ID: 1146054411

View in Genome Browser
Species Human (GRCh38)
Location 17:29574007-29574029
Sequence CTGGTCCATCTGGAGTTTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146054411_1146054425 28 Left 1146054411 17:29574007-29574029 CCTCAAAACTCCAGATGGACCAG 0: 1
1: 1
2: 1
3: 10
4: 168
Right 1146054425 17:29574058-29574080 ACTCAACACGCAGGCACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1146054411_1146054415 -10 Left 1146054411 17:29574007-29574029 CCTCAAAACTCCAGATGGACCAG 0: 1
1: 1
2: 1
3: 10
4: 168
Right 1146054415 17:29574020-29574042 GATGGACCAGGCCTCCGGAACGG 0: 2
1: 0
2: 0
3: 3
4: 77
1146054411_1146054420 19 Left 1146054411 17:29574007-29574029 CCTCAAAACTCCAGATGGACCAG 0: 1
1: 1
2: 1
3: 10
4: 168
Right 1146054420 17:29574049-29574071 CGCCCACACACTCAACACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1146054411_1146054426 29 Left 1146054411 17:29574007-29574029 CCTCAAAACTCCAGATGGACCAG 0: 1
1: 1
2: 1
3: 10
4: 168
Right 1146054426 17:29574059-29574081 CTCAACACGCAGGCACGCGGGGG 0: 1
1: 0
2: 1
3: 3
4: 34
1146054411_1146054424 27 Left 1146054411 17:29574007-29574029 CCTCAAAACTCCAGATGGACCAG 0: 1
1: 1
2: 1
3: 10
4: 168
Right 1146054424 17:29574057-29574079 CACTCAACACGCAGGCACGCGGG 0: 1
1: 0
2: 0
3: 10
4: 91
1146054411_1146054423 26 Left 1146054411 17:29574007-29574029 CCTCAAAACTCCAGATGGACCAG 0: 1
1: 1
2: 1
3: 10
4: 168
Right 1146054423 17:29574056-29574078 ACACTCAACACGCAGGCACGCGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146054411 Original CRISPR CTGGTCCATCTGGAGTTTTG AGG (reversed) Exonic
900881933 1:5388510-5388532 CTGGTCCATCTGTTGATCTGTGG - Intergenic
902561968 1:17283174-17283196 GTGTTCCATCTGGAGCCTTGGGG - Exonic
905518178 1:38577698-38577720 CTGGGGCATCTGGAGTTCTTGGG - Intergenic
906027727 1:42688283-42688305 GTGGTTCATCTGAAGTTTTCAGG - Intronic
909355410 1:74703142-74703164 CTTGTACTACTGGAGTTTTGTGG + Intergenic
913452158 1:118999793-118999815 CTGGTGCATCTGGAGGAGTGGGG + Intergenic
913968637 1:143397161-143397183 CTTGGCCATTTGGAGTTTTCAGG + Intergenic
914063016 1:144222760-144222782 CTTGGCCATTTGGAGTTTTCAGG + Intergenic
914116134 1:144743594-144743616 CTTGGCCATTTGGAGTTTTCAGG - Intergenic
915083220 1:153366253-153366275 CTGGGACATCTTGTGTTTTGAGG - Intergenic
920454167 1:206085428-206085450 CTAATTCATCTGGAGCTTTGTGG + Intronic
924707472 1:246511541-246511563 CTGGCCCATGGGCAGTTTTGGGG - Intergenic
1063268837 10:4484810-4484832 CTGGTCAATATGGAGTATTAAGG - Intergenic
1067258899 10:44668268-44668290 CTTGTCAAGGTGGAGTTTTGAGG - Intergenic
1068258320 10:54543108-54543130 GTGGGCCATTCGGAGTTTTGGGG - Intronic
1070573537 10:77659953-77659975 CAGTTACATCTGGAGCTTTGGGG - Intergenic
1071301320 10:84257990-84258012 CTGTACCATCTGCAGTTTGGGGG - Exonic
