ID: 1146052774

View in Genome Browser
Species Human (GRCh38)
Location 17:29566658-29566680
Sequence GCCCGCGCTCCTGGTTCTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146052774_1146052781 6 Left 1146052774 17:29566658-29566680 CCCGGAGAACCAGGAGCGCGGGC 0: 1
1: 1
2: 0
3: 23
4: 185
Right 1146052781 17:29566687-29566709 CCAGCGCCTCTGAGCGCCGCAGG 0: 1
1: 0
2: 2
3: 20
4: 125
1146052774_1146052788 30 Left 1146052774 17:29566658-29566680 CCCGGAGAACCAGGAGCGCGGGC 0: 1
1: 1
2: 0
3: 23
4: 185
Right 1146052788 17:29566711-29566733 CGCGCAGCAGGCACTGGGCCAGG 0: 1
1: 0
2: 3
3: 34
4: 372
1146052774_1146052786 24 Left 1146052774 17:29566658-29566680 CCCGGAGAACCAGGAGCGCGGGC 0: 1
1: 1
2: 0
3: 23
4: 185
Right 1146052786 17:29566705-29566727 GCAGGGCGCGCAGCAGGCACTGG 0: 1
1: 0
2: 2
3: 38
4: 325
1146052774_1146052784 18 Left 1146052774 17:29566658-29566680 CCCGGAGAACCAGGAGCGCGGGC 0: 1
1: 1
2: 0
3: 23
4: 185
Right 1146052784 17:29566699-29566721 AGCGCCGCAGGGCGCGCAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 136
1146052774_1146052787 25 Left 1146052774 17:29566658-29566680 CCCGGAGAACCAGGAGCGCGGGC 0: 1
1: 1
2: 0
3: 23
4: 185
Right 1146052787 17:29566706-29566728 CAGGGCGCGCAGCAGGCACTGGG 0: 1
1: 0
2: 1
3: 35
4: 226
1146052774_1146052782 7 Left 1146052774 17:29566658-29566680 CCCGGAGAACCAGGAGCGCGGGC 0: 1
1: 1
2: 0
3: 23
4: 185
Right 1146052782 17:29566688-29566710 CAGCGCCTCTGAGCGCCGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146052774 Original CRISPR GCCCGCGCTCCTGGTTCTCC GGG (reversed) Exonic
900087164 1:904209-904231 GCCCGGGGTCCTGGTCTTCCTGG + Intergenic
900349595 1:2228307-2228329 GCCCGCGCCCCCGCTCCTCCCGG + Intergenic
900592724 1:3467181-3467203 GGCCCCGCTCCTGGATCTCCTGG - Exonic
902052855 1:13577879-13577901 GTCGGTGCTCTTGGTTCTCCTGG + Intergenic
902225999 1:14996795-14996817 CTCCCCGCTCCTGGTGCTCCAGG + Intronic
904314258 1:29650178-29650200 GCCCACGCACCTGCCTCTCCTGG + Intergenic
905043970 1:34982161-34982183 CCCTGAGCTCCTGGATCTCCTGG - Intronic
905889592 1:41510945-41510967 GGCCTCGCTCCTGGGCCTCCCGG + Exonic
906506465 1:46383344-46383366 GACCAGCCTCCTGGTTCTCCAGG + Intergenic
911041135 1:93591952-93591974 GCCCGCCCTCCTAGTTCTTCCGG + Intronic
919835623 1:201571138-201571160 GCCCTGGCTCCTGGATCTCTGGG + Intergenic
1063663373 10:8048546-8048568 GCCGGCGTCCCTGGGTCTCCCGG - Intergenic
1065704957 10:28464244-28464266 GCCAGTGCTGCTGTTTCTCCTGG + Intergenic
1067003455 10:42638766-42638788 GCCCGCAGCCCTGGCTCTCCCGG + Intergenic
1070054689 10:72923706-72923728 GTCCTCGATCCTGTTTCTCCTGG - Intronic
1070895768 10:79982119-79982141 TCCCGCCCTCCTGGCTCTCCGGG + Intronic
