ID: 1146043994

View in Genome Browser
Species Human (GRCh38)
Location 17:29486884-29486906
Sequence CTGTTTAAGCAGAGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 401}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146043994 Original CRISPR CTGTTTAAGCAGAGAGAAGA TGG Intronic
900741623 1:4333654-4333676 CTCTGGAAGCTGAGAGAAGAGGG + Intergenic
900752273 1:4406120-4406142 CTGATTAACCAGAGAGGAGGAGG + Intergenic
901786497 1:11628379-11628401 ATGTTTAAGCTGAGATCAGAAGG + Intergenic
902531512 1:17093712-17093734 CTATACAAGCATAGAGAAGAGGG - Intronic
903350713 1:22714872-22714894 CTGTTTTAGAAGAGAGAATCAGG - Intronic
903459461 1:23510240-23510262 CAGGCTAAGGAGAGAGAAGAAGG - Intronic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905545195 1:38792251-38792273 GTGTTTGAGCAGAGACAGGATGG - Intergenic
905600723 1:39248186-39248208 ATGTTTTAGTAGAAAGAAGACGG - Intronic
906170202 1:43718589-43718611 CTGTTGAAGGAGGGAGAAGAAGG - Intronic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
907868769 1:58424074-58424096 CTGTCTCAGCAGAGAGGTGAAGG + Intronic
907948330 1:59156147-59156169 GTTTTTAAGCACAGAGAGGATGG + Intergenic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
909269149 1:73600815-73600837 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
909652301 1:77989083-77989105 CTGTTTAAAAAGAGAGGAGTGGG - Intronic
910354701 1:86341448-86341470 CAGTTAAACCAGAGAGAAAAAGG - Intergenic
910867678 1:91803054-91803076 CTTTTAAAGCAGAGAAAAGCAGG - Intronic
911496047 1:98632628-98632650 GTGTTTGTGCAGAGAGAAGGAGG + Intergenic
911513307 1:98835222-98835244 ATGTTTAAGCTTAGTGAAGAAGG - Intergenic
912648992 1:111421577-111421599 GTCTTCAGGCAGAGAGAAGAGGG + Exonic
912670021 1:111616887-111616909 CTATTAAAGGAGATAGAAGAAGG - Intronic
915021551 1:152784768-152784790 CTTTTCAAGCAGAGACAATAGGG + Intronic
915475843 1:156152415-156152437 CTGTTTAAGCAGAGAGGCCCAGG + Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916441086 1:164825293-164825315 GTGATAAAGTAGAGAGAAGAGGG - Intronic
916620424 1:166490520-166490542 CTAATTCAGGAGAGAGAAGATGG + Intergenic
916856056 1:168751312-168751334 TTTTTTAAACAGACAGAAGATGG - Intergenic
916880540 1:169016095-169016117 CTGGTTTAGCAGGGAGAAGACGG - Intergenic
916987004 1:170202370-170202392 ATGTTAAAGTAGAGAGAAAAGGG - Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
919142457 1:193589613-193589635 GTGTTTCAGCTGAGAGCAGAGGG + Intergenic
920385989 1:205570157-205570179 CAATTTAAGCCGAGAGAATAAGG - Intronic
920954591 1:210606607-210606629 TTGTTAAAGGAGAGAGGAGAAGG - Intronic
921916335 1:220614622-220614644 CTGATTAAGAAGAGAAAATAAGG - Intronic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922552316 1:226504890-226504912 CAGTTTAAGGAGATAGAAGTGGG + Intergenic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
923637647 1:235716887-235716909 ATGTTTAAGCAGAGAAATAAGGG - Intronic
924806765 1:247367505-247367527 CTTTGTAAGCAGAGTGAAAATGG + Intergenic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063295499 10:4801048-4801070 ATGTTTAAATTGAGAGAAGATGG + Intronic
1063876318 10:10483012-10483034 CTCTTTAAGGAGGCAGAAGAAGG - Intergenic
1064237457 10:13588647-13588669 GTGTTGAAGAAGAGAGAAGGAGG - Intronic
1064682312 10:17823051-17823073 CTGTTTAAAAAGAAAGAAGCAGG - Intronic
1067133413 10:43586778-43586800 CTGTGTTAGCAGAGACAAGAAGG - Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1071461204 10:85897912-85897934 TTATAGAAGCAGAGAGAAGAAGG - Intronic
1072423080 10:95306011-95306033 CTATTTAGGGAGTGAGAAGAAGG + Intergenic
1076843207 10:133056743-133056765 CTCTTTAGGAAAAGAGAAGATGG + Intergenic
1077866572 11:6226552-6226574 CTAATTAAGCAGAGAGCAGAGGG + Intronic
