ID: 1146034066

View in Genome Browser
Species Human (GRCh38)
Location 17:29390732-29390754
Sequence GCGGCGACGGAGACGGCTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146034054_1146034066 3 Left 1146034054 17:29390706-29390728 CCGAGGCCCGGGCCGGTTCCCCC 0: 1
1: 0
2: 1
3: 42
4: 814
Right 1146034066 17:29390732-29390754 GCGGCGACGGAGACGGCTCCCGG 0: 1
1: 0
2: 0
3: 22
4: 187
1146034059_1146034066 -9 Left 1146034059 17:29390718-29390740 CCGGTTCCCCCGAGGCGGCGACG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1146034066 17:29390732-29390754 GCGGCGACGGAGACGGCTCCCGG 0: 1
1: 0
2: 0
3: 22
4: 187
1146034056_1146034066 -3 Left 1146034056 17:29390712-29390734 CCCGGGCCGGTTCCCCCGAGGCG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1146034066 17:29390732-29390754 GCGGCGACGGAGACGGCTCCCGG 0: 1
1: 0
2: 0
3: 22
4: 187
1146034057_1146034066 -4 Left 1146034057 17:29390713-29390735 CCGGGCCGGTTCCCCCGAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 97
Right 1146034066 17:29390732-29390754 GCGGCGACGGAGACGGCTCCCGG 0: 1
1: 0
2: 0
3: 22
4: 187
1146034047_1146034066 30 Left 1146034047 17:29390679-29390701 CCTCGGCTGTGTGAGGACTAGAG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1146034066 17:29390732-29390754 GCGGCGACGGAGACGGCTCCCGG 0: 1
1: 0
2: 0
3: 22
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146034066 Original CRISPR GCGGCGACGGAGACGGCTCC CGG Exonic
900993751 1:6109426-6109448 GGGGCCAAGGAGAAGGCTCCAGG + Intronic
901060184 1:6468253-6468275 GCGGCGGCGGAGACGGGGCGAGG + Exonic
901536431 1:9885206-9885228 GGGGCAATGGTGACGGCTCCCGG + Intronic
905179339 1:36156600-36156622 GCTGCGGCGGCGGCGGCTCCAGG + Intronic
905347008 1:37318150-37318172 GACACGACGCAGACGGCTCCGGG - Intergenic
905960737 1:42040442-42040464 GCGACCACGCAGAGGGCTCCGGG - Intergenic
907178884 1:52553002-52553024 GCGGCGACGGCGGCGGCAGCAGG - Intronic
907341384 1:53738509-53738531 GAAGCCCCGGAGACGGCTCCGGG + Intergenic
912385470 1:109269171-109269193 ACGGCGACAGCGACGGCACCCGG + Exonic
913615721 1:120558176-120558198 GCGGCGGCGGCGGCGGCTACTGG + Intergenic
914574555 1:148952726-148952748 GCGGCGGCGGCGGCGGCTACTGG - Intronic
914677879 1:149917802-149917824 GCGGCAGCGGCGACTGCTCCCGG + Exonic
915325323 1:155078918-155078940 GCGGCGGCGGCGGCGGCTCCGGG + Exonic
915463195 1:156081749-156081771 GCGGCGGCGGGGCCGGCTGCGGG + Exonic
915616988 1:157046213-157046235 GCGGCGGCGGGGACGGCGCGCGG - Intergenic
916065503 1:161132633-161132655 GCGGCGGCGGCGGCGGCTGCTGG - Exonic
920260458 1:204685012-204685034 GCGGCCAGGGAGAGGGCGCCTGG - Intronic
922416595 1:225427969-225427991 GCGGTGACACGGACGGCTCCCGG + Intronic
