ID: 1146053438

View in Genome Browser
Species Human (GRCh38)
Location 17:29569159-29569181
Sequence CCTCAGATGGTGACTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 412}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146053438_1146053449 29 Left 1146053438 17:29569159-29569181 CCCTCCACAGTCACCATCTGAGG 0: 1
1: 0
2: 1
3: 39
4: 412
Right 1146053449 17:29569211-29569233 CCAACTTCTCCATCCCAGCCTGG 0: 1
1: 0
2: 3
3: 31
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146053438 Original CRISPR CCTCAGATGGTGACTGTGGA GGG (reversed) Intronic
900718144 1:4158195-4158217 CCTCAGCTGCTGTCTTTGGAGGG - Intergenic
900931205 1:5739023-5739045 CCTCACAGTGTGACTCTGGATGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902404556 1:16175637-16175659 CCTGAGGTGGGGACTGTGGAGGG - Intergenic
902699986 1:18165499-18165521 CCTCAGAATGTGACTGTGTTTGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903087577 1:20876581-20876603 TATCAGATGGTCACTGTGAATGG - Intronic
903774271 1:25782769-25782791 CCACAGAACCTGACTGTGGAGGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905485570 1:38293394-38293416 CCTCAGAAGGTGACTGTGTTTGG - Intergenic
905931287 1:41789331-41789353 CCTCACAAAGTGACTGAGGAGGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907017619 1:51032587-51032609 CCATAGCTGGTGACTGAGGAGGG + Intergenic
907251957 1:53145563-53145585 CCCCAGCTGGTGACTGTGAAGGG - Intergenic
907768609 1:57437128-57437150 CTTCAGATGGTGAAAGTGAATGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910831995 1:91470638-91470660 CCTCAGATGGCCCCTCTGGAAGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913260077 1:116989831-116989853 CCTCAGATGGTGAGGGTGAGGGG - Exonic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915783204 1:158577760-158577782 CCTGATATAGTGACTGTGGCGGG - Intergenic
916699020 1:167271669-167271691 CCTCAGAGAGTTTCTGTGGAAGG + Intronic
917120946 1:171644095-171644117 CCTCCCATGGCAACTGTGGATGG - Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
918427451 1:184425207-184425229 ACTGAGATGGTGTATGTGGAAGG + Intronic
918441004 1:184567112-184567134 GCTCTGTTGGAGACTGTGGAAGG - Intronic
919019065 1:192080128-192080150 CCTCAGTTGGTGAGTGCGGTAGG - Intergenic
920189790 1:204186285-204186307 CTTCAGATGCTGACATTGGAGGG - Intergenic
921726876 1:218533934-218533956 CCCAAGATGGTGGCAGTGGAAGG + Intergenic
921845511 1:219875619-219875641 CCTCAGATGTTGACCTTTGAAGG + Intronic
922064911 1:222127147-222127169 CCTCATAAGGTGACATTGGAGGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922810109 1:228410586-228410608 CCTCAGAATGTGACTGTGTTTGG + Intronic
923679803 1:236110399-236110421 TTTCAGATGGTCACAGTGGATGG - Intergenic
923773969 1:236961737-236961759 CATCACATGGTGACAGAGGAAGG - Intergenic
924707433 1:246511393-246511415 CCCCAGAGGGTGACTCAGGAGGG + Intergenic
1062957662 10:1551022-1551044 CCTCAGAAGGTGACAGTGTTTGG + Intronic
1063016835 10:2086830-2086852 ACTCAGATGCAGACTGTGGGAGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065666710 10:28071026-28071048 CCTCACCTGGTGACACTGGAAGG + Intronic
1066372886 10:34832224-34832246 CAGCAGATGTTAACTGTGGATGG - Intergenic
1067180189 10:43979547-43979569 CCTGAAATGGTGACTGTGGTAGG + Intergenic
1068396284 10:56466080-56466102 CAGCAGGTGGAGACTGTGGATGG - Intergenic
1068824483 10:61419163-61419185 CCTCAGGTGGTGGCAGTGGTGGG + Intronic
1068873622 10:61973107-61973129 CCTCAGAGGCTCATTGTGGATGG - Intronic
1068959216 10:62849873-62849895 CCACAGATGGGGGCTGGGGATGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069887048 10:71630417-71630439 ATTCAGATGGGGCCTGTGGAGGG + Intronic
1070735689 10:78862147-78862169 CCCCACATGGTGGCTGTGGATGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073893179 10:108123738-108123760 ACACAAATGGTGGCTGTGGAAGG + Intergenic
1074687293 10:115972531-115972553 ACTCAGCAGGTGACTGTGAAGGG - Intergenic
1074908966 10:117890077-117890099 AATGAGATGGTCACTGTGGATGG + Intergenic
1076223436 10:128754073-128754095 TCTCAGATGGTGACTGTATTTGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078319238 11:10318844-10318866 CCTCAGAATGTGACTGTGTTTGG + Intronic
1078992530 11:16664466-16664488 TCTCAGCTGGTGCCTGTGGAGGG + Intronic
1080253308 11:30260106-30260128 CCTCAGAATGTGACTGTGTTTGG + Intergenic
1080839552 11:35971370-35971392 CCTCAGAAGGTGACTGTATTTGG + Intronic
1081267691 11:41046712-41046734 TCTCTGATGGTCACTGTTGAGGG + Intronic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1084118182 11:67053990-67054012 CCCCAGGTGATGACTGTGCAGGG + Intergenic
1084279400 11:68077459-68077481 CCACAGCTGGTGACAGTGGAGGG + Intronic
1084330533 11:68427304-68427326 CCTCAGATGGTTACCATGGAGGG - Intronic
1084530843 11:69726963-69726985 CCTCTGATGGTGGATGTGGCCGG - Intergenic
1084710890 11:70843170-70843192 GCTCAGGTGGTGACTGTGACTGG + Intronic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1084779585 11:71399614-71399636 CCTCAGAGTGTGACTGTGCTTGG - Intergenic
1084960616 11:72714254-72714276 CCTCAGACTGTGGCTGGGGAGGG + Exonic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085798472 11:79565427-79565449 TCTCAGAATGTGACTGTGTATGG + Intergenic
1086504774 11:87493864-87493886 CCTCAGAAGGTGACTGGAGAGGG - Intergenic
1087202930 11:95364326-95364348 CTTCAGAGGGTGTCTGGGGAAGG + Intergenic
1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG + Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1089735524 11:120547971-120547993 ACTCAGAGGGTGGCTGTGGGAGG + Intronic
1090670454 11:128941834-128941856 CTACAGCTGGTGACTGTGGCTGG - Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091087683 11:132738613-132738635 CCTCACATGGACACTGTAGAAGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095482583 12:42651374-42651396 CCTCAGAATGTGACTGTAGTTGG + Intergenic
1097935928 12:65250936-65250958 CCTTAGATGGGGATTGAGGATGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1102679297 12:114679862-114679884 CCTTAGATGGTGAGGGTGGGGGG - Intronic
1103624196 12:122206098-122206120 CCTCAGATGATGGCAGAGGAGGG + Intronic
1103857413 12:123982489-123982511 CCCCAGGTGGTCACTCTGGAAGG + Intronic
1104017954 12:124972847-124972869 CCTCGGATGGTGACTATGCCAGG + Intronic
1105984680 13:25553783-25553805 TCTGAGGTGGTGTCTGTGGAAGG - Exonic
1106171746 13:27294614-27294636 CCTCAGAATGTGACTGTGTTTGG + Intergenic
1106887809 13:34208765-34208787 ACACAGATGGTGACTGGGTATGG - Intergenic
1108057551 13:46499498-46499520 GCTCAGATTGGGAATGTGGATGG + Intergenic
1109209149 13:59514526-59514548 CTCCAGATGGAGACTCTGGATGG + Intergenic
1111578058 13:90184427-90184449 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1111947580 13:94681851-94681873 CCTCACAAGGTGAGTGTGAATGG - Intergenic
1112617210 13:101017895-101017917 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1113037160 13:106062773-106062795 CCTCAGACTGTGACTGTGTTTGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115973292 14:38969683-38969705 CGGCAGATGCTGCCTGTGGAGGG - Intergenic
1117461686 14:55951654-55951676 CATCAGATGGTGGCTGGGGCTGG - Intergenic
1119105039 14:71915766-71915788 CCTCAGAATGTGACTGTGTTTGG + Intergenic
