ID: 1146052673

View in Genome Browser
Species Human (GRCh38)
Location 17:29566267-29566289
Sequence CCGCGAACAGCGGCGCCGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146052666_1146052673 -2 Left 1146052666 17:29566246-29566268 CCGAGCCCGAGCCTTCGCTCACC 0: 1
1: 0
2: 0
3: 26
4: 169
Right 1146052673 17:29566267-29566289 CCGCGAACAGCGGCGCCGCCGGG 0: 1
1: 0
2: 1
3: 3
4: 56
1146052665_1146052673 19 Left 1146052665 17:29566225-29566247 CCAGGTAGGACAGGAGCAGCGCC 0: 1
1: 0
2: 0
3: 6
4: 191
Right 1146052673 17:29566267-29566289 CCGCGAACAGCGGCGCCGCCGGG 0: 1
1: 0
2: 1
3: 3
4: 56
1146052668_1146052673 -8 Left 1146052668 17:29566252-29566274 CCGAGCCTTCGCTCACCGCGAAC 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1146052673 17:29566267-29566289 CCGCGAACAGCGGCGCCGCCGGG 0: 1
1: 0
2: 1
3: 3
4: 56
1146052664_1146052673 20 Left 1146052664 17:29566224-29566246 CCCAGGTAGGACAGGAGCAGCGC 0: 1
1: 0
2: 0
3: 9
4: 181
Right 1146052673 17:29566267-29566289 CCGCGAACAGCGGCGCCGCCGGG 0: 1
1: 0
2: 1
3: 3
4: 56
1146052662_1146052673 29 Left 1146052662 17:29566215-29566237 CCGCACTCGCCCAGGTAGGACAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1146052673 17:29566267-29566289 CCGCGAACAGCGGCGCCGCCGGG 0: 1
1: 0
2: 1
3: 3
4: 56
1146052667_1146052673 -7 Left 1146052667 17:29566251-29566273 CCCGAGCCTTCGCTCACCGCGAA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1146052673 17:29566267-29566289 CCGCGAACAGCGGCGCCGCCGGG 0: 1
1: 0
2: 1
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146052673 Original CRISPR CCGCGAACAGCGGCGCCGCC GGG Exonic