ID: 1146022807

View in Genome Browser
Species Human (GRCh38)
Location 17:29293480-29293502
Sequence TGGGAAAAGAATAATGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 502}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146022791_1146022807 29 Left 1146022791 17:29293428-29293450 CCCATCTCAGGGCCCCCAAATTG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG 0: 1
1: 0
2: 4
3: 39
4: 502
1146022792_1146022807 28 Left 1146022792 17:29293429-29293451 CCATCTCAGGGCCCCCAAATTGA 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG 0: 1
1: 0
2: 4
3: 39
4: 502
1146022795_1146022807 16 Left 1146022795 17:29293441-29293463 CCCCAAATTGAGGTAACTCCAGG 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG 0: 1
1: 0
2: 4
3: 39
4: 502
1146022797_1146022807 15 Left 1146022797 17:29293442-29293464 CCCAAATTGAGGTAACTCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG 0: 1
1: 0
2: 4
3: 39
4: 502
1146022799_1146022807 14 Left 1146022799 17:29293443-29293465 CCAAATTGAGGTAACTCCAGGGA 0: 1
1: 0
2: 1
3: 5
4: 111
Right 1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG 0: 1
1: 0
2: 4
3: 39
4: 502
1146022803_1146022807 -2 Left 1146022803 17:29293459-29293481 CCAGGGACGCAGGGAGGTGAATG 0: 1
1: 0
2: 0
3: 23
4: 251
Right 1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG 0: 1
1: 0
2: 4
3: 39
4: 502
1146022794_1146022807 17 Left 1146022794 17:29293440-29293462 CCCCCAAATTGAGGTAACTCCAG 0: 1
1: 0
2: 1
3: 4
4: 108
Right 1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG 0: 1
1: 0
2: 4
3: 39
4: 502
1146022790_1146022807 30 Left 1146022790 17:29293427-29293449 CCCCATCTCAGGGCCCCCAAATT 0: 1
1: 0
2: 1
3: 25
4: 224
Right 1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG 0: 1
1: 0
2: 4
3: 39
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146022807 Original CRISPR TGGGAAAAGAATAATGAGGT TGG Intronic
902753499 1:18533928-18533950 TGGGAAAGGAACAATGTGGGAGG - Intergenic
903090965 1:20916659-20916681 TTGAAAAAGAAGAATGAAGTTGG + Intronic
903356012 1:22747814-22747836 GGGGAAAAGGACAATGAAGTTGG + Intronic
904101052 1:28027795-28027817 TGGGATAAGAATAATGTGCTGGG + Exonic
904756071 1:32769683-32769705 TGGGAAATGAGTCATGGGGTCGG - Exonic
905246043 1:36614607-36614629 TGGGGAAAGAATTATGGGGGAGG + Intergenic
905635532 1:39548895-39548917 TGGGAAGAGGATAAAGAGGAAGG - Intergenic
906303655 1:44702374-44702396 TGTGGAAAGAATAAGGACGTAGG - Intronic
906321396 1:44819317-44819339 TGGGAATAGAACAAGGAGTTTGG + Intergenic
906647384 1:47485230-47485252 GGGGAAGAGAACAATGAGGGGGG + Intergenic
907191676 1:52654342-52654364 CTGAAAAAGAATAATGAAGTTGG + Intronic
909085793 1:71168959-71168981 TGAGAAAACAATAATGAGCAAGG + Intergenic
909148979 1:71976346-71976368 AGATAAAAGAGTAATGAGGTGGG + Intronic
909969619 1:81966028-81966050 AGGGAAAAGATAAAGGAGGTGGG - Intronic
910300223 1:85697631-85697653 TGAAAAAAGAATGATGAGGCTGG - Intronic
910752556 1:90649638-90649660 TAGGAAAAGAATCCTGAGATGGG - Intergenic
910990265 1:93048809-93048831 TGTGAAAATAATAATGAGGCTGG + Intergenic
911102389 1:94104870-94104892 TGGGAAAAGAACAATGGAGCTGG - Intronic
911401471 1:97379990-97380012 GGAGAAAAGAAAAATGAGATGGG - Intronic
911941208 1:104049905-104049927 TTGGAAAAGAAGAATAAAGTGGG + Intergenic
912000366 1:104825704-104825726 AGGGCAAAGAATAATTAGGTTGG - Intergenic
912060420 1:105661387-105661409 TGAGAAAAGAATTTTGATGTGGG + Intergenic
913057518 1:115176010-115176032 TGGGAATAGGAGAATGGGGTGGG + Intergenic
914254719 1:145952375-145952397 TGGCTAAAGAACAGTGAGGTGGG + Intronic
915233914 1:154466373-154466395 TGTGAAAAGAAAAATGAGCCTGG + Exonic
915666220 1:157447445-157447467 TGGGAAAATTATTATGAGGCTGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915867703 1:159522041-159522063 TGTGAAAAAAAAAATGATGTTGG + Intergenic
916189058 1:162161139-162161161 TGGGGAAGGAAGAATGAGGAGGG - Intronic
916367315 1:164046021-164046043 TGGGAAAGATATAAGGAGGTGGG - Intergenic
916962083 1:169898756-169898778 TTGGAAAAAAATAATTAAGTTGG - Intergenic
917043995 1:170836285-170836307 TGGCAAAAGAAAAATGGGTTGGG - Intergenic
917345326 1:174022750-174022772 TGGAAGAAGAAAAATGGGGTGGG - Intergenic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918196532 1:182227790-182227812 TGGGAAAAAAAAACTGAGCTGGG + Intergenic
919028415 1:192206896-192206918 TGGGATAAGTATTAGGAGGTGGG - Intergenic
919533077 1:198749632-198749654 TTATAAAAGAATAATGAGCTTGG + Intronic
919777630 1:201204606-201204628 TGGGAAAAGAAGTATGGGTTTGG + Intronic
919983420 1:202656806-202656828 TGGGAAGAGCATAATGTGGTGGG - Intronic
920023456 1:202973853-202973875 TTGGAAAAGAAGAATAAAGTTGG - Intergenic
920573650 1:207038651-207038673 TATGAAAAGAATAATTGGGTGGG - Intronic
920867310 1:209763636-209763658 TGTGGAAAGAAAAATGAGATGGG - Intronic
921062961 1:211601397-211601419 TGGGAAACGAATAAACTGGTAGG - Intergenic
921366061 1:214375179-214375201 TGGGAAAAGTATAGTATGGTTGG - Intronic
921442086 1:215199515-215199537 AAGGAAAACAATAATGAGCTTGG + Intronic