1078527596 11:12111945-12111967 TTCTTCATGCAGAGAGAAGACGG + Intronic
1079684444 11:23339956-23339978 CTGTTTCAAGAGAGAGAGGAAGG - Intergenic
1080300790 11:30782956-30782978 CATTTTAAGCAGAGAACAGAGGG + Intergenic
1080804123 11:35636318-35636340 CTCTTCCAGCAGAGAGAGGAGGG + Intergenic
1081708010 11:45197157-45197179 CTTTTTAAGCAGTAAAAAGAAGG + Intronic
1082653875 11:55828223-55828245 GTGTTGGAGTAGAGAGAAGAAGG + Intergenic
1082749119 11:56998943-56998965 CAGTTGGAGCACAGAGAAGAAGG + Intergenic
1082985265 11:59163637-59163659 CTGTTTCAGAAAATAGAAGAGGG + Intergenic
1083193977 11:61072073-61072095 ATTTTTAAAGAGAGAGAAGAGGG + Intergenic
1083474011 11:62904032-62904054 CAGTTAAAGCAGAGAGAGGCCGG - Intergenic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1088177882 11:107074385-107074407 AGGTTTAAGGAAAGAGAAGAAGG + Intergenic
1088438956 11:109846994-109847016 ATGTTTGACCAGTGAGAAGAAGG - Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088583681 11:111338792-111338814 CAGTTTCAGCAGAGATAAAAAGG + Intergenic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088644932 11:111910557-111910579 TTTTTTAAGCAGAGAAGAGAAGG - Intronic
1088928015 11:114321753-114321775 CTGATAAAGCAGAGAGAACATGG - Intergenic
1090667340 11:128923496-128923518 CTCTGTAAGGAGAGAGAAGGTGG - Intergenic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1094061659 12:26320774-26320796 ATGTTTGAGCAGAGACAAAAAGG + Intergenic
1095772027 12:45970371-45970393 CTGGTTACACAGAAAGAAGAGGG + Intronic
1095790982 12:46166807-46166829 GGGTTTAAGAAGAGAGAAGAAGG + Intergenic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1098539891 12:71642742-71642764 CTGTATAATCAGATAGAAAATGG + Intronic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1098857787 12:75672401-75672423 CTGTGCAAGGAGAGAGGAGAAGG + Intergenic
1098967881 12:76812288-76812310 CAGTTAAAGCAGAGTGATGATGG - Intronic
1099283972 12:80692017-80692039 CTGTTTAAGGAGACAGAAATGGG + Intergenic
1100620666 12:96269648-96269670 CTGATTAAGCAGACATAAAAGGG - Exonic
1101999112 12:109545623-109545645 CGGTTTGAGCAGGCAGAAGAGGG + Intergenic
1102291648 12:111705623-111705645 CTCTTGTAGCAGAGAGCAGAAGG + Intronic
1103866205 12:124053997-124054019 CTGTTCTAGCAGAGAGAGGGGGG - Intronic
1103910902 12:124351578-124351600 GTGTTCAAGCAGAGAGGAGATGG + Intronic
1104125135 12:125838900-125838922 CTGGTTCAGCAGAGAGAAAAGGG - Intergenic
1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107162395 13:37246443-37246465 TGGTTTAACCAGGGAGAAGAGGG - Intergenic
1107258777 13:38464951-38464973 CTCTTTCAGTAAAGAGAAGAAGG - Intergenic
1107568422 13:41630425-41630447 GTGTTCAAGCAGAAAGAAGAAGG - Intronic
1108214898 13:48174552-48174574 CTGTTCCAGCAGAGGGAAGTGGG - Intergenic
1109276141 13:60306392-60306414 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109918364 13:69022004-69022026 GTTTTTAAGCAGAGATAACAAGG + Intergenic
1110243962 13:73300469-73300491 CTGTTCAAGCAGTGAGACAAAGG - Intergenic
1111696007 13:91625099-91625121 CTGTTGAAGCAAAGAAAAAAGGG + Intronic
1111990730 13:95114179-95114201 CTATTTAACCAGAGAGACAAGGG - Intronic
1112341514 13:98556466-98556488 TAGTTTAAGCAAAAAGAAGAAGG - Intronic
1112623158 13:101073077-101073099 CTGTTTAAACTGAGACCAGAAGG + Intronic
1112748342 13:102553073-102553095 ATGGTCCAGCAGAGAGAAGACGG - Intergenic
1112999013 13:105610463-105610485 CTATTTAAGGTGTGAGAAGAGGG - Intergenic
1113304856 13:109066388-109066410 CAGTTTCAGCAGAAAGAAAATGG - Intronic
1113506102 13:110817069-110817091 CTGTTTAAGGAAAAAGAATAAGG + Intergenic
1114382472 14:22222169-22222191 CTGTTTAGAAAGAGAAAAGAAGG - Intergenic
1114416601 14:22549034-22549056 CAGTTGCAGCAGAGAGATGATGG + Intergenic