1075677304 10:124304356-124304378 GCCCAGGCTCCTGGTTCACTAGG - Intergenic
1076793786 10:132789300-132789322 GCCCGGGCTCCTGGGGGTCCTGG - Intergenic
1077077132 11:706879-706901 GCCCACCCTCCTGCCTCTCCTGG - Intronic
1077204829 11:1337167-1337189 CCTCGCGCTCCCGCTTCTCCAGG + Intergenic
1077228015 11:1446808-1446830 GCCCGGGCTCCTGGACCTCCTGG - Intronic
1077318038 11:1927975-1927997 GCCAGCGCTCTTGGTTTTGCAGG - Intronic
1079116163 11:17641840-17641862 GCTCGTACTCCTGGTTCTACAGG - Exonic
1079121478 11:17688256-17688278 TCCCGCGGGCCTGGTTGTCCTGG - Intergenic
1081808226 11:45901326-45901348 GCCCTCCTTCCTGGATCTCCTGG - Intronic
1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG + Intergenic
1083815611 11:65130799-65130821 GCCTGCGCTCCTGGTTCCAGCGG - Exonic
1089238239 11:117051325-117051347 ACCAGCTTTCCTGGTTCTCCAGG + Intronic
1089499893 11:118925744-118925766 GCCCGCACGCCTGGGTCCCCCGG - Intronic
1091168836 11:133502883-133502905 GCCAGCCATCCTGGTTTTCCTGG + Intronic
1093894513 12:24562044-24562066 GCCGGCGCTCCAGGGTCCCCCGG + Intergenic
1103714372 12:122935404-122935426 GCACGGGCTCCTGGCTCACCAGG + Exonic
1104036078 12:125097803-125097825 GCCCGAGCTCCTGGTTTGGCAGG - Intronic
1104759786 12:131289967-131289989 GCCGGGACTTCTGGTTCTCCAGG - Intergenic
1104820938 12:131677282-131677304 GCCGGGACTTCTGGTTCTCCAGG + Intergenic
1106590420 13:31093736-31093758 GCCCTCTCTCCTTCTTCTCCGGG + Intergenic
1108126740 13:47252679-47252701 GCCTGGGCTCCTGGGTATCCTGG + Intergenic
1108648139 13:52450525-52450547 CCCCGCGCTGCTGGATCACCAGG + Exonic
1112051072 13:95644284-95644306 GCCGGCCCTCCTGCCTCTCCAGG - Intronic
1112666205 13:101576731-101576753 GCCCTCCCTCCTTGATCTCCTGG + Intronic
1113078890 13:106495793-106495815 CCCCTCCCTCCTGGTTATCCAGG + Exonic
1114454414 14:22845922-22845944 GCCCGTGCTGCTGCTGCTCCTGG + Exonic
1115851272 14:37592141-37592163 GCCAGCGCTGCTGGTTCTGCCGG + Exonic
1118885035 14:69859307-69859329 GCCCGAGCTTCTGGTCATCCGGG - Intronic
1119776422 14:77251914-77251936 GCCCCTCCTCCTGGTTCTCTTGG + Intronic
1121091455 14:91185554-91185576 GCCACCGCTCCTGGTGCTCTGGG + Intronic
1121525188 14:94614546-94614568 TCCCTCGGTCTTGGTTCTCCTGG - Exonic
1121843704 14:97155340-97155362 GCCCCACCTCCTGGTTTTCCTGG - Intergenic
1122908611 14:104815513-104815535 GCCGGCGCTCCTGGGGCTTCGGG + Intergenic
1123066241 14:105620918-105620940 GTCCACGCTCCTGGCTCTCCCGG + Intergenic
1123070383 14:105639970-105639992 GTCCACGCTCCTGGCTCTCCCGG + Intergenic
1123074974 14:105663630-105663652 GTCCACGCTCCTGGCTCTCCCGG + Intergenic
1123089619 14:105736758-105736780 GTCCACGCTCCTGGCTCTCCCGG + Intergenic
1123095412 14:105764918-105764940 GTCCACGCTCCTGGCTCTCCCGG + Intergenic
1124484699 15:30103957-30103979 GCTGTGGCTCCTGGTTCTCCTGG - Intergenic