1074458953 10:113619701-113619723 CTGGTCTTTCTGGACTTTTCTGG - Intronic
1075765554 10:124890310-124890332 CTGGTCATCCTGGAGATTTGTGG - Intergenic
1076236126 10:128864867-128864889 CTGGTACAACTGCAGTTCTGGGG + Intergenic
1084590893 11:70089596-70089618 TGGGTCCCTCTGGAGTTTTGAGG + Intronic
1089598155 11:119595528-119595550 CTCGAACTTCTGGAGTTTTGAGG + Intergenic
1092985861 12:13845710-13845732 CATGTTCATCTGGATTTTTGTGG + Intronic
1093871080 12:24291775-24291797 CTGGTCAATCAGGAATATTGTGG - Intergenic
1096125591 12:49117105-49117127 CTGTGCCCTCTGGGGTTTTGAGG + Intergenic
1097050084 12:56217616-56217638 CTGGTCCATCTGGGGATTTGGGG - Intronic
1099257318 12:80329864-80329886 CTGGTCTATCAGCAGTTTTAGGG - Intronic
1100489195 12:95062561-95062583 CTGCTGCATCTGGAGTTGTAAGG + Exonic
1101428725 12:104608807-104608829 CTACTCCATTTGGAGGTTTGTGG + Intronic
1103007769 12:117435673-117435695 CGGGTCCCTCTGGAGTTTGGTGG + Intronic
1103612324 12:122131395-122131417 CTGGGCCATGTGGGGTTTAGGGG + Intronic
1105426508 13:20299393-20299415 CTGGTGGATCTGGAGTGTAGGGG - Intergenic
1107935454 13:45341733-45341755 CTGCCCCAGCTGGAGTTTTTGGG + Intergenic
1111095285 13:83505891-83505913 ATGGCTCATCTGGAGTTTAGGGG + Intergenic
1111997305 13:95177384-95177406 CTGGTCCATCAGCAGTTTCTTGG + Intronic
1111998126 13:95184814-95184836 CTGGTCCATCAGCAGTTTCTTGG + Intronic
1114052217 14:18930073-18930095 CTGGCCCAGGTGGGGTTTTGGGG + Intergenic
1114110342 14:19471851-19471873 CTGGCCCAGGTGGGGTTTTGGGG - Intergenic
1115473751 14:33794814-33794836 TTGGGCCATCTTGAGTTTGGGGG + Intronic
1116137070 14:40939706-40939728 CTGGACAACCTGGAGTTCTGAGG - Intergenic
1125189554 15:36974783-36974805 CTGGTTTCTCTGGCGTTTTGGGG + Intronic
1126562685 15:50060767-50060789 GTGATACACCTGGAGTTTTGTGG + Intronic
1128809318 15:70559245-70559267 CTGTTCCATCTGGCATTTTCTGG + Intergenic
1129390069 15:75215960-75215982 CTGGGCCAGCTGGAGGTTTAGGG - Intergenic
1130199379 15:81810775-81810797 CTGGACCAGCAGGAGCTTTGTGG - Intergenic
1130991350 15:88877734-88877756 CTGGGCCATTTGCGGTTTTGTGG - Exonic
1131299440 15:91183540-91183562 CTGTGTCATGTGGAGTTTTGGGG - Intronic
1131611448 15:93968779-93968801 CTAAACCATCTGGTGTTTTGTGG + Intergenic
1135505260 16:23030946-23030968 CTGGTATATGTGGAGTTCTGAGG - Intergenic
1136344100 16:29664146-29664168 CTGGTCCTACTGGAGGTTTCTGG - Exonic
1137822823 16:51462065-51462087 CTGTTCCATCTGAGGTTCTGGGG - Intergenic
1139596807 16:67963031-67963053 CTGGTCCATTTGCAGCTTTAGGG - Intronic
1139740209 16:69028917-69028939 CTGGTCCACTTGGAGATCTGGGG - Intronic
1140127566 16:72130997-72131019 CTGACCCTTCTGGAGTTTAGAGG + Intronic
1140738360 16:77919101-77919123 AAAGTCCTTCTGGAGTTTTGAGG + Intronic
1141701669 16:85645184-85645206 CTAGTCCATCTGGGGGTCTGGGG + Intronic