921705080 1:218313319-218313341 AGGGAAAAGAAGAATCAGATTGG + Intronic
921975312 1:221196447-221196469 CTGGAAAAGAATAATAAAGTAGG - Intergenic
922522565 1:226268866-226268888 TGGCAAAAGAATAAGGTGCTTGG - Intronic
923447264 1:234083770-234083792 TGGGAAAAGCATTGTGAGGCAGG + Intronic
923649779 1:235863656-235863678 TGGGAAAAGAATGACTAGGTTGG + Intronic
923827605 1:237517169-237517191 AGGGAACAGAATAGTGAGGCAGG - Intronic
923830281 1:237548333-237548355 TGGAAGAACAGTAATGAGGTAGG + Intronic
924866518 1:247987790-247987812 TGGGAGAAGGGTAATGAGTTTGG - Intronic
1063754685 10:8994438-8994460 AGGGAAAAGAAAAGTGAGTTGGG - Intergenic
1063849564 10:10170398-10170420 TCGAAAAAGAAGAATGAAGTAGG - Intergenic
1063936419 10:11083201-11083223 TGGGAAAATAAAAATGAACTGGG + Intronic
1064662910 10:17624151-17624173 AGGGAAAAGAAAGTTGAGGTAGG + Intergenic
1064845719 10:19650592-19650614 TAGCAAAATAATGATGAGGTGGG + Intronic
1065344647 10:24737324-24737346 TGGGAAAACAAGAATTAGGGAGG - Intergenic
1065451532 10:25863628-25863650 GGGGAGTATAATAATGAGGTTGG + Intergenic
1065703829 10:28451560-28451582 TTGGAAAAGAAGAATAAAGTAGG - Intergenic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1066564243 10:36703487-36703509 TTGGCAAAAAATCATGAGGTTGG + Intergenic
1068802691 10:61160236-61160258 TGGGAAAAGCTGCATGAGGTGGG + Intergenic
1069138820 10:64798951-64798973 TAGAAAGAGAATAATGAGGGTGG - Intergenic
1069185645 10:65419043-65419065 TGGGAAAATAATGATGAGCAAGG - Intergenic
1069311046 10:67036823-67036845 TGGGAAATGAATATTAAAGTAGG + Intronic
1070587383 10:77776759-77776781 TGGGAAAACAGGAATGAGGCAGG + Intergenic
1071206637 10:83287645-83287667 TGGAAAAAGAACATTGAGGCTGG - Intergenic
1071206963 10:83291223-83291245 TAGTCATAGAATAATGAGGTCGG - Intergenic
1073624571 10:105083689-105083711 TGAGAATAGAAAAAGGAGGTTGG - Intronic
1073734991 10:106335776-106335798 TGGTAACAGAATAATGAAGTAGG + Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1075257327 10:120935538-120935560 TGGGAAAAGAAAAATAAGTGTGG - Intergenic
1075350207 10:121717627-121717649 AAGGAAAAGAATAATTATGTTGG + Intergenic
1077920531 11:6638849-6638871 TGGGAAGTGAATGATCAGGTTGG - Intronic
1078077538 11:8175392-8175414 TTGGAAAATAAAAATAAGGTGGG + Intergenic
1078868582 11:15322823-15322845 TTGGAAAAGAATGCTGATGTTGG + Intergenic
1080653769 11:34242670-34242692 GGGGAAAAGAATGACCAGGTGGG + Intronic
1081565851 11:44260708-44260730 TGTAAAAAAAAAAATGAGGTCGG - Exonic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1082282428 11:50284204-50284226 TGGGAAATGAGGAGTGAGGTAGG + Intergenic
1082822551 11:57553989-57554011 TGGGGAAATAAAAATGAAGTCGG + Intronic
1084311806 11:68321325-68321347 TTTGAAAAGGACAATGAGGTGGG - Intronic
1084511682 11:69609440-69609462 TGGGAAAAGAGCCATGAAGTGGG - Intergenic
1085073209 11:73567331-73567353 AGGGAAAAGGATAACGAGTTCGG + Intronic
1085527004 11:77170145-77170167 TGGGGAAAGATTAAGGAGGGAGG + Intronic
1085666950 11:78422293-78422315 TGGGAATACAAAAATGAGGAAGG - Intergenic
1085685535 11:78618953-78618975 TGGGAACAGAATATTAAGGATGG + Intergenic
1086905565 11:92414428-92414450 TGGCAAAAGAAGAATGACCTAGG - Intronic
1087268599 11:96087850-96087872 TGGGAAAATAATCATGAATTTGG - Intronic
1088190823 11:107226400-107226422 GGGGAGAAGAATACTGAGGGGGG - Intergenic
1088763479 11:112954074-112954096 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1088989680 11:114941568-114941590 TGGTGAAAGAATCATGATGTTGG - Intergenic
1089182976 11:116595637-116595659 TGGGAAATCAATAAGGAGGCGGG + Intergenic
1089372355 11:117970418-117970440 TGGGAATAGAACTCTGAGGTTGG - Intergenic
1089658158 11:119967120-119967142 TGGAACAAGAATTATTAGGTTGG + Intergenic
1089872833 11:121692131-121692153 TGGCAAAAGAATACTAGGGTAGG - Intergenic
1090663388 11:128898094-128898116 TTGGAAAAGAATAAAGTGGAAGG - Intronic
1092255873 12:6926768-6926790 TGGGAAAAGAAAATGGAGATGGG - Intronic
1092626208 12:10332080-10332102 TGCCAAAAAAATAATAAGGTTGG + Intergenic
1092668831 12:10839246-10839268 TGCCTAGAGAATAATGAGGTGGG + Intronic
1092699306 12:11209422-11209444 TGGGAAAAGAATAAAAGGGTAGG + Intergenic
1093002962 12:14019286-14019308 TTGAAAAAGAAAAATGAAGTTGG - Intergenic
1093109563 12:15133004-15133026 TGGGATATGAATAATGGGGGAGG - Intronic
1093120493 12:15265823-15265845 GGGGAAGAGAATTATGAGGAAGG - Intronic
1093512588 12:19946739-19946761 TGGGGAAAGAATGATGAGGAAGG + Intergenic
1093798138 12:23338043-23338065 TGAGAAAAGAAAAATAAGGATGG + Intergenic
1094010288 12:25801230-25801252 TGAGAAAAGCATATTGAGTTTGG + Intergenic
1094308673 12:29052288-29052310 GGGGAAAAGAATTATTATGTTGG - Intergenic
1094448493 12:30559262-30559284 GGGAAAAAGAAAAATGAAGTGGG - Intergenic
1094598503 12:31887485-31887507 TGGGAAAACAAGAATTAGGGAGG - Intergenic
1095298840 12:40558766-40558788 AAGGCAAAGAAGAATGAGGTAGG - Intronic
1095404187 12:41849511-41849533 TAGGCAAAGAAGAAGGAGGTGGG - Intergenic
1095613274 12:44157574-44157596 TTTTAAAAAAATAATGAGGTCGG + Intronic
1095748900 12:45689506-45689528 TTGGAAAAAAGTAAAGAGGTCGG - Intergenic