923338709 1:232990689-232990711 GTGGGGACAGAGACGGCTGCAGG - Intronic
1064981873 10:21173851-21173873 GCGGCGGCGGCGGCGGCTGCTGG + Intronic
1065023158 10:21517134-21517156 GCGGCGGCGGCGGCGGCTGCCGG + Exonic
1066370404 10:34814822-34814844 GCGGCGGCGGGGACGGCGCCGGG - Intronic
1067079698 10:43206009-43206031 GCGGGGCCGGTGGCGGCTCCGGG - Exonic
1069819269 10:71217534-71217556 GCAGCGGCTGAGGCGGCTCCGGG - Intronic
1075519523 10:123135589-123135611 GCGGTGGCGGAGGCGGCTGCGGG + Intergenic
1075697480 10:124447612-124447634 GCGGCGGCGGCGGCGGCTCGGGG - Exonic
1076035718 10:127196862-127196884 GCTGCTCCGGAGGCGGCTCCAGG - Intronic
1076792882 10:132786113-132786135 GCGGCGGCGGCGGCGGCTCCGGG + Intergenic
1080503803 11:32893252-32893274 GCGGCGGCGGCGGCGGCTCGGGG - Exonic
1083329613 11:61891459-61891481 GCGGCGGCGGAGGCGGCGCCCGG - Exonic
1083595553 11:63916976-63916998 GCGGCGGCGGCGACGGCGGCGGG + Intergenic
1084129039 11:67119350-67119372 GCGGCGGCGGCGGCGGCTCTCGG + Intronic
1084489590 11:69471167-69471189 GCGGCCCCGGAGCCGGCTGCGGG + Intergenic
1085074655 11:73580226-73580248 GCGGCGACAGTGACGGCAGCGGG - Intronic
1086980999 11:93197801-93197823 GCGGCGACGCCGGCGGCTGCCGG - Exonic
1088686742 11:112290210-112290232 GCGGGGACGCGGGCGGCTCCGGG + Intergenic
1089046327 11:115504327-115504349 GCGGCGGCGGCGGCGCCTCCCGG - Exonic
1092253535 12:6914553-6914575 GCGGCGGCGGCTGCGGCTCCCGG - Intronic
1094238072 12:28190821-28190843 GCGGGAACGGAGCCAGCTCCCGG + Intronic
1094564935 12:31590848-31590870 GCGGCGGCGGCGGCGGCCCCTGG - Exonic
1096254967 12:50057416-50057438 GCAGGCAGGGAGACGGCTCCGGG + Intergenic
1102197410 12:111034855-111034877 GCGGCGGCGGCGGCGGCCCCCGG - Intronic
1102853953 12:116277495-116277517 GAGGCGGCGGCGGCGGCTCCGGG - Intergenic
1102854055 12:116277802-116277824 GCGGCGGCGGCGGCGGCTCGCGG + Intergenic
1105031545 12:132887564-132887586 GCGGCGGCGCAGCCGGTTCCGGG - Exonic
1106735735 13:32586529-32586551 GCGGCGGCGGCGGCGGATCCCGG + Exonic
1119003987 14:70907823-70907845 GCGGCGACGGCGGCGGCGCCGGG + Exonic
1120167909 14:81220398-81220420 GCGGGGACGGCGGCGACTCCCGG - Intronic
1120521874 14:85533867-85533889 GCGGCGACGGCGGCGGCTGCTGG - Intronic
1122905685 14:104800572-104800594 GCGGGGACGGCGAGGGCGCCGGG - Intergenic
1124220351 15:27845687-27845709 GGAGCGACGGAGGAGGCTCCTGG - Intronic
1124922312 15:34038912-34038934 GCGGCGGCGGAGGCGGCGGCGGG - Exonic
1126574274 15:50182347-50182369 GCGGCGACTGGGCGGGCTCCGGG - Exonic
1126592456 15:50354448-50354470 GCGGCGAGGGTGGCGGGTCCTGG - Intronic
1127606505 15:60592462-60592484 GCGGCGGCAGAGGGGGCTCCGGG - Intronic
1129675974 15:77632630-77632652 GAGGCGGCGGCGGCGGCTCCGGG - Intronic