1114494854 14:23125721-23125743 CAGTTTAAGCAGACAGAATTCGG + Exonic
1114706860 14:24736620-24736642 CTTTTTCAGCAGAGTGAAAATGG - Intergenic
1114725573 14:24932636-24932658 GTGGTTCAGGAGAGAGAAGATGG + Intronic
1115119546 14:29924680-29924702 ATGTTTCAGGAGAGAGCAGAGGG - Intronic
1116097583 14:40390564-40390586 CTATTTAATCACAAAGAAGAAGG - Intergenic
1116153619 14:41174496-41174518 CTGTTTAAGGTGCAAGAAGAGGG - Intergenic
1116255705 14:42551768-42551790 ATGTTTAAGGAGAGAATAGATGG + Intergenic
1116630262 14:47321825-47321847 GTTATTAAGGAGAGAGAAGATGG - Intronic
1116714129 14:48406862-48406884 CTGCTGAAGCTGTGAGAAGAGGG - Intergenic
1116779837 14:49224902-49224924 CTGTGGAAGAAGAGAAAAGATGG + Intergenic
1117236846 14:53786951-53786973 ATGTTTAAGGAGAAAGAAAAAGG - Intergenic
1117886764 14:60372106-60372128 CTAGTGAAGCAGTGAGAAGAGGG + Intergenic
1119193855 14:72702616-72702638 ATGGTTCTGCAGAGAGAAGATGG - Intronic
1119836812 14:77757842-77757864 TTGTTTAAGAAAAGATAAGAAGG - Intronic
1120005260 14:79349357-79349379 CTGTGTAAGCAGAAAGCAGGAGG + Intronic
1120353341 14:83393304-83393326 TTGTTTAAAAAGAGAGAAAAGGG + Intergenic
1121940739 14:98068221-98068243 CTCTGTGAGCAGAGATAAGAGGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122750643 14:103930060-103930082 CTTTTTAAAGAGCGAGAAGAGGG - Intronic
1124836926 15:33204454-33204476 CTGTTTGAGATGAGAGAAAAGGG + Intergenic
1125214163 15:37250615-37250637 CTGAGTAAGGAGACAGAAGATGG - Intergenic
1126221996 15:46224770-46224792 CTTTTTAACCAGAGAACAGAAGG - Intergenic
1126615505 15:50575013-50575035 GTTTTTAAGCAAAGAGGAGATGG - Exonic
1127057008 15:55142395-55142417 CTGTCTATGCAGAAAGAAGCAGG + Intergenic
1127057739 15:55149817-55149839 CTGATTGAGCAGAGAGGAAAAGG + Intergenic
1127225259 15:56920106-56920128 CTGCTTAAGCAGAAAGCAGATGG - Intronic
1129267019 15:74398931-74398953 CTCATTCAGCAGTGAGAAGATGG + Intergenic
1130017442 15:80198552-80198574 CTGCTGAAGCATAGAGGAGATGG - Intergenic
1130957986 15:88640474-88640496 CTGTTAACGCAGAGTTAAGAGGG + Intronic
1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG + Intergenic
1133755333 16:8758406-8758428 TGGTCTCAGCAGAGAGAAGAGGG + Intronic
1134328276 16:13227048-13227070 CTCTTTAAGCTGAGATCAGAAGG - Intronic
1135840773 16:25874080-25874102 CTGGTAAAGCAGAGAGGACAGGG - Intronic
1135865705 16:26099916-26099938 CTGTTTGAGTAAAGAGGAGAAGG + Intronic
1136481654 16:30545799-30545821 CAGTTAAATCAGAGAGAAAAAGG + Intronic
1137387483 16:48055145-48055167 CTGTTTACGAAGAGGGAAAACGG - Intergenic
1137879625 16:52032723-52032745 CTGGTTTAGCAGACAGCAGAGGG + Intronic
1138417104 16:56877896-56877918 CTGTTCCAGCACAGAGAGGAAGG - Intronic
1138708139 16:58938873-58938895 CTTTTTAAACAGAGCGAACATGG + Intergenic
1138993920 16:62425159-62425181 TAGTTTAAGGAAAGAGAAGAGGG - Intergenic
1139017481 16:62707594-62707616 CTGTTTATGCAAAGAAAATATGG + Intergenic
1139642393 16:68301819-68301841 ATATTAAAGAAGAGAGAAGAAGG - Exonic
1140997383 16:80274386-80274408 CTTTATAAACAGAGAGAAAAGGG - Intergenic
1143057951 17:4176414-4176436 GTGTTTGAGCTGAGAGAACAAGG - Intronic
1143396120 17:6598775-6598797 CTGGTCTAGCAGAGAGAAAAAGG - Intronic
1144502584 17:15802070-15802092 TGGGTCAAGCAGAGAGAAGATGG - Intergenic
1144798307 17:17907532-17907554 CTGTGAAATCAGAGAGAAAATGG + Intronic
1145043844 17:19596820-19596842 CTGTTTAAGCTGAGACTTGAAGG + Intergenic
1145164761 17:20604724-20604746 TGGGTCAAGCAGAGAGAAGATGG - Intergenic
1145916295 17:28576004-28576026 CTCTAGAAGCTGAGAGAAGAGGG - Intronic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1147759962 17:42791155-42791177 CTGGGTAAGGAGAGAAAAGAGGG - Intronic
1148004673 17:44416957-44416979 GTATTTTAGCAGAAAGAAGAGGG + Intronic
1148238943 17:45987450-45987472 CAGTTTATGCAGTGAGAAGATGG - Intronic
