TGG Intronic
900191851 1:1355421-1355443 GGACCGGGGACCGGGGCCGCGGG - Intronic
900413141 1:2522296-2522318 GGAGAGGCAAACGGTGCCGCTGG + Intronic
904039332 1:27575295-27575317 GGAGAGGGAAACCAGGCGGCTGG + Intronic
904165746 1:28553586-28553608 GGAGTGGGAAGCCCGGCCGCCGG + Intronic
906125173 1:43423125-43423147 GGTGGGGGAAACGCAGCCGCAGG - Exonic
909661755 1:78091404-78091426 GGAGCCGATAAGGCGGCCGCAGG + Intronic
913144591 1:115976730-115976752 GAAGAGGGAAATGCGGCTGCGGG - Intronic
913998063 1:143667758-143667780 GGATCGGGAGACGAGGGCGCCGG - Intergenic
920375285 1:205504842-205504864 GGAGCGGGCACCGCGGCGCCGGG + Intronic
922586382 1:226737478-226737500 GGAGCGGGAGCCGCGGCGGCGGG - Exonic
924527332 1:244863967-244863989 GGAGAGGAGAACGGGGCCGCGGG - Exonic
1064230809 10:13528534-13528556 GGTGCGGGGAAGGCGGCGGCGGG + Intronic
1065110702 10:22437221-22437243 CGAGCGGGAAGAGCGGCCTCTGG + Intronic
1066126489 10:32347290-32347312 GGCGCGGGAAGCGAGGCCGGCGG - Intronic
1070801525 10:79246988-79247010 GGAGCAGGAAACCAGGCAGCAGG - Intronic
1070974925 10:80599063-80599085 GGAGTGGGAAACGTGGGCTCAGG + Intronic
1072891498 10:99329298-99329320 GGAGCTGGGAACCCAGCCGCAGG - Exonic
1073251125 10:102120792-102120814 GGAGCGGGAGCCGCGGCTGGGGG + Intergenic
1075519617 10:123135996-123136018 GGAGCGGGACAGGCGGGCGGCGG - Exonic
1076395898 10:130136922-130136944 GGAGCGGGACCCACGGCTGCGGG + Intronic
1076649946 10:131981014-131981036 GCAGCGGGAAACGCAGGCCCGGG - Intronic
1077366784 11:2164462-2164484 GAAGGTGGAAACGCGGCCCCTGG - Intronic
1083595989 11:63918455-63918477 GTGGCGGGCAACGTGGCCGCTGG - Intergenic
1086041566 11:82485888-82485910 GGAGCAGGAAAGGCGGTGGCAGG - Intergenic
1087141294 11:94768329-94768351 GGAGCGGGGAGCGCGGACGGCGG + Intronic
1088578985 11:111298784-111298806 GGAGCGGCCAACTCGGCCTCTGG - Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090977086 11:131687735-131687757 GGAGAGGGACAGGCGGCCACAGG + Intronic
1094338969 12:29389540-29389562 GGGTCGGGAGACGCGGCGGCCGG - Intergenic
1094564979 12:31590999-31591021 GGCGCGGGGGAAGCGGCCGCGGG + Exonic
1096863819 12:54549547-54549569 GGAGGGGGGAACCCGGCCGGGGG + Exonic
1100166649 12:91924241-91924263 CGAGCGGGAACCGGGGCTGCGGG - Intergenic
1102470813 12:113158907-113158929 GGAGCGGGCACCCCGGCCGAAGG + Exonic
1103698613 12:122835861-122835883 GGAGCGGGGAGCGCGGCTTCCGG - Intronic
1109364602 13:61339176-61339198 GGGCCGGGAAACGGGGCTGCGGG + Intergenic
1112088185 13:96053454-96053476 GGAGCGGGACACGCATGCGCCGG - Intronic
1115851836 14:37595392-37595414 GGGGCGGGAGGCGCGGCGGCCGG - Intronic
1121357970 14:93231126-93231148 GGAGCGGGACACTGGGCCGTGGG + Intergenic
1122719632 14:103715160-103715182 GGAGCGGGGAAGGCGGTCTCCGG - Intronic
1123041109 14:105490580-105490602 GCAGAGGGAAGCGCTGCCGCGGG + Intronic
