ID: 1146034059

View in Genome Browser
Species Human (GRCh38)
Location 17:29390718-29390740
Sequence CGTCGCCGCCTCGGGGGAAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146034059_1146034066 -9 Left 1146034059 17:29390718-29390740 CCGGTTCCCCCGAGGCGGCGACG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1146034066 17:29390732-29390754 GCGGCGACGGAGACGGCTCCCGG 0: 1
1: 0
2: 0
3: 22
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146034059 Original CRISPR CGTCGCCGCCTCGGGGGAAC CGG (reversed) Exonic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
920920328 1:210292768-210292790 CGACGACGCCTCGGAGGATCCGG - Intergenic
1070754454 10:78983026-78983048 CGTGGCAGCCTTGGGGTAACTGG + Intergenic
1071835736 10:89415236-89415258 GGCCGCCGCCTCCGGGAAACTGG + Intronic
1074865430 10:117542121-117542143 CGGCCCCGCGTCGGGAGAACTGG - Intergenic
1075040718 10:119104623-119104645 CGCCCCCGGCTCGGGGGAACCGG - Intronic
1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG + Intergenic
1089694919 11:120211071-120211093 CGTCTCCGCCTCGGGGCCGCCGG + Exonic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1105492583 13:20902863-20902885 CGTCGCGGCCTCGGCGGGTCTGG + Intronic
1114350589 14:21846447-21846469 CGTCGCCCCCTGGAGGGCACAGG - Intergenic
1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG + Intronic
1122975366 14:105168667-105168689 CGTCGCCGCCGGGTGGGAGCCGG - Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG + Intergenic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1154125636 18:11689716-11689738 CTTCGCCGCCCCGAGGGAGCAGG - Exonic
1160949323 19:1658023-1658045 TGCCCCCGCCTCGGGGTAACTGG - Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
932380421 2:71276859-71276881 CGTCCCCGCGTCGCGGGAATGGG + Intronic
942178396 2:173355894-173355916 AGTCGCCGCCCCGGTGGAGCTGG + Intronic
948806063 2:240453807-240453829 CGTCGCCGCCCTGGGGGTCCCGG - Intronic
1175923094 20:62459075-62459097 CCTCGCAGCCTCGGGGGTGCCGG + Intergenic
1178922540 21:36747965-36747987 GGTCGCCGCCTCGGGGCCGCCGG - Exonic
1181478243 22:23181365-23181387 GGCAGCCGCGTCGGGGGAACGGG + Exonic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG + Intronic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG + Intronic
968507391 4:977170-977192 CCTCGCAGCCTCGGAGGAGCCGG + Intronic
968608004 4:1544653-1544675 CCTCGCAGCCTCGGAGGAGCCGG + Intergenic
985610257 5:883937-883959 CCTTGCCGCCTGGGAGGAACCGG + Exonic
991263448 5:64690689-64690711 CCTCGCCGCGCCGGGGGCACTGG - Exonic
992889667 5:81192519-81192541 CGGCGCCACCTTGGGGCAACAGG - Intronic
997585098 5:135039306-135039328 GGTAGCAGCCTCGGGGGCACGGG - Intronic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1018790914 6:167147032-167147054 AATCGCTGCCTCTGGGGAACTGG + Intronic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1029714173 7:102317173-102317195 CATCCCCACCTCAGGGGAACAGG + Exonic
1034262304 7:149764732-149764754 CGGCGCCACCTCGGGGGGAGCGG + Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1049373225 8:142277499-142277521 CATGGCCGGCTCGGGGCAACTGG + Intronic
1053304525 9:36974820-36974842 CGTCGAGGCCTCGGGGGCTCAGG - Intronic
1061559759 9:131394580-131394602 CGGCCCGGCCTCGGGGGTACGGG - Intronic
1062105763 9:134753943-134753965 CGTCGCTGCCGCCGGAGAACGGG - Intronic
1189075024 X:37905862-37905884 CGCCGCCGCCTGGGGGCATCCGG + Intronic