1148856714 17:50582971-50582993 CTGTTCAAGGCGAGAGAAGCTGG + Intronic
1150987973 17:70220737-70220759 CTCATGAAGCAGAGAGAATAAGG - Intergenic
1151963679 17:77420236-77420258 CTGTTCAGGAAGAGAGAAGCGGG + Intronic
1155176931 18:23308701-23308723 CTGTCTGAGCAGAGACCAGAAGG - Intronic
1155937467 18:31768526-31768548 CTGTTCAAGCAAAGACAAGGTGG - Intergenic
1156734611 18:40239284-40239306 AAGTTTATGCAGAGAGAACATGG - Intergenic
1158229347 18:55236223-55236245 ATGTTTCAGCAGAGAGATGTAGG + Intronic
1158259827 18:55594201-55594223 ATGTTTAAGCTGAGACCAGAAGG - Intronic
1158564377 18:58542331-58542353 CTGTTTTTTCACAGAGAAGAAGG - Intronic
1158736701 18:60090752-60090774 CTGTTCAACCACAGAGAAGTTGG - Intergenic
1159135117 18:64328444-64328466 CTGTGTATGCATAGAGAAAATGG - Intergenic
1159319608 18:66830253-66830275 CTATTTGAGCTGTGAGAAGAGGG - Intergenic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1159802727 18:72920888-72920910 CTCTTGAACCAGAGAGATGAAGG + Intergenic
1159941708 18:74413365-74413387 ATGCCTATGCAGAGAGAAGATGG - Intergenic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1164814136 19:31181408-31181430 CCATCTGAGCAGAGAGAAGAAGG + Intergenic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1168569751 19:57456483-57456505 CTGTTTAAGATGAGAAAATATGG - Exonic
925116439 2:1382385-1382407 CTATGGAAGCAGAGAGAAGGGGG + Intronic
925225801 2:2183233-2183255 CTGTTTTAGAACAGAGAGGAGGG + Intronic
925483097 2:4298177-4298199 CAGTTTAAACAGAGATAAAATGG + Intergenic
925501085 2:4505632-4505654 CATTTTAAGCAGAAAGAAGGTGG - Intergenic
925588486 2:5487043-5487065 CTTTTTAAGCAGAGGGAAAGAGG - Intergenic
925714310 2:6770805-6770827 GTCTGTAAGCAGAGAGAATACGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926445350 2:12935147-12935169 TTGTTTAAGCAGGGATAACATGG + Intergenic
926526849 2:13991955-13991977 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
929132607 2:38593146-38593168 CTGTTTAACCATAGGAAAGACGG - Intronic
929588040 2:43128227-43128249 CAGTCTAGGTAGAGAGAAGAAGG + Intergenic
930270485 2:49250799-49250821 CGGTTTATGAAGAGAGAAGAAGG + Intergenic
930512129 2:52358737-52358759 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
930542555 2:52725027-52725049 GTGTTGAAGCAGAGAGAAGGAGG - Intergenic
930874142 2:56194542-56194564 CAGTTTTAGCAGTGACAAGAAGG + Intronic
932018060 2:68053276-68053298 CTGTATAACCAGTGAGAGGAAGG - Intronic
933804572 2:85988816-85988838 CTGTTTAAAAAGGGAGAAAAAGG + Intergenic
934621459 2:95811565-95811587 CTCTCTAAGCAGAGAGAACAGGG + Intergenic
934811984 2:97287250-97287272 CTCTCTAAGCAGAGAGAACAGGG - Intergenic
934825709 2:97420677-97420699 CTCTCTAAGCAGAGAGAACAGGG + Intergenic
935148622 2:100413864-100413886 CTGGTTAAGCAGAGTTAAGTGGG - Intronic
935159238 2:100514855-100514877 CTGCTTCAGAAGAGAAAAGAAGG + Intergenic
936157372 2:110057215-110057237 ATGTATCTGCAGAGAGAAGAAGG - Intergenic
936187320 2:110314229-110314251 ATGTATCTGCAGAGAGAAGAAGG + Intergenic
937388660 2:121462845-121462867 CTGTTTAAGCAGGGAGGGTATGG + Intronic
937702220 2:124876455-124876477 TTTTTTAAGAGGAGAGAAGAGGG + Intronic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
938195460 2:129323628-129323650 CACTGTAAGCAAAGAGAAGAGGG + Intergenic
940279819 2:151977580-151977602 TTGTTTGGACAGAGAGAAGAAGG + Intronic
941774010 2:169372218-169372240 TTGTTCAACCAGAGAGGAGAGGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942087165 2:172454341-172454363 GTTTTTAAGCAGAGACATGAAGG + Intronic
942142159 2:172988195-172988217 GTGTTTAACCAGGGGGAAGAAGG + Exonic
942593454 2:177570002-177570024 CTGTTTAAATAGAAAGAATAGGG + Intergenic
943016616 2:182518109-182518131 GTGTTTAAGCAGAGAGTAAAAGG + Intronic