1097037350 12:56132580-56132602 TGGGGAGAGACTTATGAGGTGGG + Exonic
1097241274 12:57576973-57576995 TGGGAAAAATATGATGGGGTAGG + Intronic
1097560164 12:61194198-61194220 TGGGATAAAAATAATGAAATTGG - Intergenic
1098332378 12:69367223-69367245 TGAGAAAAGAAAACTAAGGTAGG - Intronic
1099065992 12:77980003-77980025 TGGGAAAACAGGAATGAGGGAGG + Intronic
1099675259 12:85752914-85752936 TGGGAAAGGAAAAAAGATGTTGG - Intergenic
1100501863 12:95182134-95182156 TTAGAAATAAATAATGAGGTTGG + Intronic
1101813330 12:108126703-108126725 TGTGAAAGGGAGAATGAGGTTGG - Intergenic
1102272078 12:111545664-111545686 AGGAAAAATAATAATGAGGCCGG + Intronic
1104033035 12:125078967-125078989 TGGGAAAGGGATGATGGGGTGGG + Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105620352 13:22060609-22060631 AAGGAAAAGAATAATGACCTAGG + Intergenic
1106143561 13:27032336-27032358 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1106311312 13:28556890-28556912 GGGGAAGGGAAGAATGAGGTGGG + Intergenic
1106621377 13:31374196-31374218 TGGGAAAAGAAGCAGGAGGAGGG - Intergenic
1107078511 13:36348915-36348937 TTGAAAAAGAAGAATGAAGTTGG + Intronic
1107578135 13:41749791-41749813 TGGGAAATGAACAATGTGGTGGG + Intronic
1108038307 13:46315456-46315478 AGGGTAGAGAAAAATGAGGTTGG + Intergenic
1110481475 13:75982548-75982570 TGAGCAAAGAATAATGAGAAGGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111212171 13:85093879-85093901 TGGGAAAAGAAAGATAATGTTGG - Intergenic
1111542360 13:89685761-89685783 TGGGAAAAGAAAAACGTGGAGGG - Intergenic
1112197080 13:97236605-97236627 TGGGAAAAGAATAAAAATATAGG - Intronic
1112442938 13:99437860-99437882 TGGGAAAAGAATAAAGTCATAGG + Intergenic
1112600085 13:100846747-100846769 TGTGCAAAGAATAATGGGGGGGG - Intergenic
1113215902 13:108040296-108040318 TGGGAAAAGAGGGGTGAGGTTGG - Intergenic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113967734 13:114163941-114163963 TGGGAAAAGCATAAGGAGTGAGG + Intergenic
1114141859 14:19921256-19921278 TGTAACAAGAATAATGATGTAGG - Exonic
1114336451 14:21696120-21696142 TTGAAAAAGAAAAATAAGGTGGG + Intergenic
1114527924 14:23377969-23377991 TGGGGAAAGCATTATGAGGCAGG + Intronic
1114890538 14:26916679-26916701 TTGGAAAGGAAAAATGAAGTGGG - Intergenic
1117222656 14:53621183-53621205 TGGGAAAAGAAGAGTGGTGTGGG - Intergenic
1117851169 14:59971368-59971390 TGCGAAAAGAATAATGCTGGAGG - Intronic
1118401083 14:65380208-65380230 TGGCAAGAGAAAAATGAGGAAGG + Intergenic
1118920903 14:70149268-70149290 TGGGAAAAGCAGAATCAGGCTGG + Intronic
1119089620 14:71769426-71769448 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1119915243 14:78393553-78393575 TTGAAAAAGAAAAATGAAGTAGG - Intronic
1120510024 14:85401964-85401986 AGGAAAAAGAATAAAGAGGGAGG + Intergenic
1121071500 14:91026389-91026411 TGGGAAAAAAAAAATTAGCTAGG - Intronic
1121520491 14:94583037-94583059 TGGGAAAAGAAGAGTGAGCCTGG + Intronic
1121743510 14:96269981-96270003 TGAGTAAAGAATAATGGGGCCGG + Intergenic
1122463872 14:101917408-101917430 AGGGAAAAGAATCATGAGGTTGG + Intronic
1122658134 14:103275743-103275765 TTTAAAAAGAATAATAAGGTGGG - Intergenic
1124091683 15:26610127-26610149 TGGGAAAACAGTAATTAGGGAGG - Intronic
1124709465 15:31994022-31994044 TTGAAAAAGAATAATAAAGTGGG - Intergenic
1127180172 15:56407752-56407774 TGAGCCAAGAATAAGGAGGTTGG - Intronic
1127694048 15:61426696-61426718 TGGGAAAAGAAGCAGGAAGTTGG + Intergenic
1128288187 15:66456070-66456092 GGGGAAAAGACTGAGGAGGTAGG - Intronic
1129068647 15:72932691-72932713 TGGGAAAAGAATAGCCAGGGAGG - Intergenic
1130266142 15:82405488-82405510 TGGGAAAGGAACACTGAGTTTGG + Intergenic
1130745400 15:86648231-86648253 TGGAAAGAGAAAGATGAGGTAGG + Intronic
1131644087 15:94323345-94323367 TGGGTAATGAAAAATGAAGTTGG + Intronic
1132138831 15:99371866-99371888 TGAGAAAAGAATTAGGTGGTGGG - Intronic
1132514460 16:359763-359785 TGGGAAAACAGCACTGAGGTTGG - Intergenic
1133863772 16:9621946-9621968 TGGGGAAAGAAAAATGAACTCGG + Intergenic
1135582157 16:23637803-23637825 TGGGAAATGAATAATAAAGCAGG + Intronic
1135945397 16:26860549-26860571 TGGGAAAACAGGAATGAGGGAGG + Intergenic
1136466712 16:30449275-30449297 TGGGAAAAGAATAACAGGATTGG + Intergenic
1137415440 16:48273349-48273371 TGGTTAAATGATAATGAGGTGGG + Intronic
1137998103 16:53242201-53242223 TGGGATAAGAAGTATAAGGTTGG - Intronic
1138891494 16:61149531-61149553 TGGGGAAAGAAAAAAGAGCTTGG - Intergenic
1139141628 16:64270240-64270262 GGGAAAAAGAAAAATGAAGTGGG - Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1140196447 16:72859434-72859456 TGGGAGAAGAAGGCTGAGGTGGG - Intronic
1141409779 16:83825203-83825225 TGGCAAAATACTAATGATGTGGG - Intergenic
1142287788 16:89178469-89178491 TGGGAGAAGAAGAGTGAGGCTGG + Intronic
1142865919 17:2791424-2791446 TGGGGAGAGAATAATGAAGATGG - Intronic
1143864892 17:9916715-9916737 TGGGAAAAAAATAAAGAAGGAGG + Exonic
1143979421 17:10855258-10855280 TGCCAAAAGACCAATGAGGTAGG - Intergenic
1144028150 17:11296693-11296715 TAGGAACAGAATATTGAGCTAGG + Intronic