1125594254 15:40874127-40874149 GGAGCGGGCCATGCCGCCGCGGG - Exonic
1125722732 15:41852961-41852983 GGAGCTGGAAGGGCGGCTGCAGG - Exonic
1125882901 15:43209156-43209178 AGATGGGGAAATGCGGCCGCAGG + Intronic
1131257615 15:90872192-90872214 GGTGCGGGATCCGCGGGCGCCGG + Intronic
1132774902 16:1587995-1588017 TGAGCGGGAAAACCGGCCGCCGG - Exonic
1135582565 16:23641079-23641101 GGTGCGGGAAGGGCGGACGCAGG - Intronic
1136341743 16:29648505-29648527 GGATGGGGAAAGGCGGCCCCCGG + Intergenic
1136752393 16:32651043-32651065 GGAGCGGCACACTCGGCTGCCGG - Intergenic
1136822198 16:33329419-33329441 GGAGCGGCACACTCGGCTGCCGG + Intergenic
1136828761 16:33385958-33385980 GGAGCGGCACACTCGGCTGCCGG + Intergenic
1136833827 16:33484740-33484762 GGAGCGGCACACTCGGCTGCCGG + Intergenic
1138507711 16:57486430-57486452 GGCGAGGGAGGCGCGGCCGCAGG + Exonic
1141839778 16:86567204-86567226 GGAGCGGGAGGGGCGGCCCCGGG - Intergenic
1142336080 16:89490310-89490332 GGCCCGGGAAACGCGGCCGCGGG - Exonic
1203011089 16_KI270728v1_random:239780-239802 GGAGCGGCACACTCGGCTGCCGG - Intergenic
1142671948 17:1491565-1491587 GGCGCGGGGACGGCGGCCGCGGG - Intronic
1143057488 17:4173242-4173264 GGAGCTGCAAAACCGGCCGCTGG - Intronic
1143381290 17:6497955-6497977 GGAGCGGGTGAGGCAGCCGCAGG + Intronic
1145013287 17:19381890-19381912 GGAGCGGGAGAAACGGCGGCAGG + Exonic
1146022563 17:29292726-29292748 GGAGCGGGAAACGCGGCCGCTGG + Intronic
1146283320 17:31559112-31559134 GGAGCGGGCGTCGCGGCCGGGGG + Intergenic
1146383657 17:32350139-32350161 GGAGCGGGGAACGAGGCCGTCGG + Exonic
1147153497 17:38531913-38531935 GGAGCGGGGTCCCCGGCCGCAGG - Exonic
1148388529 17:47253790-47253812 GCTGCGGGAAAAGCGGCCGCGGG + Intergenic
1148824875 17:50385223-50385245 GGAGCGGGAACTGCGGAAGCGGG - Exonic
1150562011 17:66302641-66302663 GGAGCGGGAGCCGGAGCCGCTGG - Intronic
1151370613 17:73644472-73644494 GGGGCGGGCAACGTGGCCACGGG - Intergenic
1151490807 17:74431478-74431500 GGAGCAGGGAACGGGGACGCCGG + Exonic
1152223194 17:79080580-79080602 GGGGCGGGAAACGTGGGAGCCGG - Intronic
1152744016 17:82031047-82031069 CGAGGGGGAGACGCGCCCGCGGG - Exonic
1155392126 18:25349670-25349692 GGTGCGGGAACCGGGGCCACGGG + Intronic
1159798123 18:72867872-72867894 GGAGCGAGGAGCGCTGCCGCTGG - Exonic
1160818428 19:1046892-1046914 GGAGAAGGAGACGCGGCTGCGGG + Exonic
1162489658 19:10984595-10984617 GGAGCGGGAAACGGTGGGGCAGG - Intronic
1162564098 19:11435641-11435663 GCAGCAGGAACCGCGGCTGCTGG + Intronic
1163427095 19:17245743-17245765 GGAGCGGCAGCCGCGGGCGCCGG - Exonic
1164617519 19:29675816-29675838 GGAGAGGGAAACTGGGCCCCAGG + Intergenic
1165321944 19:35091002-35091024 GGAGCAGGCAGGGCGGCCGCGGG - Intergenic
1167075717 19:47247582-47247604 AGAGTGGGAAACGTGTCCGCCGG + Intergenic
