ID: 1146032943

View in Genome Browser
Species Human (GRCh38)
Location 17:29381930-29381952
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146032934_1146032943 7 Left 1146032934 17:29381900-29381922 CCAGGAAGTCAGTCTTGACCTTG No data
Right 1146032943 17:29381930-29381952 CAATATTAGTAGAGGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146032943 Original CRISPR CAATATTAGTAGAGGGGGGT GGG Intergenic
No off target data available for this crispr