1144914884 17:18716357-18716379 TGAGAAAAGAACCATGAGGAGGG + Intronic
1145982714 17:29023330-29023352 TTGGGGAAGAATAATGAGATTGG + Intronic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1146466188 17:33088649-33088671 GGTGAAAAGAAAAATGAGCTGGG + Intronic
1147043539 17:37736062-37736084 TTTGAAAAGTATAATCAGGTGGG - Intronic
1147699185 17:42381399-42381421 TAGCAAAAGAATAATAAGGAAGG - Intronic
1148636697 17:49154311-49154333 TGTGAAAAGAATATTTATGTTGG + Intronic
1149819541 17:59761693-59761715 TGGGAAAAGAATAATTACTGGGG - Intronic
1150360444 17:64528608-64528630 TGTGAAAAAAATAATAAGCTCGG + Intronic
1150538484 17:66071590-66071612 TGGTCAATAAATAATGAGGTAGG - Intronic
1151055154 17:71022318-71022340 TGTGAAGAGAATATTGAGATGGG - Intergenic
1151900845 17:77013152-77013174 GGCGATAAGAATAATGAGGCTGG + Intergenic
1153384972 18:4482608-4482630 TGGGAAAAGCAGAATGATGCAGG + Intergenic
1153853731 18:9123789-9123811 TTGTAAAAGAAAAATGAGGCAGG - Intronic
1154079406 18:11241056-11241078 TTGGAAAAGAACAATAAGGTTGG + Intergenic
1154099786 18:11461461-11461483 TTGAAAAAGAATAATAAAGTGGG - Intergenic
1154233099 18:12576259-12576281 TTGGAAAGGAATAATAAAGTTGG + Intronic
1154484812 18:14865219-14865241 TGGGAGAAGGATAAAGAGGGTGG - Intergenic
1155787021 18:29914233-29914255 TGGGATCACAATGATGAGGTGGG + Intergenic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1157137973 18:45076125-45076147 AAGGAAAACAATAATGAGTTAGG + Intergenic
1158748882 18:60235514-60235536 TGGGAAAAGAATGAATAGGATGG - Intergenic
1159437667 18:68439642-68439664 TGAGAAAGGAATAATAAGGGAGG - Intergenic
1160108054 18:75996972-75996994 TTGAAAGAGAATAATGAAGTGGG - Intergenic
1160234121 18:77072169-77072191 TGAGATAAGAATTATGAGGCAGG - Intronic
1160343855 18:78113194-78113216 TGGGAGAAAAAGAATGATGTAGG - Intergenic
1160384544 18:78487025-78487047 TGGGAGAACATTAATGAGGGAGG + Intergenic
1160574176 18:79840640-79840662 TTGGAAAAGAAGAATAAAGTGGG + Intergenic
1161532273 19:4797106-4797128 TGGAAGAAAAATAATGAAGTAGG + Exonic
1163480681 19:17554486-17554508 TGTGAAAATAATAATAAGCTGGG + Intergenic
1164518404 19:28956625-28956647 TGGTTAAAGGATAATGAGGAAGG + Intergenic
1165674418 19:37708957-37708979 TGGGAAAACAATAAAGCTGTTGG + Intronic
1165940058 19:39410419-39410441 TGGGAGAGGAGTAATGAGGGAGG - Intergenic
1166284836 19:41818681-41818703 TGGAAAAGGAATAATAAGATGGG - Intergenic
1166573866 19:43818332-43818354 AGGGAAAAGTATAGTGTGGTAGG + Intronic
1167397600 19:49241469-49241491 TGGAAGAATAATAATGAGGCCGG + Intergenic
1167761135 19:51450082-51450104 TGAGATAGGAACAATGAGGTTGG - Intergenic
1167789365 19:51663512-51663534 GGAGAAAAGAAGAATGAGGCCGG - Intergenic
1167969341 19:53177219-53177241 AGGGAAAAGAATAATGAAACAGG - Intronic
1168303518 19:55420525-55420547 TGTGAGAAGAATAATGAGTTTGG + Intergenic
926275794 2:11402350-11402372 TGGGAAAAGAGTCAAGAGGGAGG + Intergenic
926477542 2:13344664-13344686 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
927048009 2:19299374-19299396 TGGGAAGAGAAAGAGGAGGTTGG + Intergenic
928098050 2:28417536-28417558 AGGGAAAAGAAGAATGAGACGGG - Intergenic
928336156 2:30400228-30400250 TTGAAAAGGAGTAATGAGGTTGG - Intergenic
928414208 2:31078313-31078335 TGTGAAAATGTTAATGAGGTTGG + Intronic
929270283 2:39964307-39964329 TAGGAACAGAATATTAAGGTTGG - Intergenic
929554590 2:42917762-42917784 TCGAAGATGAATAATGAGGTAGG + Intergenic
930388384 2:50727841-50727863 AGGGGAAAGAATATTGAGTTGGG + Intronic
931083598 2:58803996-58804018 TGGGTCAAGCATAATGAAGTGGG + Intergenic
931139057 2:59436893-59436915 TGGGAAAGGGATACTGAGGGAGG + Intergenic
931489400 2:62727192-62727214 TGGGAATAGGATAATCAGGATGG - Intronic
933762921 2:85685837-85685859 TTGGAAAAGAATGATGAGTCGGG - Intronic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
935281053 2:101518251-101518273 TGGGATAAGAATGATGTGCTGGG - Intergenic
935429890 2:102964512-102964534 TGGAAAAATAATGAAGAGGTTGG - Intergenic
935761307 2:106323119-106323141 TAGTAAAAAAACAATGAGGTAGG - Intergenic
936239481 2:110774869-110774891 TTGGAAAAGAAGAATAAAGTTGG + Intronic
936474166 2:112825002-112825024 TGGGAAATGAAGAATGAGGTGGG + Intergenic
937783260 2:125864723-125864745 TGGGAAAACAGGAATGAGGGAGG + Intergenic
937965192 2:127501719-127501741 TTTGAAAAGAAAAATGGGGTGGG - Intronic
938222156 2:129579217-129579239 TGGGAAAAAAAAAAAGAAGTTGG - Intergenic
938451240 2:131423384-131423406 TGGGAAAAAAATCAGGAGGGAGG + Intergenic
938674115 2:133613721-133613743 AGGGAAGAGAATAAAGAGGGTGG - Intergenic
939481254 2:142749805-142749827 TTTGAAAAGACTAATGAGATAGG - Intergenic
939990387 2:148872965-148872987 TGGGCAAAGGATGATGAGCTGGG - Intergenic
940102703 2:150060122-150060144 AGGGAAAAGAATAAGGAACTAGG + Intergenic
940647916 2:156411013-156411035 TGGGAGAAAAATAATAGGGTTGG + Intergenic
941482104 2:166028954-166028976 TGGGACAAGAAGGATGTGGTGGG + Intronic
942162824 2:173210053-173210075 TTTGAAAAGAATATTGAGGCCGG + Intronic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
943249371 2:185497144-185497166 TGGGGAAAGAATAATTATCTTGG + Intergenic