1119199998 14:72745082-72745104 CCTCAGGGGGTGGGTGTGGAGGG + Intronic
1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG + Intronic
1121674250 14:95739594-95739616 CCTCAGATGATGAAAGTGGAAGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122603282 14:102931685-102931707 CCTCTGGTGTGGACTGTGGAAGG + Intronic
1124688651 15:31803732-31803754 TCTCAGATGGTCACAGTGGAAGG - Intronic
1125066656 15:35495156-35495178 CCTCAGATGGTGACTGTATTTGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128894514 15:71360075-71360097 ACTCAGATGGTGGCTGAGGCTGG + Intronic
1128942270 15:71798748-71798770 CCTGAGTGGGTGACTGGGGATGG - Intronic
1129452839 15:75660245-75660267 CCACAGATGGGGGCTGGGGATGG + Exonic
1130684124 15:86022177-86022199 CCACTGATGGAGACTGTGAATGG - Intergenic
1131532264 15:93204013-93204035 CCTGAGATAGTCACTGTGGTAGG + Intergenic
1131981503 15:97999098-97999120 CCTCAGATTGTGACTGTGTTTGG + Intergenic
1132130415 15:99272306-99272328 CGTCTGGTGGTCACTGTGGAAGG + Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133663576 16:7942999-7943021 CCTCATATGTTTTCTGTGGAAGG + Intergenic
1135201630 16:20442465-20442487 CCTCAGATTGTGACTGTCTTTGG - Intergenic
1135217478 16:20585401-20585423 CCTCAGATTGTGACTGTCTTTGG + Intergenic
1135836048 16:25826336-25826358 CCTCAGAACGTGACTGTAGTTGG - Intronic
1135898726 16:26434917-26434939 CCAAAGATGGTGACTGAGCAGGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137826171 16:51497667-51497689 CCTGTGATGGTGACTTTGTATGG + Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139588506 16:67919695-67919717 CCTCAGTTGGTCACTGTGGCTGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140489288 16:75320678-75320700 GCTCAGCTGGTGACTCTGCAAGG + Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141824421 16:86468856-86468878 CCTCAGCTGGGGAATGGGGATGG + Intergenic
1142378368 16:89718286-89718308 CCTCAGGTGAGGACTGAGGATGG - Intronic
1142743396 17:1943059-1943081 CCACAGCTGGTCATTGTGGAGGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143092210 17:4455612-4455634 GCTCAGATGGACACCGTGGAGGG - Intronic
1143335222 17:6167080-6167102 CCTGGGATGGTGGCAGTGGATGG + Intergenic
1143760851 17:9103000-9103022 CTTCTGATGGTGAGTGTGGGGGG + Intronic
1143850689 17:9809471-9809493 CCTGAGAGGGTGGCTGTGGCGGG + Intronic
1143904889 17:10200025-10200047 CCACAGAAGGTGACTGGGGGAGG - Intergenic
1145761574 17:27428777-27428799 CCCCAGAGGGTGACTCAGGAGGG - Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1146161629 17:30562938-30562960 CCCCAGAAGGTGACTCAGGAAGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147495836 17:40914327-40914349 TCTCAGCTGATGACTGTTGATGG + Intergenic
1148688393 17:49513256-49513278 CCTGAGATGGTGACGGGGCAGGG - Exonic
1148855354 17:50576115-50576137 CCTCAGATGGGGACCTGGGAGGG - Exonic
1150838774 17:68588752-68588774 CCTCAGAATGTGACTGTGTTTGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152560417 17:81075835-81075857 CCTCATATGGAGCCTGTGGCTGG - Intronic
1152703067 17:81829041-81829063 CCTGAGGTGGTGGATGTGGAGGG + Intronic
1153617640 18:6949183-6949205 TCTCCCATGGTGACTGTGGTGGG - Exonic
1153792273 18:8589367-8589389 CCTCAGAATGTGACTGTATATGG - Intergenic
1154167454 18:12026789-12026811 GCTCAGGTGGTATCTGTGGAGGG + Intronic
1156581591 18:38382916-38382938 CCACAGATGGAGACTATGCATGG - Intergenic
1158481406 18:57824635-57824657 ACTCAGCTGGTGCCTATGGAGGG - Intergenic
1158640072 18:59196204-59196226 CCTCTGCTGGTGTCTTTGGAGGG - Intergenic
1159469848 18:68837757-68837779 CCTCAGAATGTGACTGTTGGTGG - Intronic