945045454 2:205777514-205777536 CTGTTTAAGTTGAGAGGAGGAGG + Intronic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946799299 2:223393090-223393112 CTTTCTAAGCAGACAGAAAAAGG + Intergenic
947370850 2:229444154-229444176 ATGTTTTAGCAGAGAATAGACGG + Intronic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947546358 2:231013124-231013146 CTGGTGAAGCAGGGAGGAGAAGG - Intronic
1169030293 20:2401435-2401457 CTGTTTAAGCAGGGAAAAGGCGG - Intronic
1169254041 20:4083711-4083733 ATCTGAAAGCAGAGAGAAGAAGG - Intergenic
1169518205 20:6341375-6341397 CAGTTTAAGCAGAAACAAGTTGG + Intergenic
1170412191 20:16103896-16103918 ATGTTGAAGGATAGAGAAGAGGG + Intergenic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1170985008 20:21249648-21249670 CTTTTTAAGAAGAAAGAAAAAGG - Intergenic
1172500520 20:35423061-35423083 CTCTTGAACCTGAGAGAAGAAGG + Intergenic
1173033813 20:39389352-39389374 CTGTCTAGAGAGAGAGAAGAAGG - Intergenic
1173436115 20:43033719-43033741 CAGATGAAGCACAGAGAAGATGG + Intronic
1174056268 20:47800483-47800505 GTGTTCCAGCAGAGAGAAGGAGG + Intergenic
1175028289 20:55926637-55926659 CTCTTTAAGCAGAGTGACAAAGG + Intergenic
1175432468 20:58915661-58915683 CTGTCTAAAAAGACAGAAGAAGG - Intergenic
1175749965 20:61489252-61489274 CTGTTTGAGCAGATAGAACCAGG + Intronic
1176361541 21:6000794-6000816 CTGTCTCAGCAGTGAGCAGATGG + Intergenic
1176886923 21:14267836-14267858 CTGTCTCAGCATAGAGAGGAAGG - Intergenic
1179049108 21:37873689-37873711 AGGTTTAAGAAGAGAGAACAGGG - Intronic
1179761977 21:43537756-43537778 CTGTCTCAGCAGTGAGCAGATGG - Intronic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1183000817 22:34857168-34857190 CTGTTTACACAGAGAGAAGTAGG + Intergenic
1185199688 22:49494092-49494114 CAGTTGGAGCAGAGAGCAGAGGG + Intronic
949380796 3:3443650-3443672 TTGCTTGAGCAGAGAGCAGAGGG + Intergenic
949464355 3:4329114-4329136 CTGTTAAAGCAGCCAGGAGAAGG - Intronic
949506216 3:4730514-4730536 CTGTTGAAGGAGAGACAAAATGG + Intronic
950913257 3:16616719-16616741 CTGTGTAAGCAGCCAGGAGAGGG + Intronic
952206159 3:31182702-31182724 TGGTTTCAGCAGAGAGAACAAGG + Intergenic
952220561 3:31319972-31319994 CTGTTTAATCAGAGATGAGAGGG - Intergenic
953140054 3:40221230-40221252 CTATTGAAGCACAGAGAAAATGG + Intronic
953858348 3:46519532-46519554 CTGTGAAGGGAGAGAGAAGAGGG - Intronic
956315617 3:67932824-67932846 CTGTTTCAGAAAATAGAAGAGGG + Intergenic
956777126 3:72574666-72574688 ATCTATAAACAGAGAGAAGAGGG + Intergenic
958002906 3:87773756-87773778 TTGTATAAGGTGAGAGAAGAGGG + Intergenic
958040044 3:88216381-88216403 ATGTTTCAGCAGAGTCAAGATGG - Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959872245 3:111341574-111341596 CTATTAAAGCTGTGAGAAGAGGG + Intronic
960401203 3:117201253-117201275 CTGTTATTGCAGAGAGCAGAAGG + Intergenic
961196674 3:125007813-125007835 CAGTTTAAGAATAGAGAAGCTGG - Intronic
963335441 3:143970045-143970067 CTGATTAAGCTGAGAGAACCGGG - Intergenic
963497009 3:146077563-146077585 CTTTTTAAAGGGAGAGAAGAGGG - Intronic
965395069 3:168152980-168153002 CTATTGAAGCTGTGAGAAGAGGG + Intergenic
965957575 3:174389466-174389488 CTATTTGAGCTGTGAGAAGAGGG - Intergenic
966244325 3:177789799-177789821 CTATAAAAGCAGAGAGGAGAGGG + Intergenic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
969035991 4:4254410-4254432 CTATTTAAGCAGCGAGATGGAGG + Intergenic
969125552 4:4945336-4945358 CTTTTTCAGCAGTGTGAAGATGG - Intergenic
969140816 4:5070052-5070074 CTGTTTATTCAGCCAGAAGAAGG + Intronic
969723244 4:8904915-8904937 CTGTCCAGGCTGAGAGAAGAAGG - Intergenic
970363901 4:15338637-15338659 CTGTGAATGCAGAGAAAAGATGG - Intergenic
970820446 4:20205631-20205653 CAGTTAAAACAGAGAAAAGAGGG + Intergenic
970883935 4:20965013-20965035 CTATTTAACCAAAGAGAAGATGG + Intronic