1132837996 16:1964391-1964413 GCGGCGCCGGAGAGCGGTCCTGG - Intronic
1132885104 16:2179052-2179074 GCGGCGGCGGCGGCGGCTCGCGG + Exonic
1132900444 16:2251362-2251384 CCGGCGGCGGAGACGGCGCGCGG - Exonic
1137708013 16:50548606-50548628 GCGGCGACGGCGGCGGGGCCCGG - Intronic
1138595419 16:58026803-58026825 GGGGCGGCGGAAGCGGCTCCCGG - Intronic
1139754636 16:69132541-69132563 GCGGCGGCGGCGACGGCGGCGGG - Exonic
1141597993 16:85108947-85108969 GCGTTCACAGAGACGGCTCCTGG - Intronic
1141683374 16:85556630-85556652 GCCGCGGCGGAGCCGGCTCCCGG - Intergenic
1142131997 16:88435381-88435403 GCTGAGAGGGAGAAGGCTCCGGG + Exonic
1142136376 16:88453625-88453647 GCGGCGCCGGAGACATGTCCAGG + Exonic
1143116482 17:4584440-4584462 GCGGAGCCGGGGACGACTCCGGG - Intronic
1143750499 17:9023403-9023425 GCGGCGGCGGAGCCGGCGGCGGG + Intronic
1144910055 17:18673030-18673052 GCGGCGGCGGCGGCGGCGCCCGG - Exonic
1145912856 17:28552502-28552524 ACGGCGACGGAGTCCGCTCCGGG - Exonic
1145992413 17:29087004-29087026 GCGGCTACAGAGGCAGCTCCGGG - Exonic
1146034066 17:29390732-29390754 GCGGCGACGGAGACGGCTCCCGG + Exonic
1146332315 17:31937337-31937359 GTGGCGGCGGCGACGGCTTCGGG + Exonic
1147486365 17:40818906-40818928 GCGGCGGCGGCGGCGGCTACGGG - Exonic
1147757898 17:42780553-42780575 GCGGCGACGGGGGCGGGGCCAGG + Intergenic
1148060055 17:44830077-44830099 CCGGCGGAGGAGGCGGCTCCGGG - Intronic
1150003653 17:61456638-61456660 GCGGCGACGACGTCGGCCCCGGG - Exonic
1151558695 17:74859893-74859915 GCGGCGGCGGCGGCGGCTCCGGG + Intronic
1151755833 17:76074831-76074853 GCGGAGACCCAGACGGCTGCAGG + Exonic
1151825732 17:76523226-76523248 GCGGCGCAGGAGGCGGCTCCCGG + Intergenic
1152049083 17:77958757-77958779 GCGGCGGCGGCTACGGCTCCCGG - Intergenic
1152396331 17:80035831-80035853 GAGGCGACGGTGGCGGCTCTCGG - Exonic
1152650044 17:81488468-81488490 GCGGCGCCGGAAACGGCAACAGG - Intergenic
1153040819 18:812023-812045 GCGGCGGCGGCGGCGGCTCCGGG + Intronic
1155392755 18:25352411-25352433 GCGGCGACGGCGGCGGCGCGGGG - Intergenic
1160685987 19:436789-436811 GTGGGGATGGAGACGTCTCCTGG + Intronic
1161988468 19:7670372-7670394 GCGCGGGCGGAGGCGGCTCCAGG + Exonic
1163282146 19:16324740-16324762 GCGGCGGCGGAAACGCGTCCCGG - Intergenic
1163282313 19:16325323-16325345 GGGGCGGCGGCGGCGGCTCCGGG - Exonic
1163748922 19:19064021-19064043 GCGGCGGCGGCGACGCGTCCGGG + Exonic
1164693588 19:30227734-30227756 GCGGCGGCGGCGGCGGCTGCCGG - Intergenic
1164835114 19:31350884-31350906 GCCGCGCCGGGGCCGGCTCCGGG + Intergenic
1165906390 19:39197048-39197070 GTGGCGAGGGAGGCAGCTCCTGG - Exonic
1166688353 19:44809095-44809117 GCGGCGGCGGAGACTGAGCCCGG - Exonic
1166695115 19:44847662-44847684 GGGGCGACGGAGACGTCGCCGGG + Intronic