1124518882 15:30393281-30393303 GCTGTGGCTCCTGGTTCTCCTGG + Exonic
1124539773 15:30572965-30572987 GCTGTGGCTCCTGGTTCTCCTGG - Intergenic
1124758878 15:32434617-32434639 GCTGTGGCTCCTGGTTCTCCTGG + Intergenic
1128086247 15:64888611-64888633 GCCCTCCCTCCTGGGCCTCCAGG - Intronic
1131034768 15:89214968-89214990 GCCCTCATTCCTGGTTCTCCAGG - Intronic
1132318013 15:100904422-100904444 GCCCTCTCTCCTGCTCCTCCAGG + Intronic
1132657038 16:1045747-1045769 GCCTGCCCTCCAGGTGCTCCCGG + Intergenic
1132759585 16:1502240-1502262 GCCCGTGCTGCTGGCTCTCATGG + Intronic
1136867551 16:33769454-33769476 GCCCACGCTCCTGGCTCCCAGGG + Intergenic
1138449098 16:57082456-57082478 GCCTGGGCTCCTGGCTCTTCAGG - Exonic
1141462602 16:84186696-84186718 GCCCTCGCTGCGGGCTCTCCAGG + Intronic
1141624543 16:85254334-85254356 GCCTGCAGACCTGGTTCTCCTGG + Intergenic
1141839891 16:86567662-86567684 GCCAGCCCTGCTTGTTCTCCCGG - Exonic
1141950026 16:87334127-87334149 GCCCGCCTTCCTGCTGCTCCTGG + Exonic
1203104610 16_KI270728v1_random:1346749-1346771 GCCCACGCTCCTGGCTCCCAGGG - Intergenic
1203128904 16_KI270728v1_random:1615619-1615641 GCCCACGCTCCTGGCTCCCAGGG + Intergenic
1143166431 17:4899375-4899397 GCCCCTGCCCCAGGTTCTCCTGG - Exonic
1143864711 17:9915798-9915820 CCCCTCGCTCATGCTTCTCCCGG + Exonic
1144235548 17:13257283-13257305 GCCTACGCTCCTGGCTCTCAGGG + Intergenic
1145980038 17:29005821-29005843 GCCCTCGCTGCTGGCGCTCCTGG - Exonic
1146052774 17:29566658-29566680 GCCCGCGCTCCTGGTTCTCCGGG - Exonic
1147911405 17:43858332-43858354 GCCCGGCCTCCTGGCTCTGCGGG + Intronic
1151555056 17:74842597-74842619 GCCACGGCTCCTGGCTCTCCGGG - Exonic
1151584731 17:75002157-75002179 GCCTGCGTTCCCGCTTCTCCCGG - Exonic
1151824105 17:76514073-76514095 GCCTGCACTCCTGGCTCTCCTGG + Intergenic
1152330128 17:79667938-79667960 GCCAGTGCTCCTGGTTGCCCAGG - Intergenic
1153006233 18:500665-500687 GCCCGCGCTCCCCGCGCTCCCGG + Exonic
1159742287 18:72187338-72187360 CCCTGAGCTCCTGGTTTTCCTGG - Intergenic
1160045922 18:75387275-75387297 GCCTGGGCTCCTGGAACTCCAGG - Intergenic
1160568074 18:79798929-79798951 GCCCGCGCGCCTGGCTCCCGGGG + Intergenic
1160791265 19:924878-924900 GCCCGCCCTCCAGGCTCCCCTGG + Intergenic
1160835458 19:1122674-1122696 GGCCGCGCAGGTGGTTCTCCAGG + Exonic
1161580764 19:5079597-5079619 GCCTGCAGGCCTGGTTCTCCAGG + Intronic
1162417017 19:10544226-10544248 GGCCCCGCTCTTGGCTCTCCCGG + Exonic
1163187954 19:15652878-15652900 GACAGCGCTCCTGGTATTCCGGG - Exonic
1164589790 19:29500405-29500427 GCCCCCGCTCCTTGTAATCCTGG - Intergenic
1166871260 19:45872467-45872489 GCCAGCGCTGCTGATTCTCCCGG - Exonic
1167307219 19:48716044-48716066 GCCTGCACTCCTGGTTCTTGGGG + Intronic
