ID: 1146051789

View in Genome Browser
Species Human (GRCh38)
Location 17:29560007-29560029
Sequence CCCATTACTACTTGAAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146051789_1146051796 27 Left 1146051789 17:29560007-29560029 CCTAGTCTTCAAGTAGTAATGGG No data
Right 1146051796 17:29560057-29560079 CAGTGGGTGCATCTGGCACAAGG No data
1146051789_1146051793 10 Left 1146051789 17:29560007-29560029 CCTAGTCTTCAAGTAGTAATGGG No data
Right 1146051793 17:29560040-29560062 AATGTTCTTGGGATATGCAGTGG No data
1146051789_1146051795 20 Left 1146051789 17:29560007-29560029 CCTAGTCTTCAAGTAGTAATGGG No data
Right 1146051795 17:29560050-29560072 GGATATGCAGTGGGTGCATCTGG No data
1146051789_1146051792 -1 Left 1146051789 17:29560007-29560029 CCTAGTCTTCAAGTAGTAATGGG No data
Right 1146051792 17:29560029-29560051 GAAAATCAGAGAATGTTCTTGGG No data
1146051789_1146051797 28 Left 1146051789 17:29560007-29560029 CCTAGTCTTCAAGTAGTAATGGG No data
Right 1146051797 17:29560058-29560080 AGTGGGTGCATCTGGCACAAGGG No data
1146051789_1146051791 -2 Left 1146051789 17:29560007-29560029 CCTAGTCTTCAAGTAGTAATGGG No data
Right 1146051791 17:29560028-29560050 GGAAAATCAGAGAATGTTCTTGG No data
1146051789_1146051794 11 Left 1146051789 17:29560007-29560029 CCTAGTCTTCAAGTAGTAATGGG No data
Right 1146051794 17:29560041-29560063 ATGTTCTTGGGATATGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146051789 Original CRISPR CCCATTACTACTTGAAGACT AGG (reversed) Intergenic
No off target data available for this crispr