1166888043 19:45973417-45973439 GTGGCGGCGGCGACGGCTGCTGG + Exonic
1167001112 19:46746266-46746288 GCGGCGGCGGAGGCAGCCCCGGG - Exonic
1167557471 19:50205298-50205320 GCGGCGGCGGCGGCGGCGCCAGG - Intronic
1167633482 19:50639789-50639811 GCGGCGGCAGCGGCGGCTCCGGG - Intronic
1168076351 19:53982605-53982627 GCGGCGGCGGAGGCGGCGGCGGG + Exonic
926154900 2:10448295-10448317 GCGGCGGCGGCGGCGGCTACAGG + Exonic
927881460 2:26692717-26692739 GCGGCGGCGGCGGCGGCCCCGGG + Intronic
929174231 2:38960550-38960572 GCGGCGACGGCGGCGGCGGCCGG - Exonic
929778358 2:44942295-44942317 GCGGCGGCGGCGGCGGCTCCAGG + Exonic
930136097 2:47905576-47905598 GCGGCGGCGGAGGCTGCTGCTGG + Exonic
930641654 2:53859769-53859791 ACGATGCCGGAGACGGCTCCCGG - Intronic
933666832 2:84971204-84971226 GCGGCGTCGGACCCGCCTCCTGG + Exonic
933876178 2:86623537-86623559 GCGGGCACGGCGGCGGCTCCAGG + Exonic
934296788 2:91748916-91748938 GCGGCGGCAGCGACGGCCCCGGG - Intergenic
934736298 2:96691518-96691540 GCGGCGGCGGAACCGGCTCTGGG - Intergenic
937045129 2:118847094-118847116 GCGGCGGCGGCGGCGACTCCGGG - Exonic
938451540 2:131425322-131425344 GCGGCGGCGGCGGCGGCTCGGGG - Intergenic
939153800 2:138501740-138501762 GCGGCGGCGGCGGCGGCTCCTGG - Intergenic
947860526 2:233354554-233354576 GCGGCGGCGGAGGCGGTTGCGGG - Exonic
1168965410 20:1895287-1895309 GCGGCGGCGGCGGCCGCTCCAGG + Intronic
1169171885 20:3471570-3471592 GGGGCGTTCGAGACGGCTCCAGG + Intronic
1170150416 20:13221455-13221477 GCGGCGGCGGAGACGGAGACTGG - Intergenic
1171173527 20:23035203-23035225 GCGGGGCCGGAGACGACTCCAGG + Intergenic
1174533062 20:51230022-51230044 GCCACGACGCAGACGGATCCTGG - Intergenic
1175847238 20:62065368-62065390 GCGGCGACGGCGGCGGCGGCGGG + Exonic
1176286167 21:5020646-5020668 GCGGAGAGGGGGACGGCCCCCGG - Intergenic
1176375692 21:6085960-6085982 GAGGGGACGGAGAAGGCCCCAGG + Intergenic
1176547610 21:8208442-8208464 GCGGGGGAGGAGACGGTTCCGGG + Intergenic
1176566561 21:8391489-8391511 GCGGGGGAGGAGACGGTTCCGGG + Intergenic
1176574437 21:8435676-8435698 GCGGGGGAGGAGACGGTTCCGGG + Intergenic
1176611049 21:8986968-8986990 GCGGGGGAGGAGACGGTTCCGGG + Intergenic
1179213660 21:39348850-39348872 GGGGCGCCGGCGGCGGCTCCAGG + Intronic
1179747782 21:43452284-43452306 GAGGGGACGGAGAAGGCCCCAGG - Intergenic
1179871014 21:44242829-44242851 GCGGAGAGGGGGACGGCCCCCGG + Intergenic
1181267979 22:21642285-21642307 GCGGGGACGGAAGCGGCCCCTGG + Exonic
1182729372 22:32474943-32474965 GCGGCGACGGGGACGGCGGCGGG - Exonic
1183933793 22:41250382-41250404 GAGGCGAGGGGGACGGTTCCTGG - Intronic
1184759691 22:46537446-46537468 GCGGCGGCGGCGGCGGCTCCAGG + Intergenic