1167521928 19:49960371-49960393 GCCCGGGCTCCAGGGTCTCGGGG + Exonic
1167523456 19:49970351-49970373 GCCCGGGCTCCAGGGTCTCGGGG - Intergenic
1167669005 19:50839025-50839047 GCCCGCACTCCTGGGTCTGAGGG + Intergenic
1167705621 19:51079390-51079412 GCCTGGGCTCCTGGGTCTCCAGG - Intronic
1167756613 19:51416900-51416922 GCCCGGGCTCCAGGGTCTCGGGG + Exonic
1167795403 19:51704971-51704993 GCCCGGACTCCTGGTTCTGAGGG - Intergenic
925093635 2:1175964-1175986 CCCAGCTCTCCTGGTTCTTCAGG + Intronic
925406978 2:3612411-3612433 GCCTTCTCACCTGGTTCTCCGGG - Intronic
925917536 2:8617384-8617406 GCCCCCACTCCTGTGTCTCCAGG + Intergenic
927234265 2:20855993-20856015 GCTCAATCTCCTGGTTCTCCAGG + Intergenic
927256362 2:21043909-21043931 GCCCGCGCTGCTGGCGCTGCTGG - Exonic
927670913 2:25068138-25068160 GCTCTCACCCCTGGTTCTCCTGG + Intronic
929488579 2:42376410-42376432 ACCTGCACTCCTGCTTCTCCAGG + Intronic
930278688 2:49343439-49343461 GCCAGCTCTCCTAGTTCTACAGG + Intergenic
932790184 2:74648284-74648306 GCCCCCTCACCTGGTCCTCCCGG + Intronic
934769277 2:96897668-96897690 GCCCACGCTGCTGTTTCTCCAGG + Intronic
935209157 2:100923624-100923646 GCCCGGGGTCATGGTTCTCAGGG - Intronic
937221561 2:120345507-120345529 GCCCGCGCGGCCGGCTCTCCCGG + Intergenic
937356248 2:121199888-121199910 TCCCCAGCTCCAGGTTCTCCTGG - Intergenic
940215689 2:151301168-151301190 ACCAGAGCTCCTGGTTCTCAGGG + Intergenic
944678683 2:202056011-202056033 GCCCAGTCTCATGGTTCTCCTGG - Intergenic
946509956 2:220345164-220345186 GCCCTTGCTCCTTCTTCTCCAGG - Intergenic
947065996 2:226226171-226226193 GCCAGCTCTCCTGGTTGGCCTGG + Intergenic
947168779 2:227290031-227290053 CCACGCAGTCCTGGTTCTCCAGG - Exonic
947659850 2:231858449-231858471 GCCACCGCTCCCGGTCCTCCTGG + Intergenic
948740135 2:240041098-240041120 GACCTCCCTCCTGGGTCTCCTGG - Intergenic
948912404 2:241011127-241011149 GGCAGGTCTCCTGGTTCTCCTGG + Intronic
949010719 2:241676852-241676874 GCCCACGCTCCTGTGGCTCCTGG + Intronic
1168766945 20:388229-388251 GCCCGCCCTCCTCGGGCTCCAGG - Exonic
1169087886 20:2838697-2838719 ACACCCGCTCCAGGTTCTCCCGG + Exonic
1169673912 20:8132925-8132947 GCGCGCGCTCCTGTTTCATCGGG + Intronic
1170924606 20:20712102-20712124 GCCCGGCCTCCAGGTTCTCCGGG + Intronic
1171123142 20:22582614-22582636 GCCAGCGCTGCTGGTTCTGCCGG + Exonic
1171779637 20:29407970-29407992 GCCCAGGCTTCTGGCTCTCCAGG - Intergenic
1172024991 20:31942513-31942535 CCCCACGCTGCTGCTTCTCCTGG - Intronic
1172875004 20:38158758-38158780 GCCAGCTCTCCTGCTTCTCTGGG + Intronic
1172911232 20:38410759-38410781 GCCCACCCTCCTGCTGCTCCTGG + Intergenic
1173819020 20:46008941-46008963 GCCCCTGGTCCTGGTGCTCCTGG + Exonic
1174146602 20:48456509-48456531 GGCCGCCCTCCTGGCTCTCAGGG + Intergenic