971306301 4:25485038-25485060 CTGTTAAAGCAGACTAAAGATGG + Intergenic
971948714 4:33315540-33315562 CTGGTGAAGCTGTGAGAAGAGGG + Intergenic
972399400 4:38686690-38686712 TTGTATAAGCAGGGACAAGAAGG + Intronic
972946102 4:44257705-44257727 CTCTCTAAGCAGAGAGCAGCTGG - Intronic
974160723 4:58134375-58134397 CTGTTTAGGCACAGAGCTGAGGG + Intergenic
975343241 4:73264462-73264484 ATGTTTAAGCAGAGAGGACCAGG + Intergenic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977218999 4:94316673-94316695 CATTCTAAGCAGAGAGAAAATGG - Intronic
977368296 4:96101584-96101606 CTAGTGAAGCAGTGAGAAGAGGG + Intergenic
979754138 4:124318587-124318609 CTGTATATGCAGTGAGAAAAGGG - Intergenic
979986536 4:127323154-127323176 CTCTTTAAGGGAAGAGAAGAAGG + Intergenic
980062534 4:128147315-128147337 CTGTCTTAGCAGTGAGAAAAAGG - Intronic
980523994 4:133965789-133965811 TTGTTTAAGGTGAGAGATGAAGG - Intergenic
980641921 4:135591623-135591645 CTATGCAAGCAGAGAGAAAATGG + Intergenic
981343367 4:143647868-143647890 CTGATTAAACGGTGAGAAGAAGG + Intronic
982806615 4:159773299-159773321 GTTTTTAATCAGAGAGAAAAAGG - Intergenic
984373943 4:178902471-178902493 CTATTTAAGAAGAGAGGACAGGG + Intergenic
984884311 4:184436648-184436670 CTGTCTAGGCAGGGAGAAGGTGG + Intronic
988045965 5:25953509-25953531 TTACCTAAGCAGAGAGAAGAAGG - Intergenic
988189859 5:27915929-27915951 CTTTTCAAACAGAGAAAAGAGGG - Intergenic
989049466 5:37305202-37305224 CTGTTTAATCTGAAAGAAAATGG + Exonic
989966906 5:50475404-50475426 CTGGTGAAGCTGTGAGAAGAAGG + Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
990601195 5:57360200-57360222 CTGTTATAGCAAAGAGAGGATGG + Intergenic
991121831 5:63025078-63025100 TTATTTAACCAGAAAGAAGAAGG - Intergenic
993060331 5:83030586-83030608 CTATTTAAGCAGTGAGAGGCAGG - Intergenic
993379849 5:87194018-87194040 CTGTTTAAGCAGCAAGCACAGGG - Intergenic
993822734 5:92640042-92640064 CTGTTTAATCAGGGATAAGCAGG + Intergenic
994370566 5:98962744-98962766 CTGTTGAAGCTCAGAGATGAGGG + Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
994840628 5:104920799-104920821 TTGTTTTAGCAGAGTGGAGAGGG - Intergenic
995320742 5:110830852-110830874 CTCCATCAGCAGAGAGAAGAGGG - Intergenic
995965120 5:117896689-117896711 CTCTTTCAGAAGAGAGAAGCAGG + Intergenic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
998989789 5:147802944-147802966 CTGATTCAGCAGAGCAAAGAAGG + Intergenic
999776847 5:154818772-154818794 CTCTTTAAGCATATTGAAGATGG + Exonic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1002496707 5:179619191-179619213 TCTTTTAAGCAGAGAGAATATGG + Intronic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1003012736 6:2441191-2441213 CTTTTAAATCATAGAGAAGATGG + Intergenic
1003504488 6:6728451-6728473 ATGTTGAAGCAGAGAATAGAAGG + Intergenic
1003595531 6:7470940-7470962 TTGTTTCAGTAGAGAGATGAGGG - Intergenic
1003596259 6:7476808-7476830 TTGTTTCAGTAGAGAGATGAGGG + Intergenic
1004002672 6:11609713-11609735 CTTAGTAAGCAGAGAAAAGAAGG - Intergenic
1005286553 6:24333913-24333935 ATGATTAAGCAGTGAGAATAAGG + Intronic
1006150433 6:31984050-31984072 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006156734 6:32016788-32016810 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1007333517 6:41134174-41134196 CTGTTTAGGAAGAGAGATAAAGG + Intergenic
1007659111 6:43471565-43471587 CTGATTCAGCAAAGAGATGAGGG + Intergenic
1007701841 6:43770369-43770391 ATGTTTAAGAAAAAAGAAGAGGG - Exonic
1008838713 6:55870348-55870370 TTGTTGAAGAAGAGAGAAAAAGG + Intronic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009298744 6:61988237-61988259 CTGTTTAATCAAGGAAAAGAAGG + Intronic
1009597970 6:65760782-65760804 CTGTTAACTGAGAGAGAAGAAGG - Intergenic