1203252483 22_KI270733v1_random:124727-124749 GCGGGGGAGGAGACGGTTCCGGG + Intergenic
1203260540 22_KI270733v1_random:169813-169835 GCGGGGGAGGAGACGGTTCCGGG + Intergenic
950316307 3:12004644-12004666 GCGGCGGCGGCGGCGGCTGCTGG - Exonic
950729788 3:14947614-14947636 GCGGCGGCGGCGGCGGCACCGGG + Intronic
950779092 3:15375653-15375675 GCGGCGATGGCGACGGCGGCGGG + Intergenic
953989882 3:47475839-47475861 GCGGCGACGGGGGCGGCAGCAGG + Exonic
954194769 3:48990101-48990123 GCGCGGACGCAGGCGGCTCCGGG + Exonic
957792485 3:84959049-84959071 GCGGCGGCAGTGGCGGCTCCCGG - Intronic
962129848 3:132660626-132660648 GCGGCGACGGAGGGGGCGGCCGG + Exonic
965590655 3:170357736-170357758 GCGGCGACGGCGGCGGCGGCGGG + Intronic
966911417 3:184562250-184562272 GCGGCGACGGCGGCGGCGGCGGG - Exonic
966919332 3:184601931-184601953 CCGGCGGCGGAGCCGGCCCCCGG - Intronic
967858260 3:194134289-194134311 GCGGCGGCGGCGACTCCTCCCGG + Intergenic
967924188 3:194633388-194633410 GCGGCGGCGGCGAAGGCGCCGGG + Exonic
969717053 4:8872791-8872813 GCCGGAACGGAGACAGCTCCAGG - Intergenic
975485755 4:74933072-74933094 GCGGAGGCGGAGGCGGCCCCGGG + Intergenic
975689530 4:76950035-76950057 GCGGCGGCGGCGACGGCTGTGGG + Intronic
979832040 4:125315654-125315676 GCGGCGGCGGCGGCGGCTGCAGG + Intergenic
980130071 4:128809988-128810010 GCGGCGGCGGCGGCGGCTGCAGG + Intronic
981034423 4:140154318-140154340 GAGGCGACGGAGACGGGAGCCGG - Intergenic
989011538 5:36877208-36877230 GCGGCGGCGGCGCCGGCGCCAGG + Intronic
992473266 5:77077763-77077785 GCGCCGACGCCGACGCCTCCCGG - Exonic
995354718 5:111224446-111224468 GCGGCGGCGGCGGCGGCTTCCGG + Exonic
996978492 5:129461463-129461485 GCGGGGACGGGGGCGGCTGCGGG - Exonic
997201341 5:132011711-132011733 GCCGCTGCGGAGACGGCTCAAGG + Intronic
1001070309 5:168579569-168579591 GCGGCGGTGGCGGCGGCTCCGGG - Exonic
1003206946 6:4021382-4021404 GCGGCGGTGGCGGCGGCTCCCGG - Exonic
1004044687 6:12012443-12012465 GCGGCGGCGGCGGCGGCGCCTGG - Exonic
1006463714 6:34178574-34178596 GCGGCGAGGCAGGCCGCTCCAGG + Intergenic
1007784206 6:44270789-44270811 GCGGCGGCGGTGGCGGCCCCGGG + Exonic
1011610440 6:89145978-89146000 GCGGCGCCGGGGGCGGCCCCGGG + Intergenic
1015149236 6:130019887-130019909 GCCGCGACGGCGCGGGCTCCCGG - Intronic
1015904886 6:138107097-138107119 GCGGCGACGGCGGCGGCGGCGGG + Intronic
1016714106 6:147204110-147204132 GCGGCGACGGTGGCGGCGCCGGG + Intergenic
1017672012 6:156777822-156777844 GCGGCGGCGGCGGCGGCACCGGG + Intergenic
1018205083 6:161429609-161429631 GAGGCCACGGAGATGGCTGCTGG + Intronic
1019354068 7:569876-569898 GCGGGGACAGTGACGGTTCCAGG - Intronic
1020081410 7:5287919-5287941 GAGGCGGCGGAGGCGGCTCAGGG + Exonic
1020418094 7:7969052-7969074 GCGGTGGCGGCGGCGGCTCCGGG + Exonic
