ID: 1146057640

View in Genome Browser
Species Human (GRCh38)
Location 17:29589266-29589288
Sequence GGCCGCCGCCGGGCGGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 688
Summary {0: 1, 1: 1, 2: 8, 3: 77, 4: 601}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146057640_1146057657 21 Left 1146057640 17:29589266-29589288 CCGGCGCCCGCCCGGCGGCGGCC 0: 1
1: 1
2: 8
3: 77
4: 601
Right 1146057657 17:29589310-29589332 GGCCCCGCCGCGCTTACCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 72
1146057640_1146057648 0 Left 1146057640 17:29589266-29589288 CCGGCGCCCGCCCGGCGGCGGCC 0: 1
1: 1
2: 8
3: 77
4: 601
Right 1146057648 17:29589289-29589311 TGGCTGTGCGGTCCCGCCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 134
1146057640_1146057656 20 Left 1146057640 17:29589266-29589288 CCGGCGCCCGCCCGGCGGCGGCC 0: 1
1: 1
2: 8
3: 77
4: 601
Right 1146057656 17:29589309-29589331 CGGCCCCGCCGCGCTTACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 145
1146057640_1146057655 19 Left 1146057640 17:29589266-29589288 CCGGCGCCCGCCCGGCGGCGGCC 0: 1
1: 1
2: 8
3: 77
4: 601
Right 1146057655 17:29589308-29589330 CCGGCCCCGCCGCGCTTACCCGG 0: 1
1: 2
2: 2
3: 20
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146057640 Original CRISPR GGCCGCCGCCGGGCGGGCGC CGG (reversed) Intronic
900121319 1:1049773-1049795 CGACGCGGCCGGGCGGGCACTGG - Exonic
900180390 1:1308574-1308596 GGCCGCGTCCGCGCGCGCGCAGG + Exonic
900227612 1:1540387-1540409 GGCCGGGGCCGGGGGGGCGCCGG - Intronic
900413926 1:2526442-2526464 GGTAGCCGCAGGCCGGGCGCCGG - Exonic
900626585 1:3611370-3611392 GGGCTCCGCGGAGCGGGCGCGGG - Exonic
901022243 1:6261256-6261278 GGCCGGCCGCGGGCGGACGCGGG - Intergenic
901361305 1:8703222-8703244 GGGCACCGCGGCGCGGGCGCAGG + Intronic
901673085 1:10867241-10867263 AGGCGCGGGCGGGCGGGCGCCGG + Intergenic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
901836290 1:11926103-11926125 GCCCGCCGCCCGCCGCGCGCCGG + Exonic
902214121 1:14924039-14924061 CGCCGCGGCGGGGCGGGGGCGGG + Intronic
902400833 1:16155857-16155879 GGCCGCGGCCGCGGCGGCGCAGG - Exonic
902478413 1:16699825-16699847 GGCAGCCGGCGGGCGCGGGCTGG + Intergenic
903072102 1:20731717-20731739 GGCCCCTGAGGGGCGGGCGCGGG + Intronic
903153340 1:21428424-21428446 CGCCGCCGCCGGGCGCGCCCAGG - Intergenic
903250957 1:22052895-22052917 TGCGTCCTCCGGGCGGGCGCGGG + Intronic
903251101 1:22053294-22053316 GGCCGCGGCGGGGCGGTGGCAGG + Intronic
903492903 1:23743306-23743328 CGCGGCCGCCGGGTGGGCGCTGG + Exonic
903597105 1:24503085-24503107 CGCCGCCGCAGGACGGGAGCCGG - Exonic
903652444 1:24930156-24930178 GGCCGCGGCGGGGCCCGCGCGGG + Intronic
903750580 1:25618049-25618071 GGCCCCCGCCGCGCCGGCCCCGG + Exonic
904063002 1:27725962-27725984 TGCGGCAGGCGGGCGGGCGCAGG - Intronic
904641956 1:31937946-31937968 GGCGGCCCCCGCGCCGGCGCCGG - Intronic
904642008 1:31938133-31938155 CGCCGCCGCCGGGCCGGGCCGGG - Exonic
904822658 1:33255969-33255991 GGCGGCCGCCGGGCCTGGGCAGG + Intergenic