1010594554 6:77748155-77748177 CTAGTGAAGCTGAGAGAAGAGGG - Intronic
1010790765 6:80062482-80062504 CTTATGAAGCATAGAGAAGACGG - Intergenic
1012020325 6:93909743-93909765 CATTTTAAGAAGAGACAAGATGG - Intergenic
1012950219 6:105510224-105510246 GGGTTTATGCAGAAAGAAGAGGG + Intergenic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013798667 6:113914350-113914372 ATGTTTAAGAAGATAGAAAATGG - Intergenic
1014469015 6:121792026-121792048 TTTTTAAAGCATAGAGAAGAAGG - Intergenic
1014883034 6:126746404-126746426 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1015069592 6:129075543-129075565 CTTTTTTAGCAAAGAGATGATGG + Intronic
1015468642 6:133576976-133576998 CAGCTTAGGCAGAGAGAAGCTGG - Intergenic
1016080959 6:139855425-139855447 CTGTTTAAGCAATGAGAAGATGG - Intergenic
1016708121 6:147137687-147137709 CTGTTTGAACAGAGAGTAAATGG + Intergenic
1017860521 6:158393370-158393392 CTGGTGAAGCTGTGAGAAGAGGG - Intronic
1019050597 6:169180127-169180149 CTGGTGGAGCAGTGAGAAGAGGG - Intergenic
1019924723 7:4184629-4184651 CTGTTTAAACTCAGAGAGGAAGG + Intronic
1020743057 7:12046493-12046515 CTGGTTTCGCAGAGAGATGAAGG - Intergenic
1020908725 7:14101056-14101078 GTGTTTAGGCAGAGACAACAGGG - Intergenic
1021402385 7:20224198-20224220 CTGTTGGAGCAGAGAGCAGCAGG + Intergenic
1021522428 7:21551195-21551217 CTAGTTTACCAGAGAGAAGAAGG - Intronic
1023949432 7:44830586-44830608 GCACTTAAGCAGAGAGAAGAAGG - Intronic
1024782474 7:52867005-52867027 CTGTTTAAGGAGATTGAAGATGG - Intergenic
1024813287 7:53238222-53238244 CTTTTTAAGCACAGAGACCAGGG - Intergenic
1024845481 7:53636880-53636902 CTAATGGAGCAGAGAGAAGAAGG + Intergenic
1024963089 7:54997774-54997796 CTGTTTAAGCAAAGAAAAGAGGG - Intergenic
1025814492 7:64898745-64898767 CTCTGTAAGCAGGCAGAAGAAGG + Intronic
1025817997 7:64936392-64936414 CTCTGTAAGCAGGCAGAAGAAGG - Intergenic
1026738077 7:72961410-72961432 CTGCTTCAGCTCAGAGAAGAGGG + Exonic
1026797458 7:73375626-73375648 CTGAATCAGCAGAGAGGAGAAGG + Intergenic
1027105657 7:75403658-75403680 CTGCTTCAGCTCAGAGAAGAGGG - Exonic
1027789110 7:82616381-82616403 CTAGTAAAGCAGTGAGAAGAGGG - Intergenic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1028859841 7:95636775-95636797 CTGTCTAGGCAGAGAGACAAAGG - Intergenic
1028874226 7:95802405-95802427 CAGTTGAATCAGAGAGAAGTTGG + Intronic
1029172425 7:98640458-98640480 AAGTTTCCGCAGAGAGAAGACGG - Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1029944668 7:104519518-104519540 CAGTTTAGGGAGGGAGAAGAAGG + Intronic
1030557310 7:111042597-111042619 CTGGTTAGGCAAAGAGAAGCAGG + Intronic
1031608266 7:123794843-123794865 CTGGTGAAGCTGTGAGAAGAGGG + Intergenic
1032155173 7:129462130-129462152 TGGTTTGAGGAGAGAGAAGATGG + Intronic
1032689177 7:134265677-134265699 CTGTCCCAGCAGAGAGAAGGAGG - Intergenic
1032696700 7:134342951-134342973 TTGATTAAGAAGAAAGAAGAAGG - Intergenic
1033031563 7:137832203-137832225 CTATTGAAGCTGTGAGAAGAGGG - Intronic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1036187755 8:6639070-6639092 ATCTTTAAACAGAGACAAGATGG - Intronic
1037566067 8:20119462-20119484 CTGGTTATGCAGGGAGCAGATGG - Intergenic
1038873784 8:31525395-31525417 CTATGTAAGCAGTGAGGAGATGG - Intergenic
1038956279 8:32471971-32471993 ATATTTAAACAGGGAGAAGAGGG + Intronic
1039379834 8:37074716-37074738 ATGATTGAGCAGAGAGAGGAAGG - Intergenic
1039507938 8:38065625-38065647 CTGTTTAAGAAAAAAGAAAAAGG + Intergenic
1041168627 8:55117211-55117233 CTTTTTGAGGAGTGAGAAGAGGG + Intronic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044787502 8:95809996-95810018 CTGTGAAAGAAGAGAGAAAAGGG - Intergenic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1045064748 8:98435299-98435321 CTGCATAGGCAGAGAGAAGGAGG + Intronic