943627333 2:190215327-190215349 TGGGATAACAATAAAGAGATCGG + Intronic
944309850 2:198221691-198221713 TGGGAAAGGAATTGTGAGGGGGG - Intronic
944868795 2:203889001-203889023 TGGGAAAAAAAAAATTAGCTGGG + Intergenic
945283192 2:208057005-208057027 TGGGAAAAGAACAGTGGGATTGG - Intergenic
945322956 2:208447812-208447834 GGGGAAAATAATAATGTGCTTGG - Intronic
945766568 2:213987286-213987308 TGAGAAAGGCAGAATGAGGTAGG - Intronic
946673397 2:222130647-222130669 TTCGAATAGAATAATAAGGTGGG + Intergenic
946760882 2:222992147-222992169 TGGGAAAAGAATTCTCAGGAGGG - Intergenic
947366338 2:229399586-229399608 TGGAAAAAAAATAAGGTGGTAGG + Intronic
947799000 2:232915580-232915602 TCAGAAAAAAATAATTAGGTTGG - Intronic
948036977 2:234865656-234865678 TAGGAGAAGAGTAATGTGGTTGG - Intergenic
948744274 2:240074920-240074942 TTGAAAAAGAACAATGAGGTGGG - Intergenic
1168928882 20:1605172-1605194 TGTGGAAAGATTAATGAGGGTGG + Intronic
1169160348 20:3372297-3372319 AGGGGAAAGAAGACTGAGGTGGG + Intronic
1169645587 20:7806174-7806196 TGGGAAAAGCAGAGAGAGGTTGG - Intergenic
1169665136 20:8025182-8025204 TTGAAAACGAATAATGATGTAGG + Intergenic
1170264933 20:14455696-14455718 AGGGCAAAAAATAATGATGTTGG - Intronic
1172366335 20:34352699-34352721 TGGGAAAAGAGCAAGGAGGAAGG + Intergenic
1172931266 20:38588041-38588063 TGGGATGAGAAAAAAGAGGTGGG - Intronic
1173255221 20:41389994-41390016 AGGGAAAACAATTATGAGGCAGG - Intergenic
1173432392 20:43000145-43000167 TGGGAAAAGAAGAAAGGGTTGGG - Intronic
1173543946 20:43877505-43877527 TGAGAAAAGACTAAGGAGATTGG - Intergenic
1174441845 20:50561922-50561944 AGGGAGAAAAATGATGAGGTTGG - Intronic
1175013947 20:55768306-55768328 TTGTAAAAGAATAAACAGGTCGG + Intergenic
1175030276 20:55946633-55946655 AGGGATAAGAACAGTGAGGTTGG - Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1176796515 21:13374256-13374278 TGGGAGAAGGATAAAGAGGGTGG + Intergenic
1178347711 21:31845879-31845901 TGTGAAAAGAATAATGGGGGTGG - Intergenic
1178766056 21:35451924-35451946 TGGGAACAAAAGAGTGAGGTGGG + Intronic
1178796578 21:35750478-35750500 TGGGACAGGAATACTGAGGATGG - Intronic
1179310201 21:40188687-40188709 TGCAAAAAGAAAAATGAGATGGG - Intronic
1179317555 21:40257897-40257919 TGTGAAAAGAATAAGGAGAAAGG - Intronic
1181780407 22:25188779-25188801 TGGGAAAACAATAAGGATGAAGG - Intronic
1181959107 22:26610333-26610355 TGGGAAAAAAAGAATGAAGAGGG - Intronic
1182449861 22:30413230-30413252 TGAGAAGTGATTAATGAGGTTGG + Intronic
1182515579 22:30856973-30856995 TGGCCAAAGACAAATGAGGTGGG - Intronic
1182851194 22:33475762-33475784 TGTGAAAAAAATAATGAGTTAGG - Intronic
1184051322 22:42007505-42007527 TGGGAAAAGTATGGTGAAGTGGG - Intronic
1184338226 22:43868429-43868451 TGGGGAAAGAATAGAAAGGTGGG + Intergenic
1184475328 22:44717533-44717555 TGGGGAAAGGGTAATGAGGAGGG - Intronic
949254849 3:2033787-2033809 TGTTAAAAGAAAAAAGAGGTTGG + Intergenic
949608899 3:5683580-5683602 TAGGGAAAGAAAAATTAGGTTGG - Intergenic
950799835 3:15541483-15541505 TGAGAAAATAAAAATGAGCTTGG - Intergenic
951900049 3:27647766-27647788 TGGGACAGGAAAAATGAGCTTGG - Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
953148783 3:40305136-40305158 TGGGAAAAGAGTAAGGAAGGTGG - Intergenic
953285586 3:41604206-41604228 TGGTAAAAGCATAATCAGGAAGG + Intronic
953459444 3:43070966-43070988 TTTAAAAAAAATAATGAGGTGGG - Intergenic
953998322 3:47537123-47537145 TGGGAGAAGAGGAAGGAGGTGGG + Intergenic
954421479 3:50421197-50421219 TGGGAAAAGAAAAACGTGGAGGG + Intronic
954494383 3:50940637-50940659 TTTGAAAAGAATAATAAAGTTGG + Intronic
955570241 3:60297082-60297104 TTGAAAAAGAATAAGGTGGTAGG - Intronic
955577304 3:60379870-60379892 TGGTCAAAGAATATTTAGGTAGG - Intronic
956000766 3:64727891-64727913 AGGAAAAAGAATATGGAGGTGGG - Intergenic
956224221 3:66937795-66937817 TGGGAAAGTAAGAATGAGGCTGG - Intergenic
956226269 3:66962400-66962422 TGGGAAAAGAAAAAAGTGGCAGG - Intergenic
956457397 3:69436160-69436182 TGGGATAAGAATAGTGAGGGAGG - Intronic
957130101 3:76213462-76213484 TGTGAAAAGAAAAATGAGAATGG + Intronic
957224923 3:77430961-77430983 TGGGAAAAGAATAAGCAGATTGG - Intronic
957701065 3:83713452-83713474 TGGGAAAAGAATAAGACGGGAGG - Intergenic
958513063 3:95073899-95073921 CGAGAAAAAAATAATGAAGTTGG + Intergenic
959478217 3:106838028-106838050 TGGGAAAACAAGAATTAGGGAGG + Intergenic
960286548 3:115836548-115836570 TGGGAACAGAACTATAAGGTTGG + Intronic
960385834 3:117020687-117020709 TGGGAAAGGACTGATGACGTGGG + Intronic
960559806 3:119071770-119071792 TTGAAAAAGAAAAATGAAGTGGG - Intronic
961348542 3:126282163-126282185 TTGAAAAAGAAGAATGAAGTTGG - Intergenic
961586416 3:127931007-127931029 TGGGAAAGAAACAATGAGGCAGG + Intronic
962341648 3:134590567-134590589 TGGGAAAGGAAGAATGGGGCTGG + Intergenic
962906911 3:139812017-139812039 TGGGTAAAGAATAATCAGGGAGG - Intergenic
964063508 3:152554221-152554243 TGGGGAAGAAGTAATGAGGTGGG + Intergenic
964134646 3:153330829-153330851 GGGGAAAAGTATTCTGAGGTGGG - Intergenic
964297131 3:155246158-155246180 TGGAAAAACACTAATGAAGTTGG + Intergenic