1168462103 19:56567816-56567838 AGAGCAGGAAACCCGGCCGGAGG + Exonic
926090184 2:10044165-10044187 GGGGCGGGGCACGCGGCCGTCGG + Intronic
929313546 2:40452074-40452096 CGAGCGGGAGCCGCGGCAGCGGG + Intronic
929575069 2:43046360-43046382 GGAGGAGGAAACGGGGCAGCTGG + Intergenic
931708656 2:64969013-64969035 CGAGCGGGAACCGCGGCTGCGGG + Intergenic
938289950 2:130143799-130143821 GGGGCGGGAGAGGAGGCCGCGGG + Intronic
938466573 2:131529138-131529160 GGGGCGGGAGAGGAGGCCGCGGG - Intronic
942044685 2:172093265-172093287 GGAGCGGGAGCCACGGCGGCGGG + Intergenic
942463768 2:176188243-176188265 GGAGCGTGACGCGCGGCCGGTGG - Intergenic
944451776 2:199851027-199851049 AGAGCGGCAGGCGCGGCCGCTGG - Exonic
946044552 2:216810450-216810472 GGAGCGGGAGACATGGCCGGAGG + Intergenic
946247473 2:218396025-218396047 GGCGTGGGAGTCGCGGCCGCCGG - Exonic
1172984046 20:38968230-38968252 GGAGCTGGAAAGACGGCTGCCGG - Intronic
1173991902 20:47310040-47310062 GGAGCAGGTAAAGCAGCCGCTGG - Exonic
1175366836 20:58461510-58461532 GGAGCGGGCAATGAGGCCACAGG + Exonic
1176179444 20:63742525-63742547 GGGGCGGGGCAGGCGGCCGCAGG - Exonic
1176547672 21:8208632-8208654 GGCGCGAGAAAGGCGGCCGGCGG - Intergenic
1176555569 21:8252838-8252860 GGCGCGAGAAAGGCGGCCGGCGG - Intergenic
1176566620 21:8391677-8391699 GGCGCGAGAAAGGCGGCCGGCGG - Intergenic
1176574499 21:8435866-8435888 GGCGCGAGAAAGGCGGCCGGCGG - Intergenic
1176611111 21:8987158-8987180 GGCGCGAGAAAGGCGGCCGGCGG - Intergenic
1182550183 22:31096746-31096768 GGAGCGGGAACGGCGGCTGCAGG + Exonic
1182664147 22:31944955-31944977 GGAGCGGGAAGCGCGGGCTAAGG - Intronic
1203252546 22_KI270733v1_random:124917-124939 GGCGCGAGAAAGGCGGCCGGCGG - Intergenic
1203260602 22_KI270733v1_random:170003-170025 GGCGCGAGAAAGGCGGCCGGCGG - Intergenic
950929361 3:16773726-16773748 GGAGCAGGAACCGGGGCTGCGGG + Intergenic
954843828 3:53536564-53536586 GGAGTGGCAAACACGGCCCCCGG + Intronic
960902226 3:122564438-122564460 GGAGCGGGGACGGCGGGCGCAGG - Exonic
963126163 3:141818924-141818946 GGAGCGGGAAAGTGAGCCGCAGG - Intergenic
966863575 3:184243940-184243962 GGAGCGGGACAGGTAGCCGCTGG + Exonic
968553055 4:1233911-1233933 GGAGAGGGCAGCGGGGCCGCAGG - Intronic
968729110 4:2261502-2261524 GGCCCGGGAGGCGCGGCCGCGGG + Intronic
969324378 4:6432441-6432463 AGAGGGGGAAACGAGGCAGCAGG - Intronic
969714409 4:8861346-8861368 GCCGCGGGAAGCGCGGCCTCCGG - Intronic
970649363 4:18159620-18159642 CGAGCGGGAACCGGGGCTGCGGG - Intergenic
972290359 4:37685844-37685866 GCGGCGGGAAACGGGTCCGCGGG + Intronic
976897370 4:90128111-90128133 GGAGCGGCCGCCGCGGCCGCAGG - Intronic
977257581 4:94758047-94758069 GGAGCCGGGAGCGCAGCCGCGGG + Intronic
977607335 4:98995978-98996000 GGAGGAGGAAACGCGGCCGGGGG - Intronic
985129731 4:186727020-186727042 GGCGTGGGAAACGCCGCCGGAGG - Intergenic
990148370 5:52788242-52788264 GGACTGGGAACCGCGGCAGCGGG + Exonic
992385503 5:76280643-76280665 GGAGCCGGCCACGAGGCCGCCGG - Intronic
997243193 5:132323575-132323597 GGACCGGGAAACCCGGCCTGAGG + Intronic
999281573 5:150369723-150369745 GGAGCTGGAAAGGCTGCAGCCGG + Intronic
1002368058 5:178728989-178729011 GCAGCGGGAAGCGAGGCCCCAGG - Exonic
1002385268 5:178861059-178861081 GCAGCGGGAAGCGAGGCCCCAGG + Exonic
1004196792 6:13512552-13512574 CCAGCGGGAACCGCGGCTGCGGG + Intergenic
1004308608 6:14523637-14523659 GGAGAGGGAGAAGGGGCCGCTGG - Intergenic
1005522589 6:26613729-26613751 GGAGCGGGAGATGAGGCAGCCGG - Intergenic
1006313396 6:33277096-33277118 GGAGCGCGCAACGCGGAAGCGGG + Intergenic
1009431815 6:63573193-63573215 GGAGCGGGAGACGTGGCCCGGGG + Intronic
1013174890 6:107668748-107668770 GGAGAGGGAAACGAGGACTCGGG - Intergenic
1014045213 6:116877152-116877174 GGGGCGGGGAAGGAGGCCGCAGG - Intergenic
1015497469 6:133896036-133896058 GCAGCGGGACACGCACCCGCTGG - Intergenic
1016936265 6:149451174-149451196 GGACCGGGAGAGGCGGCCCCAGG + Exonic
1018774001 6:166998149-166998171 GCAGCGGGAGCCGCGGCCGTAGG - Intergenic
1022207730 7:28180159-28180181 GGAGCGGGGAGCGCCGCGGCGGG - Intronic
1025078668 7:55964469-55964491 GGAGCAGGGCGCGCGGCCGCGGG - Intronic
1035277732 7:157758101-157758123 GGAGCGGGAGATGCGGTCGCGGG + Intronic
1035331287 7:158098835-158098857 GGGACGGGGAACGGGGCCGCGGG + Intronic
1037825217 8:22156567-22156589 GGGGCGGGGGCCGCGGCCGCCGG - Exonic
1045112521 8:98948312-98948334 AGCGCGGGAAAGGCGGCCACAGG + Exonic
1045277447 8:100721222-100721244 GGCTCGGGAAACGCGGCTCCAGG + Intronic
1045738024 8:105318882-105318904 GGAGCGGCAGCCGCGACCGCGGG + Exonic
1049483640 8:142840001-142840023 GGAGCGGGAAGCGCGTCAGTGGG + Intronic
1049483647 8:142840029-142840051 GGAGCGGGAAGCGCGTCAGTGGG + Intronic
1049854586 8:144853283-144853305 GGGGAGGGAGACGCGGGCGCAGG - Intronic
1051383265 9:16480518-16480540 GGAGCAGGAACCGGGGCTGCAGG + Intronic
1053001135 9:34577905-34577927 GGAGCGGGAAGCGCCGAGGCGGG + Intronic
1056985604 9:91361702-91361724 GGGGCGGGACCCCCGGCCGCAGG + Exonic
1058618780 9:106862459-106862481 GGTGCGAGGAGCGCGGCCGCCGG - Intergenic
1059208319 9:112486950-112486972 GGAGCGGGGAAGGCGCCCGGCGG - Exonic
1060096267 9:120793359-120793381 GGACCGGGAGCAGCGGCCGCAGG - Exonic
1061969191 9:134034746-134034768 GGAGCTGGAAAAGCGTCTGCAGG - Exonic
1062263403 9:135675069-135675091 GGAGGGGGAATCGGGGCCCCGGG - Intergenic
1203770739 EBV:48814-48836 GGAGCAGTACACACGGCCGCTGG - Intergenic
1203468950 Un_GL000220v1:108068-108090 GGCGCGAGAAAGGCGGCCGGCGG - Intergenic
1203476771 Un_GL000220v1:152040-152062 GGCGCGAGAAAGGCGGCCGGCGG - Intergenic
1200093813 X:153648004-153648026 GGAGCAGGAGCCGCGGCCGCGGG - Exonic