1159766253 18:72492296-72492318 CCTCAGATTGTGACTGTATTTGG + Intergenic
1160014093 18:75127624-75127646 CCTAGGTTGGTGGCTGTGGACGG - Intergenic
1160434418 18:78834951-78834973 CCTCCGGGGGTGGCTGTGGATGG - Intergenic
1160568571 18:79801422-79801444 CCTCAGCCGGGGCCTGTGGAGGG + Intergenic
1161302802 19:3551182-3551204 ACGCAGACGGTGCCTGTGGAAGG + Exonic
1161686581 19:5705710-5705732 CCTAAGATGGGGGCTGAGGAGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163234776 19:16023889-16023911 CCCCAGAGGGTGACTTGGGAGGG - Intergenic
1163396996 19:17069637-17069659 CCTGGGAGCGTGACTGTGGATGG + Intronic
1163417861 19:17197509-17197531 CCCCAGATGTTGAGTGTGGAGGG - Intronic
1164648626 19:29876261-29876283 CCACAGATAGAGTCTGTGGAGGG + Intergenic
1164725885 19:30465342-30465364 CTTCAGGGGGTGACTGGGGAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
1167511128 19:49895870-49895892 CCCCAGAGGGTGATTGTGGTTGG - Exonic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
924997921 2:380989-381011 CCTCACATAGTGACCTTGGAGGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925868132 2:8246598-8246620 CCTCAGGAGGTGTCTGTGAAGGG + Intergenic
927214190 2:20657526-20657548 GCTCAGATGGAGACTGGTGATGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929119879 2:38475933-38475955 CCTCAGATGATGCCAGTGCATGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930341671 2:50123831-50123853 CTTCAGATGGATATTGTGGAAGG + Intronic
931248847 2:60513060-60513082 CCTCAAATGGTGACTGTTCTGGG - Intronic
935024431 2:99262799-99262821 CCACAGATGATTGCTGTGGAGGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936009765 2:108918143-108918165 CCCCAGCTGGTGACAGTGGAAGG - Intronic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938379976 2:130831178-130831200 CCTCCCATGGTGACTGTGAGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
938900195 2:135792926-135792948 CCGCAGCTGGTGGCAGTGGAAGG + Intronic
938920836 2:135993167-135993189 TCTCAGAAGGTGACTGTGTTTGG + Intergenic
939099607 2:137880692-137880714 CCTTGGATGGTGATTGTGTAAGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941489136 2:166121834-166121856 CCTCAGAATGTGACTGTGTTAGG + Intronic
942017018 2:171827984-171828006 GCTTAGATGCTGTCTGTGGAGGG - Intronic
943489273 2:188530240-188530262 CCTCAGAATGAGACTGTGGTTGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944306067 2:198181296-198181318 CCTCAGAATGTGACTGTGTTAGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945472249 2:210240352-210240374 CCTCAGGTTGTGACTGTGTTTGG + Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945930458 2:215849743-215849765 CCTCAGTTGGTGACACAGGATGG + Intergenic
947379149 2:229528272-229528294 CATGAGAAGGTGACTGTTGACGG + Intronic
947561586 2:231158646-231158668 CCTGGGATGGAGACTGGGGAGGG - Intronic
1168930671 20:1620761-1620783 CTTCAGATGGGAACTGAGGAGGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170116573 20:12866364-12866386 CCTCTGATGGTGTCAGTGGAGGG + Intergenic
1170529926 20:17281107-17281129 CCTCAGATGGAGAGTCTTGAAGG - Intronic
1170767205 20:19300423-19300445 AGTCAGGTGGTGACTGAGGATGG - Intronic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1172025009 20:31942645-31942667 CTCCAGATGCTGAATGTGGATGG - Intronic
1172123086 20:32609860-32609882 CCTCAGATGGAGAGTGAGGGGGG - Intergenic
1172493361 20:35359744-35359766 CCTCAGCTGGTGACAGAGTAAGG - Intronic
1172961454 20:38803209-38803231 CCTCAGAATGTAACTGTGGATGG - Intergenic
1173453562 20:43186514-43186536 CCTCTGATCGTGGCTGTGAAAGG + Intronic
1173839006 20:46144818-46144840 CCTCAGAAGGTGGGTGTGGCTGG + Intergenic