1046209811 8:111055861-111055883 CAGTTAAAGCAGTGATAAGAAGG - Intergenic
1047192054 8:122687139-122687161 GCGTTTAAGTAGAGGGAAGAAGG - Intergenic
1047336100 8:123938122-123938144 CTTTTCAAGGACAGAGAAGAAGG + Intronic
1047515867 8:125554483-125554505 CTTTCTAAGCAGAGAGAAAGAGG + Intergenic
1047530575 8:125670497-125670519 CTGCATAGGCAGTGAGAAGATGG + Intergenic
1047547483 8:125833166-125833188 CTGCTTACGCAGAGTAAAGAGGG - Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047795530 8:128251416-128251438 CTATTTAAGGAGAAAGCAGAAGG - Intergenic
1047924877 8:129672893-129672915 CTGAGAAAGCAGAGAGAACAAGG - Intergenic
1047948138 8:129903351-129903373 CTGTTTAAGGAAAGAAAAAAAGG + Intronic
1048256110 8:132906471-132906493 CTGTTAAAACTGAGAGCAGATGG + Intronic
1050081214 9:1917739-1917761 CTCTTTATGCAGTGACAAGATGG - Intergenic
1051596338 9:18827658-18827680 CTGTGTTAGCAGAGACAATAAGG - Intronic
1051874685 9:21778996-21779018 CTGTAGAAGCTGAGAGCAGAAGG - Intergenic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1053486143 9:38457870-38457892 CTGTTTCAGCAGAGTGATGAGGG + Intergenic
1055270334 9:74550649-74550671 CTGTATAAGAAAAGAGAAAATGG - Intronic
1055737463 9:79347010-79347032 CTGATTAAAGAGGGAGAAGATGG - Intergenic
1056277094 9:85003970-85003992 CTATTTAAGGAGAAAGAAGAAGG + Intronic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1057116605 9:92528970-92528992 ATGTTCAAGAAGTGAGAAGAAGG + Intronic
1058839868 9:108895662-108895684 TATTTTAAGCAGAGAGATGAAGG + Intronic
1059267096 9:113044829-113044851 CTGTTTACGTAGAGAAAATATGG - Intronic
1060089027 9:120726847-120726869 CGTTTTAAGCAGGGAGATGAGGG + Intergenic
1060136659 9:121162930-121162952 CTTTTTCAGTAGAGAAAAGATGG + Intronic
1061536625 9:131254320-131254342 CTTTTCAATCAGACAGAAGAAGG - Intergenic
1062552598 9:137096725-137096747 CTGGTCGAGCAGAGAGCAGAGGG + Intronic
1186248468 X:7640212-7640234 CTGTGTATGAAGAGAGTAGAGGG + Intergenic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1186541689 X:10407757-10407779 CTGTTTATTCAGAGAGAGAACGG - Intergenic
1186548838 X:10480868-10480890 CTCTTTAAGAAGAGTGAAAATGG + Intronic
1187002061 X:15192101-15192123 CTGAGTTAGCAGAGAAAAGAAGG + Intergenic
1187322566 X:18253278-18253300 TTTTTTAAGCAGAAAGAAGGAGG - Intronic
1187348342 X:18488505-18488527 CTGGTCAACCAGAAAGAAGAAGG + Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1187966264 X:24615322-24615344 CAGTTTAAGCAGTAATAAGATGG - Intronic
1189289757 X:39876822-39876844 CTGTTGATGCAGAGAGAAGCAGG + Intergenic
1190155000 X:47983187-47983209 CTTTTTCAGGAGAGAAAAGAGGG + Intronic
1190550025 X:51570417-51570439 CTGTTAGAGCAGAGGAAAGATGG + Intergenic
1191760925 X:64647336-64647358 CTGTTGGAGCAGTGAGGAGAGGG + Intergenic
1192537935 X:71944454-71944476 TTGTTTGGGCACAGAGAAGATGG - Intergenic
1192699663 X:73454981-73455003 ATCTTTAAGGAGTGAGAAGAAGG + Exonic
1193803642 X:85968430-85968452 CTCTTAAAGCAAAGAGAAAAAGG - Intronic
1196805676 X:119583402-119583424 ATGTTTAAGGAGAGGGTAGAAGG - Exonic
1197313593 X:124936374-124936396 ATCTTTAAGCTGAGATAAGAAGG - Intronic
1197324167 X:125070975-125070997 CTCTTCAAACAGAAAGAAGATGG + Intergenic
1199401184 X:147400739-147400761 GTGCTTAAGCAGAGAAAAGATGG - Intergenic
1199412068 X:147535742-147535764 ATGTTTAAGGAGAGAGTAGGGGG - Intergenic
1199928458 X:152494251-152494273 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
1200373276 X:155750718-155750740 AGGTTTAAGGAGAGAGCAGATGG + Intergenic
1200704304 Y:6428592-6428614 CTGCCTAAGCAGAGAAAAAATGG + Intergenic
1201029807 Y:9736116-9736138 CTGCCTAAGCAGAGAAAAAATGG - Intergenic
1201453312 Y:14140449-14140471 ATGTTTATGCAGACATAAGAAGG + Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic