ID: 1146050311

View in Genome Browser
Species Human (GRCh38)
Location 17:29545815-29545837
Sequence AGTGAACACCAACACTGGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146050311_1146050314 10 Left 1146050311 17:29545815-29545837 CCTTCCCAGTGTTGGTGTTCACT 0: 1
1: 1
2: 1
3: 16
4: 151
Right 1146050314 17:29545848-29545870 CTTTAAGAAAATTAAAACTATGG 0: 1
1: 0
2: 4
3: 101
4: 943

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146050311 Original CRISPR AGTGAACACCAACACTGGGA AGG (reversed) Exonic
901136797 1:7002499-7002521 CGTGAATAACAACACTGAGAAGG - Intronic
902332714 1:15738416-15738438 AGTGAACCCCAAAGCTGAGAAGG + Intronic
903995230 1:27301217-27301239 AGTGGTCACCATCCCTGGGAAGG - Exonic
904035086 1:27554628-27554650 AATGGACCCCAACACTGTGAGGG + Intronic
910252613 1:85213525-85213547 AGTCATCAGCAACACTGTGATGG + Intergenic
914257647 1:145973769-145973791 AGTGAAGTCCTGCACTGGGAGGG + Intronic
922763404 1:228145896-228145918 AGTGAAGCACACCACTGGGAAGG - Intronic
922821477 1:228488119-228488141 AGGGGACACCAAGACGGGGAAGG - Intronic
1064378125 10:14815390-14815412 AGTGAAACCCACCACTAGGATGG + Intergenic
1067684555 10:48458745-48458767 ACTGAGCGTCAACACTGGGATGG + Intronic
1069596594 10:69675962-69675984 GGTGCCCACCCACACTGGGAAGG + Intergenic
1073205557 10:101767542-101767564 AGCCAGCACCAACTCTGGGACGG + Intergenic
1076660676 10:132054203-132054225 AGTTTACACAGACACTGGGAAGG - Intergenic
1078038992 11:7839896-7839918 AGGGAACACAGTCACTGGGATGG + Intergenic
1078414419 11:11153672-11153694 AGTGTATACCAACTCAGGGAAGG + Intergenic
1080324320 11:31052171-31052193 AATGAACACCAAAAGTGAGAAGG + Intronic
1084773351 11:71358397-71358419 AGTGATGTCCAGCACTGGGATGG + Intergenic
1085147206 11:74212252-74212274 AGTGGAAAGCAACACTGGGCAGG + Intronic
1086270254 11:85054614-85054636 AGTGCTCACCAACAGTGGGTTGG + Intronic
1087010362 11:93508237-93508259 ACTGGTCTCCAACACTGGGATGG + Intronic
1087313273 11:96576558-96576580 TGTGGCCACCATCACTGGGACGG + Intergenic
1087903691 11:103671265-103671287 AGTCAACACCTGCTCTGGGAAGG + Intergenic
1088223900 11:107598390-107598412 AATGCCCACCCACACTGGGAAGG + Intronic
1090534505 11:127625869-127625891 AGTGAAGCCCAACACTAGCAGGG - Intergenic
1090544260 11:127745879-127745901 TGTGAACACAGACACAGGGAAGG + Intergenic
1090676792 11:129006640-129006662 TGTGGCCACCACCACTGGGACGG + Intronic
1091020968 11:132099615-132099637 AGGGAACAGAACCACTGGGAGGG - Intronic
1092956733 12:13558046-13558068 AGTGAATAGTCACACTGGGATGG - Exonic
1097461686 12:59871248-59871270 AGTAAAACCCAGCACTGGGAAGG + Intergenic
1097686543 12:62696389-62696411 ATTGAAAACCAACACTGGCGGGG - Intronic
1099374489 12:81882236-81882258 TGTGAACACAGACACAGGGAGGG - Intergenic
1099985820 12:89662737-89662759 AGTCAACACAGACACAGGGATGG - Intronic
1100713859 12:97285381-97285403 AGTGAACACCAACAATGGGATGG - Intergenic
1101957506 12:109223937-109223959 AGTGAACACTAGAACTGGCATGG - Intronic
1102577804 12:113867491-113867513 AGTGTGCACCAACCCTGGGTTGG - Intronic
1102894233 12:116585857-116585879 ATTGAACTCCAAAACTGGGCTGG + Intergenic
1106379820 13:29225196-29225218 AGAGAACACAAAGACAGGGAAGG - Intronic
1106406688 13:29480725-29480747 AAGGAACACTAATACTGGGAGGG - Intronic
1112635456 13:101212753-101212775 AGTAAAGGCAAACACTGGGATGG + Intronic
1113204395 13:107898429-107898451 GGTGCCCACCCACACTGGGAAGG + Intergenic
1114403426 14:22431370-22431392 AGGCAAGACCATCACTGGGAGGG + Intergenic
1114976406 14:28106039-28106061 AATGAACTCCAACTCTGTGAGGG - Intergenic
1115431126 14:33320024-33320046 ATTGACCAGGAACACTGGGAAGG - Intronic
1116182627 14:41554504-41554526 AGTGAAAACCAACTCTGAAAAGG - Intergenic
1119280708 14:73405130-73405152 AGTTAACTATAACACTGGGATGG + Intronic
1125667051 15:41439465-41439487 AGTTAACACCATCACTCGGAGGG - Intronic
1131523496 15:93134622-93134644 AGGGAATACGAACAATGGGATGG - Intergenic
1135425903 16:22335758-22335780 AGTAAACCCCAGCACTGGGCTGG + Intergenic
1138593311 16:58015224-58015246 ACTAAACACCACAACTGGGATGG - Intronic
1139793059 16:69456259-69456281 GGTGAATCCCAACACTGGGAAGG - Intronic
1140319022 16:73929801-73929823 ATTGAACACAAATACTGGGAAGG + Intergenic
1141485190 16:84334168-84334190 AGTGAACACCAGCAATGGCCTGG + Intergenic
1144437067 17:15251627-15251649 AGTGGCCCCCAACACTGGCAGGG - Intronic
1146050311 17:29545815-29545837 AGTGAACACCAACACTGGGAAGG - Exonic
1146313749 17:31791195-31791217 AGTGGAAAGCTACACTGGGATGG - Intergenic
1148620598 17:49031908-49031930 AGTGAACACCGAGAGTGAGACGG + Exonic
1152185567 17:78854653-78854675 AGGGAACACTAAGCCTGGGAGGG + Exonic
1157065832 18:44349575-44349597 TGAGAACATCAACACAGGGAGGG - Intergenic
1158481170 18:57823314-57823336 TGTGGCCACCACCACTGGGACGG + Intergenic
1162958701 19:14113816-14113838 GCTGGACCCCAACACTGGGATGG + Intronic
1162958708 19:14113856-14113878 GCTGAACCCCAACACTGGGATGG + Intronic
1166549799 19:43657636-43657658 AGTGACCACCCAGAGTGGGATGG - Intronic
1168695469 19:58401558-58401580 AGTGAGCACCAGCACTCCGATGG + Intronic
926747481 2:16170904-16170926 AGTGAACACAAGGACTTGGATGG + Intergenic
927515514 2:23669642-23669664 CGTGAACACAAACGCTGAGAAGG - Intronic
928707958 2:33971830-33971852 TGTGAACACCAAGACTTGGGTGG - Intergenic
929567217 2:42996759-42996781 AGGGAGCACCCACACTGGGGTGG + Intergenic
934922090 2:98352675-98352697 AGTGGCCACCAACACTGGGGAGG - Intronic
936066384 2:109335548-109335570 AGGGGACATGAACACTGGGATGG - Intronic
936071300 2:109373406-109373428 AGTGTCCATCAACAGTGGGATGG + Intronic
937374870 2:121329300-121329322 AGTGGACATCATCATTGGGAGGG + Intergenic
940795503 2:158072562-158072584 TGTGGCCACCACCACTGGGACGG - Intronic
943933682 2:193886590-193886612 TGTGGCCACCACCACTGGGACGG - Intergenic
944843625 2:203646781-203646803 AGTGAACACCAGCACGAAGAAGG - Intergenic
945782432 2:214192181-214192203 TATGAACACCATCACTGGAAAGG - Intronic
948257818 2:236580752-236580774 ACTGACCACCCAGACTGGGATGG - Exonic
1169432473 20:5550628-5550650 ACTGAGCAACAACACTGGAATGG + Intronic
1170336743 20:15278463-15278485 AGTGAAAAGCAGGACTGGGAGGG - Intronic
1171196118 20:23200906-23200928 ACACAACATCAACACTGGGATGG + Intergenic
1174412052 20:50342669-50342691 AGTGAACACCTACAATGCCAGGG - Intergenic
1175506759 20:59491658-59491680 AGTCACCAACAACACTGGGATGG + Intergenic
1175683454 20:61008685-61008707 AGAGGAGACCAGCACTGGGAGGG - Intergenic
1177651601 21:23966601-23966623 AATGACCCCCAACCCTGGGATGG - Intergenic
1177856243 21:26403800-26403822 CCTGATCAGCAACACTGGGAAGG + Intergenic
1178451507 21:32705688-32705710 AGTGAACACCAACAGGGGCCTGG + Intronic
1179356976 21:40669076-40669098 AGTGACCACCGACTCTGTGAAGG - Intronic
1181545343 22:23599271-23599293 TGTGAACACGCACACTGGGCTGG - Intergenic
1185368590 22:50448103-50448125 AGTATACACCACCACTGGGAGGG - Intronic
950901373 3:16500839-16500861 AGGAAACACTAAAACTGGGAAGG + Intronic
951829205 3:26905429-26905451 AAAGCACACCAGCACTGGGAGGG - Intergenic
952110236 3:30114584-30114606 AGTGAACAACACCAGTGGAAAGG - Intergenic
952318861 3:32257256-32257278 AGTGAGCCACAACACTGGAAAGG + Intronic
959920236 3:111860589-111860611 AGGAAACCCCAACCCTGGGAGGG - Intronic
961917380 3:130391426-130391448 AGGGAACACCTACACTGCCAAGG + Exonic
961947370 3:130706403-130706425 AGTGAACATGAAAAATGGGATGG + Intronic
963930918 3:151003648-151003670 AGTGAACACCAAACCTGGGATGG + Intergenic
964834063 3:160917816-160917838 AGGGTACACCAACAATGTGATGG + Intronic
969726689 4:8922361-8922383 AGTGGAGCCCAAGACTGGGAGGG + Intergenic
970003576 4:11388444-11388466 GGTGAAGACCAACATAGGGATGG + Intergenic
970549101 4:17161737-17161759 AGTGAACACCAAAAGTGAGCAGG - Intergenic
971843447 4:31886918-31886940 AGTGAACACCAACATAGATAAGG + Intergenic
972588529 4:40461566-40461588 TGTGAAAACCAAAACAGGGATGG + Intronic
974372139 4:61031342-61031364 AGTGAAAAAAAACACTGGAAAGG - Intergenic
977297714 4:95229314-95229336 AGAACACACCAACACAGGGAGGG - Intronic
977743912 4:100522277-100522299 AATGAACATCAACAGTGGGAGGG + Intronic
981016310 4:139977973-139977995 AGTGAACACCAAAGCTGAAAGGG + Intronic
981422682 4:144569627-144569649 AGAGAGCAACAACCCTGGGAAGG + Intergenic
983345137 4:166519898-166519920 AGTGAAAAGCATCAGTGGGAAGG + Intergenic
985238537 4:187903158-187903180 TGTAAACTCCAACACTGGGTGGG - Intergenic
986668211 5:10121204-10121226 AGTGAACCCCAACGCAGGGGAGG - Intergenic
987029191 5:13960299-13960321 AGTGAACCCCAACACTGGAGGGG + Intergenic
989347211 5:40442471-40442493 AGTGAGCAGCACCACAGGGAAGG - Intergenic
990703649 5:58502625-58502647 AGTGAACACCCATAGTGGGATGG + Intergenic
990828032 5:59923441-59923463 TGTGGCCACCACCACTGGGATGG - Intronic
990950211 5:61291231-61291253 AGTGAACCCCAGCACTTGGATGG - Intergenic
991523224 5:67524945-67524967 AGTGAACACAAACAAATGGAAGG - Intergenic
994013597 5:94938309-94938331 AGTGCATAACAACACTGGGGTGG - Intronic
996195846 5:120605992-120606014 AGTGCACACCAACAGAGGCAGGG + Intronic
1000127102 5:158256317-158256339 CATGAACACCCACATTGGGAAGG + Intergenic
1002339809 5:178508341-178508363 AGCACACACCAACACTGAGATGG - Intronic
1003860975 6:10321521-10321543 AGTGCACACAAACACGGGGCAGG + Intergenic
1008846136 6:55966463-55966485 CGTGGAAACCAAGACTGGGATGG - Intergenic
1008959713 6:57254041-57254063 AGTGAACATCATCATTTGGAGGG + Intergenic
1013193081 6:107820357-107820379 AGTGACCAGCCGCACTGGGAGGG + Intronic
1015190081 6:130462943-130462965 AGGGAACGACAACACAGGGATGG - Intergenic
1016871796 6:148825182-148825204 AGTGGACACCAAAAGTGGGAGGG + Intronic