1141941321 16:87278035-87278057 CTGCTCCCTCTGGAGTTTCTGGG - Intronic
1142257240 16:89019914-89019936 CTGCTCTGTCTGGAGATTTGGGG - Intergenic
1146054411 17:29574007-29574029 CTGGTCCATCTGGAGTTTTGAGG - Exonic
1149054571 17:52347646-52347668 CAGGTCTATATGCAGTTTTGGGG + Intergenic
1149483538 17:57023262-57023284 CTGGTCCTTTTGGGTTTTTGTGG - Intergenic
1150775044 17:68074530-68074552 CTGGTCCATATTGAGATGTGTGG + Intergenic
1151258460 17:72898129-72898151 CTGGTGCATCTGGCAATTTGGGG + Intronic
1151958420 17:77392366-77392388 CTGGTGCATTTGAAGTTTTCAGG + Intronic
1152694388 17:81736440-81736462 AGGGTCCATCTGGTTTTTTGTGG + Intergenic
1203168662 17_GL000205v2_random:125014-125036 GTGGTCTATCTGGAATATTGTGG - Intergenic
1153412530 18:4809906-4809928 TTCTTCCCTCTGGAGTTTTGTGG + Intergenic
1157365829 18:47063402-47063424 CTGGGGCTTCTGGAGCTTTGTGG + Intronic
1157833183 18:50876315-50876337 CCTGTCCTTCTGGAGTTTTATGG - Intergenic
1160469350 18:79114465-79114487 CTGCTTCATCTGGAGTTCTCTGG - Intronic
1162244637 19:9389637-9389659 CTGGTTACTCTGCAGTTTTGGGG + Intergenic
1162571558 19:11477261-11477283 CTGGTTCATTAAGAGTTTTGTGG + Intronic
1163742685 19:19025835-19025857 TTGGTCCCTCTGCAGTTTTGGGG - Exonic
1166349564 19:42189319-42189341 CTGGTGCAGCTTGAGTCTTGTGG - Intronic
1202702426 1_KI270712v1_random:174631-174653 CTTGGCCATTTGGAGTTTTCAGG + Intergenic
926130193 2:10298151-10298173 CTGGTCCATCTACAGATTTGAGG + Intergenic
926148738 2:10412756-10412778 CTGAGCCTTCTGGAATTTTGGGG + Intronic
926230975 2:11003572-11003594 CTGGTCCCTCTGAAGCTCTGGGG - Intergenic
927266784 2:21161365-21161387 CTGGTCCAGCTGCAGACTTGCGG - Intergenic
929024328 2:37585239-37585261 CTGTTCCACCTGAAGATTTGAGG - Intergenic
934173338 2:89558085-89558107 CTTGGCCATTTGGAGTTTTCAGG + Intergenic
934283653 2:91632438-91632460 CTTGGCCATTTGGAGTTTTCAGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934573127 2:95384549-95384571 CTGGTCCCTCTGGGGTCCTGAGG - Exonic
935166858 2:100577312-100577334 CGGGTGGATCAGGAGTTTTGAGG - Intergenic
935326337 2:101941197-101941219 CTGGTCCTTCTGGTGTTATTAGG + Intergenic
939207248 2:139122841-139122863 CTGCTCATTCTGGATTTTTGTGG + Intergenic
942695811 2:178643790-178643812 CTGGTCACTCTGAAATTTTGGGG - Intronic
943116303 2:183675965-183675987 CTTGTCTTTCTGGAGTTTTATGG - Intergenic
946816381 2:223582581-223582603 GTGGTCCATATGTGGTTTTGTGG - Intergenic
947169104 2:227293243-227293265 CTGGCCCACCTGGACATTTGGGG + Exonic
948291306 2:236826879-236826901 CCTGTCCTTTTGGAGTTTTGTGG + Intergenic
948780822 2:240320586-240320608 CTGGACCGTCTGGACTCTTGGGG + Intergenic
1170553575 20:17497756-17497778 CTGGTGAATCTGGAGTATTCAGG + Intronic
1171212394 20:23327014-23327036 CTGATCCACCTGGAGTGTGGAGG + Intergenic
1173722486 20:45271727-45271749 CTGGTCCACCTACAATTTTGTGG + Intergenic