1175869881 20:62203859-62203881 CCACACATGCTGACTGTGGGGGG - Intergenic
1177483095 21:21719491-21719513 CCTCAGAAGGTGACTGTAATTGG + Intergenic
1179527602 21:41993057-41993079 CCTCAGACGGTCATTGTCGATGG - Exonic
1179713415 21:43275724-43275746 CCTCACCTGGTGTCTGTGGTGGG - Intergenic
1179713425 21:43275754-43275776 CCTCACCTGGTGTCTGTGGTGGG - Intergenic
1179713450 21:43275846-43275868 CCTCACCTGGTGTCTGTGGTGGG - Intergenic
1179713469 21:43275906-43275928 CCTCACCTGGTGTCTGTGGTGGG - Intergenic
1179713479 21:43275936-43275958 CCTCACCTGGTGTCTGTGGTGGG - Intergenic
1180078470 21:45475281-45475303 GCTCAGATGGTGCCTGGGCAGGG + Intronic
1180637236 22:17270767-17270789 CCTCACATGAGCACTGTGGACGG + Intergenic
1180700213 22:17777468-17777490 CCTCAGAACGTGACTGTGCTTGG + Intergenic
1180924388 22:19543908-19543930 CCTCAGATATTAACTTTGGAGGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182484266 22:30629976-30629998 CCACAGGTGGTGTCTGTGGGTGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182972477 22:34590893-34590915 AATCAGATGGTCACAGTGGATGG + Intergenic
1183975197 22:41507985-41508007 AATCAGATGGTCACAGTGGATGG - Exonic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184677770 22:46053091-46053113 CCTCACATGCTGCCTGGGGAAGG - Intronic
1184919124 22:47593293-47593315 CCTCAGAAGATGACTGTGTCTGG + Intergenic
1185154539 22:49185284-49185306 CCACAGATGGTGCCTCTGGGAGG + Intergenic
1185237594 22:49723992-49724014 CCTCAGACTGTGACTGTAGCTGG + Intergenic
951258568 3:20480299-20480321 CCACAAATGGTGACTATGGGTGG + Intergenic
951437815 3:22685441-22685463 CCTCAGAATGTGACTGTGTTTGG - Intergenic
952129331 3:30342006-30342028 ACACAGATGGAGACAGTGGAAGG - Intergenic
952268634 3:31811139-31811161 GCTCAGATGTAGCCTGTGGATGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954450070 3:50567028-50567050 CCTCTGATGGTCCCTGAGGAAGG + Intronic
956298856 3:67746710-67746732 ACTCAAAAGGTTACTGTGGATGG - Intergenic
958892670 3:99797732-99797754 CCTTAGAAGCGGACTGTGGAAGG + Exonic
959069733 3:101691070-101691092 CCCCATATGGTGACTGAGTAAGG - Intergenic
959334696 3:105049301-105049323 CTTCAGACAGTTACTGTGGATGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959684574 3:109130450-109130472 CCTCAGATTGTGACTGTAGTTGG + Intergenic
960571143 3:119186393-119186415 CCTGAGATGGTGATTGGGTAGGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
962032483 3:131615974-131615996 CCTCAGAAGGGGGCTGTGGCGGG - Intronic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
963037753 3:141047361-141047383 CATCACATGGTGACTCTGTAGGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965517948 3:169642234-169642256 GTGCAGATGGTGACTGGGGAAGG + Intronic
965609478 3:170529699-170529721 CCTCAGAATGTGACTGTATATGG + Intronic
965980196 3:174681111-174681133 ACTCAGCTGATGCCTGTGGAGGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967226391 3:187295672-187295694 CTTCAGAAGGTGACTGTGTTTGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969599847 4:8169872-8169894 CCTGAGATGGGGTGTGTGGAAGG - Intergenic
970316987 4:14838670-14838692 CCTCAGAATGTGACTGTGTTTGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973690567 4:53424988-53425010 CCTAATCTAGTGACTGTGGAAGG + Intronic
973834070 4:54791765-54791787 CCTCAGAAGGTGACTGTATTTGG - Intergenic
975045466 4:69798058-69798080 CCTCAGAATGTGACTGTAGTTGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977647781 4:99433560-99433582 CCTCAGAAGGTGACTGTATTTGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
981130476 4:141153269-141153291 CCACAGATGGTGACTGTGTTTGG + Intronic
