ID: 1146023068

View in Genome Browser
Species Human (GRCh38)
Location 17:29295115-29295137
Sequence TTCCTGAGTAACCACTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146023068_1146023072 -5 Left 1146023068 17:29295115-29295137 CCATGATAGTGGTTACTCAGGAA No data
Right 1146023072 17:29295133-29295155 AGGAAGGAAGAGGGTTGTGATGG No data
1146023068_1146023074 -3 Left 1146023068 17:29295115-29295137 CCATGATAGTGGTTACTCAGGAA No data
Right 1146023074 17:29295135-29295157 GAAGGAAGAGGGTTGTGATGGGG No data
1146023068_1146023076 1 Left 1146023068 17:29295115-29295137 CCATGATAGTGGTTACTCAGGAA No data
Right 1146023076 17:29295139-29295161 GAAGAGGGTTGTGATGGGGAGGG No data
1146023068_1146023075 0 Left 1146023068 17:29295115-29295137 CCATGATAGTGGTTACTCAGGAA No data
Right 1146023075 17:29295138-29295160 GGAAGAGGGTTGTGATGGGGAGG No data
1146023068_1146023073 -4 Left 1146023068 17:29295115-29295137 CCATGATAGTGGTTACTCAGGAA No data
Right 1146023073 17:29295134-29295156 GGAAGGAAGAGGGTTGTGATGGG No data
1146023068_1146023077 8 Left 1146023068 17:29295115-29295137 CCATGATAGTGGTTACTCAGGAA No data
Right 1146023077 17:29295146-29295168 GTTGTGATGGGGAGGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146023068 Original CRISPR TTCCTGAGTAACCACTATCA TGG (reversed) Intergenic
No off target data available for this crispr