1173985392 20:47257835-47257857 CTGGCCCAAATAGAGTTTTGGGG + Intronic
1174153543 20:48502506-48502528 GTTGTGGATCTGGAGTTTTGGGG - Intergenic
1179334820 21:40440920-40440942 ATGGACCACCTGGAGCTTTGAGG + Intronic
1180470689 22:15652446-15652468 CTGGCCCAGGTGGGGTTTTGGGG + Intergenic
1181442164 22:22942237-22942259 GTGGTCAATGTGGAGTCTTGGGG - Intergenic
1183904154 22:41027501-41027523 CTGGTCCCTCTGGGGTATGGCGG - Intergenic
1184285139 22:43466312-43466334 CTGTTCTATCTGGGGTGTTGTGG + Intronic
1184405920 22:44300788-44300810 CTGGCCCATCTGGGGTTCTGGGG - Intronic
950375141 3:12565354-12565376 ATGTTAGATCTGGAGTTTTGTGG + Intronic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
952400758 3:32961224-32961246 CTGGTGCAAATGGAGTTTGGGGG - Intergenic
959037574 3:101384529-101384551 CTGGTCCAACTGCAGTCTTGTGG + Intronic
960008257 3:112804325-112804347 CTGCTCCTTCTGGAGATTTCTGG + Intronic
963127298 3:141827580-141827602 CTGGTCCATCTGCAGTTTTGAGG - Intergenic
966660321 3:182407562-182407584 TTAGTCCATCTCTAGTTTTGTGG + Intergenic
967149177 3:186632660-186632682 CTGGTGGATCAGGAGTTTAGGGG - Intergenic
969638368 4:8382336-8382358 CTGGTCCATACGGAGTACTGTGG - Intronic
969656418 4:8501264-8501286 CTGGTCCATCGGGGGATGTGGGG + Intergenic
969827189 4:9766895-9766917 CTTGGCCATTTGGAGTTTTCAGG + Intergenic
970942440 4:21650803-21650825 CATTTCCATCTGGAGTTTGGGGG + Intronic
971529205 4:27662988-27663010 CTGAAACATCTTGAGTTTTGTGG + Intergenic
977993819 4:103478192-103478214 CTGGGCCATCTGGATTCTTTAGG - Intergenic
978526577 4:109673306-109673328 ATGGTCCATGTGGTGGTTTGAGG - Intronic
979134679 4:117095229-117095251 CTTGTTCTTCTGGAATTTTGTGG + Intergenic
981003977 4:139856003-139856025 CAGGTCCATCTGGAGTCCTGAGG - Intronic
982334561 4:154219501-154219523 AAGGGCCATCTGGATTTTTGTGG - Intergenic
983286122 4:165741848-165741870 CTGGTTCATAGGGTGTTTTGGGG - Intergenic
984714758 4:182916169-182916191 CTGTCCCATCTGGATTATTGAGG - Intronic
989131684 5:38113385-38113407 CTGGACCATCTGGGGTTGTTGGG + Intergenic
991260238 5:64659580-64659602 CTGGACCACATGGAGTTTCGGGG + Intergenic
992960537 5:81953756-81953778 CTGGTCCATCTGAGGACTTGAGG - Intergenic
993085949 5:83364005-83364027 CCAGTCCATGTGGAGGTTTGAGG + Intergenic
994656851 5:102604790-102604812 CTGTTCCCTCTAGAGTTTTATGG + Intergenic
996302688 5:122007666-122007688 CTGGTCCAGTGGGAGTTTTCTGG + Intronic
999821375 5:155232308-155232330 CTTTTCCTTCTGGAGTTTTCTGG + Intergenic
1000177886 5:158776010-158776032 ATAGTCTTTCTGGAGTTTTGTGG - Intronic
1010664345 6:78610453-78610475 CTGATCCAACTTTAGTTTTGTGG - Intergenic
1011494806 6:87927343-87927365 CTGCTCCTTCTGGACTTTGGGGG + Intergenic
1012663678 6:101938361-101938383 CTGATCTATCTGGAGTTAAGGGG - Intronic