981246381 4:142544630-142544652 CATCATATTGTGACTCTGGAGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982233635 4:153232127-153232149 CCTCAGATTGTGACTGTATTTGG - Intronic
982729455 4:158940317-158940339 CCTCAGAATGTGACTGTATATGG - Intronic
982897651 4:160953656-160953678 GCTCAGGTGGTGACAGTGAATGG + Intergenic
983645734 4:169989646-169989668 CCTCAGATGGTGACAGAGTGAGG + Exonic
984185554 4:176538750-176538772 CCTCAGGTGATGACTGAGCAAGG - Intergenic
984356759 4:178669984-178670006 CCTCAGAAGGTGACAGTGTTTGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984907823 4:184646535-184646557 CCTAAGATGGTGTTTTTGGAAGG + Intronic
985684069 5:1272526-1272548 TCTGATGTGGTGACTGTGGATGG - Intronic
985684076 5:1272560-1272582 TCTGATGTGGTGACTGTGGATGG - Intronic
985684082 5:1272594-1272616 TCTGATGTGGTGACTGTGGATGG - Intronic
985684117 5:1272772-1272794 TCTGATGTGGTGACTGTGGATGG - Intronic
985684131 5:1272842-1272864 TCTGATGTGGTGACTGTGGATGG - Intronic
985684191 5:1273141-1273163 TCTGATGTGGTGACTGTGGATGG - Intronic
985684219 5:1273283-1273305 TCTGATGTGGTGACTGTGGATGG - Intronic
985684233 5:1273353-1273375 TCTGATGTGGTGACTGTGGATGG - Intronic
985684272 5:1273541-1273563 TCTGATGTGGTGACTGTGGATGG - Intronic
985684279 5:1273575-1273597 TCTGATGTGGTGACTGTGGATGG - Intronic
985684304 5:1273686-1273708 TCTGATGTGGTGACTGTGGATGG - Intronic
985684311 5:1273720-1273742 TCTGATGTGGTGACTGTGGATGG - Intronic
985766874 5:1784734-1784756 GGTCAGATGGTGGCTGTGGCTGG + Intergenic
986831768 5:11588219-11588241 CTTCACATGGTGACTCTGGTTGG + Intronic
986902344 5:12452011-12452033 CCTCAGAATGTGACTGTGTTTGG + Intergenic
989002028 5:36771122-36771144 CCTCAGATTGTGACTGTATTTGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989692888 5:44166607-44166629 CTTCACATGGTGACAGTAGAGGG + Intergenic
990128340 5:52547881-52547903 CCTCACATAGTTACTGTGTAGGG + Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992186920 5:74252845-74252867 CCTCATAGGGTGATTGTGGAAGG + Intergenic
992835875 5:80640935-80640957 CTTCAGTTGGTGCCTGTGGCAGG + Intronic
994009257 5:94880968-94880990 CCTCTGCTGGACACTGTGGATGG + Intronic
996263251 5:121500729-121500751 CCTCAGAATGTGACTGTGTTTGG + Intergenic
1001864468 5:175091484-175091506 CCTCAGAATGTGACTGTAGTTGG + Intergenic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1003399670 6:5781487-5781509 CCTCAGAGTGTGACTGTGTTTGG + Intergenic
1003741749 6:8948296-8948318 CCTCAGATTGTGACTGTATTTGG - Intergenic
1003937611 6:10991858-10991880 AGTGAAATGGTGACTGTGGAAGG - Intronic
1006166703 6:32069669-32069691 CCCCAGGTGGTGCCCGTGGAGGG - Intronic
1006166830 6:32070243-32070265 CCCCAGGTGGTGCCCGTGGAGGG - Intronic
1006168974 6:32082152-32082174 CCCCAGGTGGTACCTGTGGAAGG - Intronic
1006169402 6:32084529-32084551 CCCCAGGTGGTGCCCGTGGAAGG - Intronic
1006984730 6:38168994-38169016 TCTCTGAAGGTCACTGTGGAGGG + Exonic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009045995 6:58237915-58237937 ACCCAGATGGTGCCTGGGGAAGG - Intergenic
1009688442 6:66993472-66993494 TATCAGATGGTTTCTGTGGAAGG + Intergenic
1010935635 6:81857996-81858018 CCTCAGCTGTTGACTGTGTCTGG + Intergenic
1012950322 6:105511559-105511581 TCTCAGGTGGTGAGTATGGAGGG - Intergenic
1013426876 6:110020144-110020166 CTTTAGATGGTAGCTGTGGATGG - Intergenic
1014057897 6:117037738-117037760 GGTCAGATGGTGACTGGGGTTGG - Intergenic
1015365188 6:132389342-132389364 CATCAGATGGTCACTCTGAATGG + Intronic
1016118723 6:140321183-140321205 TCTCAGAGGGTCATTGTGGAGGG - Intergenic
1016764048 6:147772795-147772817 CCTCAGAAGGTGACTGTATTTGG - Intergenic