1018102515 6:160453820-160453842 AGGAAACACCAACACAGGAAGGG - Intergenic
1018839347 6:167507492-167507514 AGTGACCACCAACTCGGGGTGGG - Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1022793917 7:33716933-33716955 ACTGAACAAAAATACTGGGAAGG - Intergenic
1024093575 7:45967328-45967350 AGAGAGCACCCACAGTGGGAGGG - Intergenic
1026877996 7:73890673-73890695 AGTGAGCGCCAGGACTGGGAAGG - Intergenic
1028637074 7:93001154-93001176 ATAGAACACCAACACTGACATGG - Intergenic
1029570717 7:101366995-101367017 AGTTAACTACACCACTGGGAAGG - Intronic
1030515965 7:110538169-110538191 AGTGAAAAACCACGCTGGGAAGG - Intergenic
1031098584 7:117449482-117449504 TGTGGCCACCACCACTGGGACGG - Intergenic
1033041881 7:137926692-137926714 GGTGAACACCAACACCAAGAAGG + Intronic
1033358984 7:140624425-140624447 CCTCAACACCAACACAGGGAGGG + Intronic
1034312131 7:150098021-150098043 AGTGAAAACCATCACTTGGTGGG - Intergenic
1034352901 7:150428856-150428878 AGTGAACACAAACAGCAGGAGGG - Intergenic
1034794724 7:154002637-154002659 AGTGAAAACCATCACTTGGTGGG + Intronic
1036346056 8:7964101-7964123 AGAGAACACAGACACAGGGAGGG - Intergenic
1036863188 8:12371106-12371128 AGAGAACACAGACACAGGGAGGG - Intergenic
1039083092 8:33753492-33753514 AATGAACACCAAAAGTGAGAGGG - Intergenic
1039855226 8:41406389-41406411 AGTGAACACCAACAATAAGCTGG + Intergenic
1039924739 8:41919213-41919235 GGTAAACACCACCACAGGGATGG - Intergenic
1040442630 8:47460482-47460504 AATGAACACCAAAACTGAGCAGG - Intronic
1041901977 8:62992557-62992579 AGGGAACACTAACACTTGGAGGG - Intronic
1046362277 8:113176730-113176752 GGGGAACAACAACACTGGGAGGG + Intronic
1047262984 8:123278902-123278924 CATGGACATCAACACTGGGAAGG + Intergenic
1048312939 8:133339862-133339884 GGTGACCACCCACACTGGGGAGG - Intergenic
1049283588 8:141762803-141762825 AGTGATGACCAACACTGTCAGGG + Intergenic
1049325279 8:142018273-142018295 AGTGAGCCCCAACAGTAGGATGG - Intergenic
1049790385 8:144469722-144469744 GGTGGACACCCAGACTGGGAAGG - Intronic
1050277672 9:4016868-4016890 AGTGAACACAAACACTTAAACGG + Intronic
1051455051 9:17246459-17246481 TGTGACCACCAACATTGGAAAGG + Intronic
1052486572 9:29108786-29108808 AGTGGGCACCAACACTGTGTTGG + Intergenic
1056891163 9:90494232-90494254 TGGGAACACCGGCACTGGGAGGG + Intergenic
1057805130 9:98214704-98214726 AGTGAAGACCCACCCAGGGAGGG - Intronic
1058782122 9:108348432-108348454 AGTGGAAACCAGCTCTGGGAAGG + Intergenic
1060325614 9:122611490-122611512 AGAGAAGACCAGCACAGGGAAGG + Intergenic
1060476471 9:123990663-123990685 TGTGAACTTCAACGCTGGGAAGG + Intergenic
1194129672 X:90065895-90065917 AGTGAACAAAAACTCAGGGAAGG - Intergenic
1194479273 X:94400621-94400643 AGTGATCAACACCACTGGGATGG + Intergenic
1194523628 X:94948591-94948613 AGAGAACATCGACACAGGGAAGG + Intergenic
1195981560 X:110583682-110583704 TGTGAACACCCACCCTAGGAGGG + Intergenic
1197623506 X:128778842-128778864 AGTGAACACCAACAGTGGCCTGG - Intergenic
1199776503 X:151016337-151016359 TATGAACAACATCACTGGGAGGG - Intergenic
1201550021 Y:15209807-15209829 AGTGAAGCAAAACACTGGGACGG - Intergenic
1201721341 Y:17100919-17100941 AGGGACCACCATCCCTGGGATGG + Intergenic