965070490 3:163910764-163910786 TGTGAAATGAATAATGTGGAGGG - Intergenic
965636464 3:170787010-170787032 TGGAATAAGAAGAATGAGGTTGG + Intronic
965690289 3:171349023-171349045 TTGGAAAAAAAAAAAGAGGTTGG + Intronic
965809063 3:172574021-172574043 TGGGCAAAAATTAAGGAGGTGGG + Intergenic
965858773 3:173121462-173121484 TTGGAAAGGTAGAATGAGGTGGG - Intronic
967533843 3:190579523-190579545 AGGAAAAAGAATAATGGGCTTGG - Intronic
967534657 3:190588429-190588451 TGGAAAATGAATAATGAAGATGG - Intronic
967720161 3:192807637-192807659 TGGAAGAAAAATAATGAAGTAGG + Intronic
967741805 3:193011105-193011127 AGGGATAAGAATATTGAAGTTGG - Intergenic
968039859 3:195579753-195579775 TGGGAGATGCATAATTAGGTGGG - Intronic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970664631 4:18322406-18322428 GGGGAAAAAAATAATTAGGCAGG + Intergenic
970965333 4:21921818-21921840 TGGGAAATGGATATTGAGATGGG - Intronic
971288296 4:25311318-25311340 TGGAAAAAGAATAATGAAGTGGG - Intergenic
971520104 4:27538723-27538745 TGGGAACAGATTCATGATGTAGG + Intergenic
971701427 4:29982772-29982794 TGGGATAAGAATTAGGTGGTTGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
974053806 4:56965642-56965664 TGGAAAAAGGATGATGAGTTCGG + Intronic
974501138 4:62704299-62704321 TGGGAGAAGAAACTTGAGGTTGG + Intergenic
975723211 4:77268095-77268117 TGGGAAAAGGGTAATGAAGGTGG + Intronic
976213421 4:82693608-82693630 TTAGAACATAATAATGAGGTTGG - Intronic
976228945 4:82820490-82820512 TTAGAAAAGAATGGTGAGGTGGG + Intronic
977289444 4:95147934-95147956 TGGGAAAAGAGTAATGACGGAGG - Intronic
977372378 4:96155397-96155419 TGGCAAAAGAGTAATGAAGATGG - Intergenic
977406587 4:96607397-96607419 GGGGAAAAGAAAACTGAGATAGG + Intergenic
977430053 4:96920749-96920771 TGAGAACAGAATAAGGGGGTTGG + Intergenic
977437478 4:97017777-97017799 TTGAACAAAAATAATGAGGTTGG - Intergenic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
979647167 4:123083677-123083699 TGTAAAAATAATTATGAGGTGGG - Intronic
979715457 4:123832204-123832226 TGGGAAAAGAAGAAAGAGGCAGG - Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980411312 4:132423150-132423172 GGGTAAAAGAGGAATGAGGTAGG + Intergenic
981206183 4:142043125-142043147 TGGGAAAAGAATAAAGATGGAGG - Intronic
981256806 4:142671102-142671124 GGGGAAAAGAATATAGATGTAGG + Intronic
981570892 4:146149249-146149271 TGGGAAAACATAAATGAGGAGGG - Intergenic
981869321 4:149467807-149467829 AGGCAGAAGAATAATGAAGTTGG - Intergenic
982413516 4:155105967-155105989 TGGAAAAAGACCAATTAGGTTGG + Intergenic
983574545 4:169247115-169247137 TGGGAAAAGCATAATGACTGAGG + Intronic
984118341 4:175710125-175710147 TTTGAAAAGAATAATAATGTTGG - Intronic
984863416 4:184259610-184259632 TGGGAAAAGAATTAGCAGATTGG - Intergenic
986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG + Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
988080410 5:26408008-26408030 TGGGAAAAGAAAAGTAATGTTGG - Intergenic
988275705 5:29078995-29079017 TGGGAAAATAATCATGTGATGGG + Intergenic
989348596 5:40458055-40458077 TTGGAACAGAATTATGAGGTGGG + Intergenic
990314263 5:54569137-54569159 TTGGAAAAAAAAAATGTGGTTGG - Intergenic
991422497 5:66455491-66455513 GGGGAAAGGAAAAATGAGGTGGG - Intergenic
991497896 5:67245565-67245587 GGGGAAAATAATAATAATGTAGG - Intergenic
991564410 5:67989883-67989905 TGGAAAAAAATTAATGAGGGAGG + Intergenic
992156783 5:73963338-73963360 TATGACAAGAATAATAAGGTGGG + Intergenic
992562769 5:77968665-77968687 AGGGAAAAGAATGCTGATGTGGG - Intergenic
992802459 5:80305935-80305957 TTGGAAAAGGAGAATGAAGTAGG - Intergenic
993435703 5:87890608-87890630 TGTGAAAAGAGTGCTGAGGTTGG + Intergenic
993468402 5:88276285-88276307 TGGGAAAATATAAATGAAGTAGG + Intergenic
994071837 5:95611476-95611498 TGGGAAAATAATATCGAGGTGGG + Intergenic
994103330 5:95917975-95917997 TGTGTAAAGAATACTGGGGTGGG + Intronic
994497611 5:100533961-100533983 GGGGAAAGGAATAATGAGAGAGG + Intergenic
994617485 5:102123646-102123668 TCGAAAGAGAATAATGAAGTTGG - Intergenic
995364221 5:111337649-111337671 TGTCAAAAGAACAAAGAGGTTGG + Intronic
995893561 5:116984940-116984962 GGGGAAAGGAGTAATGCGGTGGG - Intergenic
996452884 5:123646892-123646914 ATGGAAAAAAATAATGAGGGAGG - Intergenic
996581053 5:125032808-125032830 TGGGAAAAGAACAATTAGGATGG + Intergenic
997104350 5:131001851-131001873 TTGGTAAAGAATAATTAGATGGG - Intergenic
997782245 5:136671232-136671254 TTACAAAAGAATAGTGAGGTTGG - Intergenic
998543914 5:143009483-143009505 TGTGAAAGGAATAATTAGGCTGG + Intronic
998894956 5:146789272-146789294 TTGGAAAAGAAAAAAGATGTTGG + Intronic
999083261 5:148864158-148864180 TGGGAACAGAGTAAGCAGGTGGG - Intergenic
999337174 5:150731646-150731668 TAAGAATAGAATAATGATGTGGG - Intronic
999624667 5:153507487-153507509 TGAGAAAAGAGCAATGAGTTTGG - Intronic
1000341312 5:160279234-160279256 GGGGAAATGAATAATGAAATAGG + Intronic
1000459220 5:161492353-161492375 AGGGAATAGAATAATGAGAAGGG - Intronic
1001482488 5:172097990-172098012 TGGGAAAGGAATGATGGGGTGGG + Intronic