1012834844 6:104252078-104252100 CTGGTAGATCTACAGTTTTGAGG - Intergenic
1014699714 6:124669527-124669549 CTGGCCCATGTGGATATTTGCGG + Intronic
1017839041 6:158206380-158206402 CTTGTCCATCTGGCGATGTGTGG - Intergenic
1018715819 6:166532170-166532192 CTGGTCTTTCTGGCTTTTTGAGG - Intronic
1021441556 7:20682763-20682785 CTGGTCCATCTGTGGTGATGTGG - Intronic
1024341068 7:48260759-48260781 ATGCTCCATTTGTAGTTTTGTGG + Intronic
1024580299 7:50795534-50795556 CAGGGGCATCTGGAGTTTGGGGG - Intergenic
1024607269 7:51032157-51032179 CTGGTCCTTCTTGGGCTTTGGGG - Intronic
1025233419 7:57218015-57218037 GTTGTGGATCTGGAGTTTTGGGG + Intergenic
1026340594 7:69430783-69430805 TTGGTCCTGCTGGAGATTTGGGG - Intergenic
1026611794 7:71866672-71866694 CTGGACCATCTCTAGATTTGGGG - Intronic
1026981037 7:74526699-74526721 CTGGTTCATCTGGTTTATTGGGG - Intronic
1027975574 7:85150002-85150024 CTGTTCCATGAGGACTTTTGGGG - Intronic
1028290453 7:89058731-89058753 CTTGTCCATCTGGAGTGCAGTGG + Intronic
1030513953 7:110518744-110518766 CTGGTCCAGCTGCAGCCTTGTGG - Intergenic
1031516258 7:122702691-122702713 CTGTTTCATCTGGACTTTTGAGG - Exonic
1035426905 7:158784092-158784114 CTGGTCCATCCTGGGTCTTGGGG - Intronic
1037862151 8:22412993-22413015 ATTGTCCATAGGGAGTTTTGGGG + Intronic
1042174035 8:66021463-66021485 CTGGACCATCTGGAGGAGTGAGG + Intergenic
1044804141 8:95987642-95987664 CTGGTCCATCTGCAAGTCTGTGG - Intergenic
1045006992 8:97924833-97924855 CTGGTGCATCTTGAGTATTCTGG + Intronic
1045026266 8:98089875-98089897 CTGGACCTTCAGGAGTTTTATGG - Exonic
1045718660 8:105079625-105079647 CTGGTTCAACTGAGGTTTTGAGG - Intronic
1045824079 8:106376127-106376149 CTGGTCACTGAGGAGTTTTGAGG + Intronic
1050614025 9:7382940-7382962 CTGGTTCATGTAGAGTTTAGGGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056182375 9:84097780-84097802 CTTGTCCATCTGGAGTGCAGTGG - Intergenic
1058747575 9:108006989-108007011 CTTTTCCATCTGGGGTTCTGTGG - Intergenic
1059641960 9:116226253-116226275 CTTGTTCATCTTGAGGTTTGGGG + Intronic
1060349871 9:122850941-122850963 TTGGTCAATCTGGATTTTTAGGG - Intronic
1060362269 9:122970715-122970737 CTGGGACTTTTGGAGTTTTGGGG - Intronic
1203428813 Un_GL000195v1:69568-69590 GTGGTCTATCTGGAATATTGTGG - Intergenic
1203437473 Un_GL000195v1:153683-153705 GTGGTCTATCTGGAATATTGTGG + Intergenic
1186545241 X:10442363-10442385 GTGGTCCAAGTGGAGGTTTGTGG + Intergenic
1193428641 X:81372387-81372409 CTGGTCCCTCTGGTGCTTGGAGG - Intergenic
1197007489 X:121519622-121519644 CTGGTCCAACTGGGCTTTTTAGG - Intergenic
1197732835 X:129826705-129826727 CTGGCACAGCTGGAGTTCTGGGG - Intronic
1199215051 X:145253323-145253345 CTGGTCCTTCTTTAGGTTTGAGG + Intronic
1199614898 X:149648499-149648521 CTGGTCCAGCTGCAGGTTTGTGG + Intergenic
1201945077 Y:19502688-19502710 TTCGCACATCTGGAGTTTTGGGG - Intergenic