ID: 1146051796

View in Genome Browser
Species Human (GRCh38)
Location 17:29560057-29560079
Sequence CAGTGGGTGCATCTGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146051787_1146051796 28 Left 1146051787 17:29560006-29560028 CCCTAGTCTTCAAGTAGTAATGG No data
Right 1146051796 17:29560057-29560079 CAGTGGGTGCATCTGGCACAAGG No data
1146051789_1146051796 27 Left 1146051789 17:29560007-29560029 CCTAGTCTTCAAGTAGTAATGGG No data
Right 1146051796 17:29560057-29560079 CAGTGGGTGCATCTGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146051796 Original CRISPR CAGTGGGTGCATCTGGCACA AGG Intergenic
No off target data available for this crispr