1003160840 6:3633135-3633157 TGTGCAATGAATAATTAGGTTGG + Intergenic
1004947089 6:20627526-20627548 TCGGAAAAGAATAATGTGGAAGG - Intronic
1005429358 6:25738133-25738155 TTGAAAAAGAATAAAGTGGTAGG + Intergenic
1006243500 6:32708133-32708155 TTGGAAAAGATTAATTAGGCAGG - Intergenic
1008703386 6:54128696-54128718 TGGGAAAACCAAAATGAGATGGG + Intronic
1008714197 6:54268403-54268425 TGGGAGTAGAATATTGCGGTGGG + Intergenic
1009940872 6:70286287-70286309 TGGTAAAAGAATAGAGAGTTGGG - Intronic
1010689996 6:78899107-78899129 TAGGTAAAGAATACTGAGCTTGG + Exonic
1011112145 6:83850488-83850510 CAGGAAAAAAATAATGAGTTTGG - Intergenic
1011144448 6:84197249-84197271 TGGAAAAAAAAAAAGGAGGTAGG + Intronic
1011478114 6:87767554-87767576 TGGGAAGAGAATGATAAGATAGG - Intergenic
1011906253 6:92372267-92372289 TGCGAAAAGAAGGATAAGGTTGG - Intergenic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1012360064 6:98366343-98366365 GGGGAAAAGCATAATCAAGTTGG + Intergenic
1013068379 6:106705455-106705477 TGGGAAAACAGGAATGAGGGAGG + Intergenic
1013505430 6:110795319-110795341 TGGGTAAAGACTAGTGAGGTTGG + Intronic
1014211355 6:118711598-118711620 GGGGAAAAGTCTAATGAGGGAGG + Intergenic
1014543984 6:122710934-122710956 TGGGAAAAAAAGAATGAGAAGGG + Intronic
1014616310 6:123604388-123604410 AGGGAAAAGGATAAAGAGATAGG + Intronic
1014767574 6:125424313-125424335 TGAGCAAAGAATGCTGAGGTGGG + Intergenic
1015168497 6:130225360-130225382 TGGGAAAACAAGAATGTGGAAGG + Intronic
1015268844 6:131318098-131318120 TGGGAAAAGGAAAATGAAGGTGG - Intergenic
1015969194 6:138727497-138727519 TGGAAAAAGAAAAATGAGGCAGG + Intergenic
1016373173 6:143394843-143394865 TGGGAAAAGAACACTGGGGCAGG + Intergenic
1016434921 6:144026050-144026072 TGGGAAAGTAATAAGGAGCTGGG - Intronic
1016754411 6:147668137-147668159 TCTGAAAAGGAAAATGAGGTTGG - Intronic
1017049021 6:150373015-150373037 TGGGAAAAGAAGAAAAAGATAGG + Intronic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017506404 6:155072583-155072605 TTGAAAAAGAATAACGAGTTTGG + Intronic
1018005217 6:159615794-159615816 TGGGGAAATAAGAATGAGGAAGG + Intergenic
1018993224 6:168690695-168690717 TGTGAAAAGAATATTGAAATTGG - Intergenic
1020053195 7:5097001-5097023 TGGAAGTAGAATAATGAGGCGGG - Intergenic
1021449375 7:20768634-20768656 AGGGAAAAGGATGATGAGCTTGG - Intronic
1022237842 7:28479034-28479056 TTGGGAAAGTATAAAGAGGTGGG + Intronic
1022568687 7:31429701-31429723 TGTTTAAAGAATAATGAGCTTGG - Intergenic
1022594902 7:31704064-31704086 TGAAAAAGGAATAATGAGGCTGG + Intronic
1023355069 7:39358281-39358303 AGGAAAAAGAATAATGTGGGTGG + Intronic
1024753931 7:52505528-52505550 TGAAAAAAGAATATTGAGGATGG + Intergenic
1026728470 7:72890985-72891007 TGGGAAAAGAAGAAGGACTTGGG - Exonic
1027115363 7:75474807-75474829 TGGGAAAAGAAGAAGGACTTGGG + Exonic
1027120546 7:75515836-75515858 TGGGAAAAGAAGAAGGACTTGGG + Intergenic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027286491 7:76650501-76650523 TGGGAAAAGAAGAAGGACTTGGG + Intergenic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1028485916 7:91357111-91357133 TGGGCATAGTATAAGGAGGTGGG + Intergenic
1029057008 7:97756570-97756592 AGTGAAAAGAAAAATGAGATAGG - Intergenic
1029480266 7:100808019-100808041 TGGGAAAAGAGAAAGGAGGAAGG - Intronic
1029638963 7:101806213-101806235 TGTGAAAACAATAATGGGCTGGG - Intergenic
1029722241 7:102376182-102376204 TGGGAAAAGAAGAAGGACTTGGG - Intronic
1030922202 7:115405425-115405447 TGGCAAAATACTAATTAGGTAGG - Intergenic
1031310884 7:120195621-120195643 TAGGAAAAGAGTAAAGAGGGAGG - Intergenic
1031596902 7:123659233-123659255 AGGGTATAGAATAAGGAGGTGGG - Intronic
1031771893 7:125854144-125854166 TAGGTAAAGAGTAATGATGTGGG - Intergenic
1032805699 7:135352141-135352163 GGGGAAAAAAAGAATGATGTGGG + Intergenic
1033291670 7:140090134-140090156 TGGGAAAAGTATTATAAGTTTGG - Exonic
1035952841 8:4042969-4042991 TGGGAAAAAAAAAATTAGCTGGG + Intronic
1036743207 8:11384997-11385019 TTGAAAAAGAAGAATGAAGTAGG + Intergenic
1037378490 8:18258708-18258730 TGGGAGAAGGATAGTGAGATGGG + Intergenic
1038848433 8:31251391-31251413 TGGGGAAAAGATAATGAGCTTGG + Intergenic
1039150894 8:34504432-34504454 TGGGAACAGTATTATGTGGTGGG - Intergenic
1039164163 8:34658144-34658166 TGTGAAAACAATTATGAAGTGGG + Intergenic
1039203003 8:35117599-35117621 TTAGAAAAGAATGATGAGGCTGG + Intergenic
1039209329 8:35194707-35194729 TTAGAAATAAATAATGAGGTGGG + Intergenic
1039261808 8:35780001-35780023 TGGGAACAGATTCATGAGATGGG + Intronic
1039279977 8:35973878-35973900 CTGGAAAAGAACAATAAGGTAGG + Intergenic
1039439045 8:37581863-37581885 TGGGAAAAGAAAAATAAGGGGGG - Intergenic
1041659191 8:60384517-60384539 GGAGAAAAGAAGAAAGAGGTTGG - Intergenic
1042284539 8:67093624-67093646 GTGGAAAAGAGTACTGAGGTAGG + Exonic
1042414119 8:68499795-68499817 TGTGAAAAGAATATTGATATAGG + Intronic
1042973783 8:74441539-74441561 TTTGAAAAGATTAATGAGATAGG + Intronic
1043954775 8:86347408-86347430 TGGGAAAAGAATACTGACATAGG - Intronic
1044368817 8:91383999-91384021 TGGGAAATGAGTAATAAGGGTGG - Intronic