1021451143 7:20784868-20784890 GCGGCGACGGGGCCGAGTCCGGG + Exonic
1022103794 7:27184542-27184564 GCGGCGGCGGCGGCGGCTGCCGG - Exonic
1022375284 7:29806616-29806638 GCGGCGGCGGAGACGTCGGCCGG + Exonic
1022528353 7:31052439-31052461 ACGGCGGCGGCGGCGGCTCCGGG + Exonic
1025197503 7:56944229-56944251 GAGGCGGCGGAGGCGGCTCAGGG - Intergenic
1025674444 7:63632710-63632732 GAGGCGGCGGAGGCGGCTCAGGG + Intergenic
1025739045 7:64182015-64182037 GCGGCGGCGGCGGCGGCGCCTGG - Intronic
1026906035 7:74063306-74063328 GCGGCGGCGGGTCCGGCTCCTGG - Exonic
1029374820 7:100171321-100171343 GCGGCGTCGGCTACAGCTCCGGG - Exonic
1029927004 7:104328783-104328805 GCGGCAGCGGCGGCGGCTCCGGG - Exonic
1033033218 7:137846774-137846796 GCGGCGGCGGCGGCGGCTGCAGG + Exonic
1033186444 7:139231351-139231373 GCGCCGGCGGAGACGGCTGAGGG + Intronic
1034448007 7:151123188-151123210 GCGGCGGCGGCGGCGGCTTCCGG - Intronic
1035255893 7:157627130-157627152 GAGGCCACTGAGAAGGCTCCAGG - Intronic
1036454147 8:8893228-8893250 GCGGCGACGCGAGCGGCTCCGGG + Exonic
1037788986 8:21919966-21919988 GAGGGGACGGAGAAGGCCCCCGG - Intronic
1039454295 8:37697292-37697314 GCGGCTGCGGAGGCGGCGCCCGG - Exonic
1041690397 8:60680416-60680438 GCGGCGGCGGCGGCGGCTCCCGG + Intronic
1041919803 8:63168842-63168864 GCGGCGGCGGCGGCGGCTCTCGG + Exonic
1043847282 8:85177516-85177538 GCGGCGGCGGGGGCGGCTGCGGG - Exonic
1049109854 8:140635793-140635815 GCGGCGGCGGCGGCGGCGCCGGG + Intergenic
1049845527 8:144799051-144799073 GAGGCGACAGTGACGGCTGCGGG - Intronic
1051665065 9:19461322-19461344 GCGGCGGCGGCGACGGCGCGAGG + Intergenic
1052903985 9:33817728-33817750 GCGGCGGCGGCGGCGGCGCCGGG - Exonic
1055611777 9:78031583-78031605 GCGGCGGCGGCGGCGGCTCGGGG - Intergenic
1056243243 9:84669746-84669768 GAGGCGGCGGCGGCGGCTCCCGG + Intronic
1057733769 9:97633931-97633953 CCGGCCACGGAGGCCGCTCCCGG + Intronic
1061438151 9:130579651-130579673 GCGGCGGCGGCGACGGCGGCGGG + Exonic
1061786419 9:133031142-133031164 GCGGCGAGGAAGGCGTCTCCCGG + Exonic
1061975852 9:134067790-134067812 GCGGCGGCGGCGGCGGCCCCGGG + Intronic
1062600452 9:137316667-137316689 GGGGAGACGGAGGCTGCTCCGGG + Intronic
1203468888 Un_GL000220v1:107878-107900 GCGGGGGAGGAGACGGTTCCGGG + Intergenic
1203476709 Un_GL000220v1:151850-151872 GCGGGGGAGGAGACGGTTCCGGG + Intergenic
1185641509 X:1591633-1591655 GCGGCGTCGGAGGCGCCTCCGGG + Exonic
1186496378 X:10015321-10015343 GCGGCGGCGGCGGCGGCTCCCGG + Intergenic
1187915720 X:24150347-24150369 GCGGCGCCGGTGACGGGCCCCGG + Intronic
1189323263 X:40098427-40098449 GCGGCGGCGGCGAGGGCTGCCGG + Intronic
1199612718 X:149631713-149631735 ACGGCGACGGCGACGGCAGCGGG - Exonic