1174298858 20:49568086-49568108 GGCCGCGCTCCTCGGCCTCCTGG - Exonic
1174402950 20:50285727-50285749 GCCCGGCCTCCTGGTCCCCCGGG + Intergenic
1177259033 21:18704841-18704863 GTCGGCTCTCCTGGGTCTCCAGG + Intergenic
1182137594 22:27919879-27919901 GCCCGCTTTCCTGGGTCTCGAGG - Intronic
1182756984 22:32688308-32688330 GCCTGTGCTTCTGGTTCTACTGG + Intronic
1183903194 22:41021694-41021716 GCCCGGCCTCCTGCTTCTCCCGG + Intergenic
1184260114 22:43310155-43310177 TCCCTCGCTCCTGATCCTCCAGG + Intronic
1184379966 22:44139098-44139120 GCCTGGCCTCGTGGTTCTCCAGG + Intronic
1184644199 22:45887642-45887664 TCACACGCTCCTGGCTCTCCAGG + Intergenic
1184818947 22:46894108-46894130 GCCCACGCTCCCGTTTATCCAGG - Intronic
950029371 3:9842064-9842086 GTCAGCTCTCCTGGTTTTCCTGG + Exonic
950032058 3:9859921-9859943 GCCCTCTCTGCTGGTTCCCCAGG - Intergenic
950451155 3:13066620-13066642 GCCCTCTCTCCTGGTCCTCCTGG - Intronic
954110272 3:48429538-48429560 GGCCGCGCGCCCGGCTCTCCGGG - Intronic
960844450 3:121993596-121993618 GCCCCCGGTCCTGGAGCTCCTGG + Exonic
961066868 3:123883739-123883761 GCCCGCGCCCCAGCTTCGCCTGG + Intronic
962244772 3:133783754-133783776 GCCAGGGCTCCGGGTTCTACCGG - Intergenic
963152632 3:142061779-142061801 ACCAGCTTTCCTGGTTCTCCAGG + Intronic
966900932 3:184483981-184484003 GCCACCGCTCCTGGTTCCTCAGG + Intronic
968423901 4:508311-508333 ACCCTCGCTGCTGGTCCTCCTGG - Intronic
969134477 4:5019403-5019425 GCCCGTGCTGCTGCTGCTCCTGG - Exonic
969491910 4:7504284-7504306 TTCCACACTCCTGGTTCTCCAGG - Intronic
969912849 4:10461287-10461309 GCCCACTCTCTTGGCTCTCCTGG + Intergenic
970575435 4:17422568-17422590 TCCCGTGCTCCAGGTGCTCCTGG + Intergenic
971017254 4:22501082-22501104 ACCAGCTGTCCTGGTTCTCCAGG + Intronic
978587936 4:110293257-110293279 GCCCTTCCTCCTGGTCCTCCAGG - Intergenic
982084325 4:151818267-151818289 GCCAGCTCTCCTGGTGCTGCAGG + Intergenic
985520980 5:373811-373833 CCCCGCGCTCCTGGGGCTCCTGG + Intronic
991559762 5:67937418-67937440 GTCCGAACTCCTGGTCCTCCAGG - Intergenic
992785805 5:80169537-80169559 GCCTGCTGTCCTGTTTCTCCGGG + Exonic
995106501 5:108381913-108381935 GCTCGCGCCCATCGTTCTCCCGG - Exonic
997013506 5:129905060-129905082 CCCCGCGCGCCAGGATCTCCAGG + Exonic
997201641 5:132013297-132013319 GCCCAGGCTTCTGGTTCCCCTGG - Intergenic
1001402916 5:171456676-171456698 GCACGTCCTGCTGGTTCTCCCGG - Exonic
1002047270 5:176549165-176549187 GCCAGAGCTCCTGGCGCTCCTGG - Intronic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1004995655 6:21189873-21189895 GCACGCGATGCTGGGTCTCCTGG - Intronic
1007373815 6:41443222-41443244 GCCCCAGCTCCTGTTTCTCCAGG - Intergenic
1007469805 6:42081790-42081812 GCCCCCGCGCCTGGCTCTTCTGG + Exonic