1016838976 6:148507024-148507046 CGTCAGATGGTGGCAGGGGAAGG + Intronic
1018144865 6:160876788-160876810 CCCCAAATGGTGTCTGAGGAAGG + Intergenic
1019215081 6:170438324-170438346 CCTGAGATAGTGACACTGGAAGG + Intergenic
1019411025 7:906817-906839 GGTCAGATGGTGATGGTGGATGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019466735 7:1193785-1193807 CCTCGGAGGGTGATTGTGAAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019951122 7:4373577-4373599 CCTCAGATTGTGACTGTATTTGG - Intergenic
1020081401 7:5287896-5287918 CTCCAGCTGGTGACTGTCGAAGG - Exonic
1021713357 7:23438486-23438508 CCTTAGATGGTGACTGAGGTTGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023134142 7:37034158-37034180 CCTCAGAATGTGACTGTGTCTGG + Intronic
1023378760 7:39585303-39585325 CCTCAGAAGGTGACTGTATTTGG + Intronic
1023661779 7:42477899-42477921 CCTCAGATTGTGACTGTATTTGG + Intergenic
1024291623 7:47808410-47808432 CCTCAGATGGCTCCTGAGGAAGG + Intronic
1025144766 7:56493593-56493615 TCTTAGATGGTGACTCAGGAGGG + Intergenic
1025197512 7:56944252-56944274 CTCCAGCTGGTGACTGTCGAAGG + Intergenic
1025260345 7:57414050-57414072 TCTTAGATGGTGACTCAGGAAGG + Intergenic
1025674435 7:63632687-63632709 CTCCAGCTGGTGACTGTCGAAGG - Intergenic
1025724120 7:64042320-64042342 CCTCAGGTGGTGCCAATGGAAGG + Intronic
1025753240 7:64311582-64311604 CCTCAGATGGTGCCAATGGAAGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026015714 7:66669308-66669330 CCTCCTCTGGTGACTGGGGAGGG - Intronic
1027655308 7:80923209-80923231 CCTCAAGACGTGACTGTGGATGG - Intergenic
1028866556 7:95720295-95720317 TCTCAGAAGGTCACTGTGGTTGG + Intergenic
1028968238 7:96827162-96827184 CCTCAGAATGTGACTGTGGCTGG - Intergenic
1030352085 7:108500955-108500977 CCTCAGATGGTGGCAGTGGAAGG - Intronic
1031791610 7:126113132-126113154 CTTCAGAAGATGACAGTGGAAGG - Intergenic
1032545488 7:132738227-132738249 TCTCAGATGGGGCCTGGGGAGGG + Intergenic
1033323298 7:140359397-140359419 CCTCAGACTGTGCATGTGGAGGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034374415 7:150629917-150629939 CCTCTGATGGTGGCTGAGGCGGG + Intronic
1034569993 7:151947799-151947821 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035116783 7:156531568-156531590 CTTCAGAAGGTGACTGTGTTTGG - Intergenic
1035394183 7:158524654-158524676 CCTCAGAAGGTGACTGCGTTTGG + Intronic
1035664148 8:1367986-1368008 CCCCATCTGGTGACTGAGGAGGG - Intergenic
1036081285 8:5558867-5558889 CCTCAGAAGGTGACTGTAATTGG - Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1037593193 8:20330638-20330660 CCTCAAAAGGTGACTGGGGCAGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038731995 8:30136178-30136200 CCTCAGAATGTGACTGTATATGG + Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039891614 8:41689622-41689644 CCTCTGCTGGGGACTTTGGAGGG - Intronic
1040012520 8:42674308-42674330 ACTCACATGGTGACTGGGGAAGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041260880 8:56019602-56019624 CCTCAGGTGGGGCCGGTGGATGG + Intergenic
1042103734 8:65301653-65301675 CCTCAGAATATGACTGTGTATGG - Intergenic
1043231566 8:77808647-77808669 CCTCAAATGGTGCCTGCAGAAGG + Intergenic
1044506045 8:93020733-93020755 AATCAGATGCTGACTGAGGAGGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046189148 8:110766718-110766740 CCTCAGATTGTGACTGTATTTGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046743113 8:117849006-117849028 CTGTAGATGGTGACTGAGGATGG - Intronic
1047689889 8:127341198-127341220 CCTCTGATGGTGACTAAGGAGGG + Intergenic
1047760150 8:127948549-127948571 CCTCAGAACGTGACTGTGTTCGG + Intergenic