1044378098 8:91500002-91500024 TGGGAAAAGCATAATTATCTGGG + Intergenic
1044484753 8:92738771-92738793 AGGGAAGAGAAAATTGAGGTTGG + Intergenic
1044703943 8:94990361-94990383 TGGGAAAAGACTTGTGAGTTTGG + Intronic
1044714555 8:95088487-95088509 TGGGAAACCACTGATGAGGTAGG - Intronic
1044844665 8:96368786-96368808 TTGTAAAAGAATAATAAAGTGGG - Intergenic
1045699560 8:104850355-104850377 TGGGAAAACACTAGTGAGGGTGG + Intronic
1045932801 8:107646881-107646903 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1046957070 8:120072711-120072733 GGGGAAAAGTAAATTGAGGTGGG + Intronic
1051282755 9:15459054-15459076 TCAGAAAAGAATATTGTGGTGGG - Intronic
1052664523 9:31477788-31477810 TGGGAAAGGAATAAGGTGGTTGG + Intergenic
1052748450 9:32464362-32464384 TAGTAAAAGTATAACGAGGTAGG - Intronic
1053285685 9:36848251-36848273 TGGGGCAGGAATAATGAGGCAGG + Intronic
1056026890 9:82507163-82507185 TGGAAACAGAATAATAATGTGGG + Intergenic
1056208287 9:84340864-84340886 AAGGAAAAGATTAATAAGGTGGG - Intergenic
1056385800 9:86095913-86095935 TAGGAAAAGAGTACTGATGTGGG + Intronic
1056667811 9:88595634-88595656 TGACACAAGAATAATGAGCTGGG + Intergenic
1057395811 9:94679019-94679041 TGGGAAAACAAAAATGAGGGAGG + Intergenic
1057532920 9:95870000-95870022 TTTGAAAAGATTAATGAAGTAGG - Intergenic
1057566564 9:96170236-96170258 TCGGAAAAAAGTAATGATGTAGG - Intergenic
1057739607 9:97700077-97700099 TGAAAAAGGAAAAATGAGGTTGG + Intergenic
1057806202 9:98221484-98221506 TGGGAAATGAAAAGTGAGATGGG + Intronic
1058601323 9:106673900-106673922 TGGGAAAAGACAAAGGAGGGGGG - Intergenic
1058772466 9:108249254-108249276 TGGGAAACGAATAATGGGTGTGG - Intergenic
1058936485 9:109773977-109773999 TGGGGAATGAATAATGAAATTGG - Intronic
1059585854 9:115605513-115605535 TCAGAAAATATTAATGAGGTGGG + Intergenic
1059920708 9:119157213-119157235 TGGCAAGAGAAAAATGAGGAAGG - Intronic
1060028057 9:120189878-120189900 TGGGTAGAGAACAAGGAGGTTGG + Intergenic
1185964159 X:4581198-4581220 TGGAAATGGAATAATGAGTTGGG + Intergenic
1186094193 X:6082211-6082233 TTGAAAAAGACAAATGAGGTAGG + Intronic
1186420948 X:9425972-9425994 TGGGAATAGAAGAATGGGGAAGG + Intergenic
1187257210 X:17654328-17654350 TGGGACAGGAAGGATGAGGTGGG - Intronic
1188407708 X:29832324-29832346 TGGGAAAGGAATGATTATGTAGG - Intronic
1189222780 X:39386579-39386601 TGGGAAAAGTATAAAGAGGTTGG - Intergenic
1189301817 X:39957847-39957869 TGGGGAAACAAGAATGGGGTTGG + Intergenic
1189622946 X:42862943-42862965 TGGTAAAAGAATAAAAAGTTTGG - Intergenic
1190026560 X:46929116-46929138 TGGGCAAGGAATCATGAGGAAGG - Intronic
1190176064 X:48150721-48150743 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190182074 X:48201233-48201255 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190187457 X:48248259-48248281 TTGGAAAAGAAGAATAAGGTGGG - Intronic
1190191950 X:48284424-48284446 TTGGAAAAGAAGAATAAGGTGGG - Intergenic
1190201220 X:48363025-48363047 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202483 X:48375152-48375174 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202656 X:48376858-48376880 TTGAAAAAGAAGAATAAGGTAGG + Intergenic
1190207882 X:48418552-48418574 TTGAAAAAGAAGAATAAGGTAGG - Intergenic
1190208055 X:48420258-48420280 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190210686 X:48444302-48444324 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190656339 X:52616028-52616050 TTGGAAAGGAAGAATAAGGTGGG - Intergenic
1190661655 X:52660168-52660190 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190669300 X:52725742-52725764 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190670117 X:52732662-52732684 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190767620 X:53488580-53488602 TGGGAAAATAACTATAAGGTGGG + Intergenic
1190795836 X:53740905-53740927 TTGGAAAAGAATAATAAAGTAGG - Intergenic
1192347861 X:70326450-70326472 AGAAAAAAGAAAAATGAGGTAGG - Intronic
1193559001 X:82994436-82994458 TGAAAAAAAAATAATGAGATAGG - Intergenic
1194729397 X:97436203-97436225 TGGGCAAAGAATAAAAAAGTCGG - Intronic
1194862131 X:99012845-99012867 TGGGGAAATAATGATAAGGTAGG + Intergenic
1195424510 X:104713221-104713243 TGGGTAAAGAATAATGGACTTGG + Intronic
1196135171 X:112200914-112200936 AGGGAAAGGAATAATGAGGAAGG + Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1197381796 X:125752879-125752901 TTGAAAAAGAATAATGAACTTGG + Intergenic
1198343272 X:135735190-135735212 TGGGAAAAAAAAACTGAGGCAGG - Intergenic
1198385037 X:136120749-136120771 TTGAAAAAGAAAAATGAAGTTGG - Intergenic
1198672198 X:139093052-139093074 AGGGAAAAGAATAATAAAGAAGG + Intronic
1199723647 X:150561474-150561496 TTGAAAAAGAAGAATGAAGTTGG - Intergenic
1200324102 X:155219671-155219693 TGGGAAATGCATAAAGTGGTGGG + Intronic
1200526825 Y:4283593-4283615 TGGAAAAAAAATAATAAGATAGG + Intergenic
1201935567 Y:19407366-19407388 GTGGAAAAGAGTAATGATGTAGG + Intergenic
1202364094 Y:24143230-24143252 TGGGAAAGGAACACTGAGTTTGG + Intergenic
1202506686 Y:25526892-25526914 TGGGAAAGGAACACTGAGTTTGG - Intergenic