1013797238 6:113901330-113901352 CCCCCGGCTCCTGGGTCTCCAGG + Intergenic
1015536002 6:134268307-134268329 GCCTGGGCTCCTGGGCCTCCTGG + Intronic
1019266488 7:120038-120060 GCCCTCGCTCCTGCTCCTCAGGG - Intergenic
1019483028 7:1275016-1275038 GCCAGAGCTCCTCGTTCCCCCGG - Intergenic
1019531188 7:1504264-1504286 GGGCGAGCGCCTGGTTCTCCCGG - Intronic
1019610845 7:1935948-1935970 CCCCACGCTCCTGGTTCTGGGGG - Intronic
1022138760 7:27474114-27474136 GCCAGCTCTCCTGATTCTCTGGG - Intergenic
1023872307 7:44269633-44269655 GCCAGCTCTGCTGTTTCTCCTGG - Intronic
1028398902 7:90403626-90403648 TCCAACGCTCCTGATTCTCCTGG - Intronic
1031303374 7:120092027-120092049 GCCAGGTTTCCTGGTTCTCCAGG + Intergenic
1032194168 7:129780128-129780150 GCCCGCGCCCCCTGTTCTTCCGG - Intergenic
1035575538 8:702320-702342 GCCGGCGTTCTTGTTTCTCCAGG - Intronic
1036259279 8:7227807-7227829 CCCCGCGCCCCTGGCACTCCCGG + Intergenic
1038553565 8:28490374-28490396 GCCAGCCCTCCTGGATCTCGCGG - Intergenic
1040590444 8:48787937-48787959 GCCAGAGCTCCTGGTGCTTCAGG - Intergenic
1041167218 8:55102184-55102206 GCCCGCGCTCCTCGCCGTCCCGG - Intergenic
1049598266 8:143494556-143494578 GCCCTCGCTCTGGGTTCTGCCGG - Intronic
1049711124 8:144063820-144063842 GCTTCAGCTCCTGGTTCTCCTGG + Intronic
1049755748 8:144310658-144310680 GACCGCGCTCCTGCTGCTCTGGG - Intronic
1054820613 9:69516994-69517016 CCCCGCGCTCCTCTTCCTCCTGG + Exonic
1054870546 9:70044278-70044300 GCCCCCGCTCCTGCTGCCCCCGG + Intronic
1055021531 9:71675464-71675486 GCCTGGGCTCCAGGCTCTCCAGG - Intergenic
1057801308 9:98192779-98192801 GACCGCGCTCCTGGCTCCCCGGG + Intergenic
1058663048 9:107283522-107283544 GCCCGCGCTCCTCGCGCTCTGGG - Exonic
1060517548 9:124275489-124275511 GGCGGAGCTCCTGGTTCTCTGGG + Intronic
1060555047 9:124503774-124503796 CCCAGCGCTCCTGGGTCCCCTGG - Intronic
1060855862 9:126914839-126914861 GCCCGCGCTCCAGCTGCGCCTGG + Exonic
1061582581 9:131546592-131546614 GCCAGCGCTCCAGCATCTCCCGG - Intergenic
1061681508 9:132244782-132244804 GCCAGCGCTGCTGTTTCTCTGGG - Intergenic
1062113394 9:134795088-134795110 CCCCGCGGTCCTGGCTTTCCAGG - Exonic
1062230772 9:135480244-135480266 CCCCGCGCTCCTGGAGCCCCAGG + Intronic
1062380056 9:136282770-136282792 GCCCGCATTCCTGGTGCTGCAGG + Intronic
1062520138 9:136954369-136954391 GCCTGCGCTCAGGGGTCTCCAGG + Intronic
1186460673 X:9746080-9746102 GCCCCTGCTGCTGGTTCTCGTGG - Exonic
1189907036 X:45771733-45771755 GCCCGCGCGGCGGGTTCTTCAGG + Intergenic
1195328514 X:103777340-103777362 GCTTGCCCTCCTGGTTCTGCTGG + Intronic
1195797614 X:108668423-108668445 CCAGGCCCTCCTGGTTCTCCGGG + Exonic
1197557889 X:127978523-127978545 GCCCACACACCTGGTTCTCCTGG + Intergenic
1200128968 X:153830808-153830830 GCCCGCGCTCCCGCCTCGCCCGG + Intergenic