1047833493 8:128661745-128661767 TCACAGATGGTGACTGAGGTGGG + Intergenic
1048334542 8:133492800-133492822 CCTCAGCTGGTCTCTCTGGATGG + Intronic
1048525141 8:135195778-135195800 TCACAGATGGTGGATGTGGACGG - Intergenic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051992663 9:23171597-23171619 CCTCACTTGGTGACTGAGGGGGG - Intergenic
1052978428 9:34429407-34429429 CCTGAGCTGGTGAGTGAGGAGGG - Intronic
1053144701 9:35704511-35704533 TGTCACATGGTGACTGTGGAAGG + Intronic
1053731811 9:41064687-41064709 GCTGAGGTGGCGACTGTGGAAGG - Intergenic
1054983510 9:71234713-71234735 CCTCAGAATGTGACTGTAGTAGG - Intronic
1055641063 9:78319407-78319429 CCTGAGATGGTGCCTGGGAAAGG - Intronic
1056179590 9:84069204-84069226 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1056667159 9:88589989-88590011 CCTCAGATGGGCACAGTGGGTGG - Intergenic
1056957834 9:91096691-91096713 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1057432810 9:95010350-95010372 CAACAGATGGTGACTGTGGTAGG + Intronic
1057470455 9:95351576-95351598 CAGCAGATGTTGACTGTGGATGG - Intergenic
1059660391 9:116394397-116394419 CCTAAGATCATGACAGTGGAGGG + Intronic
1059783611 9:117556272-117556294 CCTCAGATCATGTCTGTGGTTGG - Intergenic
1060935003 9:127509620-127509642 CCCAAGATGGAGACTGTGGAAGG + Intronic
1061053993 9:128212156-128212178 CCTGAGATCCTGGCTGTGGAAGG - Intronic
1061189323 9:129072356-129072378 CCTAAGATGGTGCCTGAGCAGGG - Intergenic
1061429961 9:130524568-130524590 CCACAGAGGGTCATTGTGGATGG - Intergenic
1061667019 9:132166494-132166516 TCTCAAATTGTGACAGTGGATGG - Exonic
1062256207 9:135622787-135622809 CCTCAGAATGTGACTGTGTCTGG - Intergenic
1062271959 9:135713923-135713945 CCTCACCTGGTGACAGTGGCAGG + Intronic
1062379459 9:136280317-136280339 GCTCAGAGGGTGTGTGTGGAAGG + Intergenic
1185606232 X:1368554-1368576 CCTCAGAATGTGACTGTGTTTGG + Intronic
1185726218 X:2424018-2424040 CCTCAGAATGTGACTGTGTTTGG + Intronic
1185794142 X:2950353-2950375 CCTCAGAATGTGACTGTGTTTGG + Intronic
1185986897 X:4845067-4845089 CCTCAGAGTGTGACTGTGTTTGG + Intergenic
1186043638 X:5509236-5509258 CCTCAGAATGTGACTGTGTTTGG + Intergenic
1186249707 X:7652532-7652554 CCAGAGATGGTGCCTGTGGCTGG - Intergenic
1186917037 X:14234052-14234074 CCACAGAGGGTCTCTGTGGAAGG - Intergenic
1187720730 X:22148165-22148187 AGTCAGATGGTGGCTGTGGCTGG + Intronic
1187842548 X:23504254-23504276 CCACAGCTGGGGACTGTGGTCGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190931994 X:54956713-54956735 CCTGAGATGAGGACTGTGGGAGG - Intronic
1192184262 X:68936037-68936059 CAATAGATGGTGACTGTTGATGG + Intergenic
1192328048 X:70150068-70150090 CCTCAGAAGTTGACTGGGTAGGG + Intronic
1192438986 X:71160958-71160980 TCTCACATGGTTTCTGTGGATGG + Intronic
1193191221 X:78573234-78573256 ACTCAGCTGATGCCTGTGGAGGG - Intergenic
1193366822 X:80644281-80644303 ACTCAGATGGTGTCCATGGAGGG - Intergenic
1194335123 X:92636628-92636650 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1195315647 X:103674958-103674980 CCTCAGATTGTGACTGTAGTTGG + Intergenic
1195967574 X:110442731-110442753 CCTCAGCTAGGGTCTGTGGATGG - Intronic
1196987677 X:121292892-121292914 CCTCAAATGGTGATTCTGGAGGG - Intergenic
1198277885 X:135113237-135113259 CCCCAGACGGTGCCTGGGGAAGG - Intergenic
1199055304 X:143286984-143287006 CCTCAGCTGTTGAGTGTAGAAGG + Intergenic
1199517181 X:148691047-148691069 CCTCAGATTGTGACTATGTTTGG - Intronic
1200643593 Y:5753680-5753702 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1202028013 Y:20544799-20544821 CCTTGGATGGTTACAGTGGATGG + Intergenic