905037996 1:34929815-34929837 CGCCGCCCGCGGGCGGCCGCCGG + Intergenic
905179212 1:36156181-36156203 GGCCGGCGCCGGGCGGGGAACGG + Exonic
905308398 1:37034113-37034135 GGGCGCCGCCGAGCGTGCCCGGG + Exonic
905440863 1:37996087-37996109 GTCGGACGCCGGGCGGGCGAGGG + Intergenic
905449092 1:38045903-38045925 GGCCGACGTGGGGCTGGCGCTGG - Exonic
905518385 1:38578708-38578730 GGGCGGGGTCGGGCGGGCGCGGG + Intergenic
905580781 1:39081647-39081669 GGCCGCCGGCTGCCGGGAGCTGG - Intronic
905789731 1:40783743-40783765 GGCGGCCGCGGGGCGGGCGGGGG + Intergenic
905789799 1:40783972-40783994 GGGCGACCCGGGGCGGGCGCGGG - Intergenic
906130762 1:43453852-43453874 GGCGGGCGGCGGGCGGGGGCGGG + Exonic
906214383 1:44030524-44030546 GGGCGGGGCCGGGCGGCCGCAGG - Intronic
906292988 1:44632009-44632031 CGCCGCCGCCGGGCAGCCACGGG + Intronic
906356934 1:45115252-45115274 GGTGGCTGCCGGGCGGGGGCGGG + Intronic
906615837 1:47232253-47232275 GGCGGGCGCGGGGCGGGCGGGGG - Intergenic
906637006 1:47416478-47416500 CGCCGCCCCGGGCCGGGCGCGGG - Exonic
906720117 1:47997825-47997847 GTCCGCCGCCGAGCCGGCGGAGG - Intergenic
907429923 1:54405891-54405913 GGCTGCGGGCGGGCGGGCGGTGG - Intronic
907767367 1:57424159-57424181 GCGGGGCGCCGGGCGGGCGCGGG - Intronic
908582036 1:65525975-65525997 GGCCAGCGCCCGGCGGGCGGCGG + Intronic
908582038 1:65525977-65525999 CCCCGCCGCCCGCCGGGCGCTGG - Intronic
910292913 1:85616331-85616353 GCCCGCGGCCGGGCGTGCCCAGG - Intergenic
911208561 1:95117327-95117349 GGCCGCGGCCGCTCGGGCTCCGG - Exonic
911219723 1:95234131-95234153 GGGCGCCCCCGGGTGGCCGCGGG + Intronic
912514785 1:110210817-110210839 AGCGGCGGCCGGGCGGGCGGGGG - Intergenic
912576365 1:110675326-110675348 CGCCGCGGCCCCGCGGGCGCCGG + Intergenic
913209394 1:116570615-116570637 GGGGGCCGGCGGGGGGGCGCAGG + Intronic
914197391 1:145454548-145454570 GGCCCCGGCAGGGAGGGCGCGGG + Intergenic
914753146 1:150549304-150549326 GGCCGCCGAGGGGCGCGGGCTGG + Intergenic
914845633 1:151282309-151282331 GGCGGCCGCGGGGAGGGCGGCGG + Exonic
915463490 1:156082762-156082784 GGCCGGCGCGGGGCAGGAGCGGG - Intronic
916694423 1:167221415-167221437 GGCCGGGGCCGGGCGGGCGCGGG + Intronic
917141624 1:171841411-171841433 GGCAGCCGCGGGGCGGGGGCGGG + Intergenic
919809397 1:201399330-201399352 GGCGGCGGCCGGCGGGGCGCGGG - Exonic
921010295 1:211134174-211134196 AGCCGCCTCCGGGTGGGCGGAGG + Intergenic
922315059 1:224434626-224434648 GGGCGCCGCGGGGCGGCTGCGGG + Intronic
922496502 1:226062231-226062253 GGCTGCCCCCGCGCGGGCCCCGG - Intronic
922766411 1:228158708-228158730 GGCCGCCGCAGGGAAGGCGCAGG - Exonic
923372736 1:233328688-233328710 GGCGGGGGCCGGGCGCGCGCGGG - Exonic
923698901 1:236281752-236281774 GGGGTCCGCCGGGCAGGCGCTGG - Exonic
924754768 1:246931434-246931456 GGCCTAGGCCGGGCGTGCGCGGG - Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1063664715 10:8054457-8054479 GGCCGCCGGCGGAGGGGCGGCGG - Intronic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1065099513 10:22320594-22320616 GGCCGAGGCGGGGCGCGCGCGGG - Intronic
1067116231 10:43437269-43437291 GGCGGCCGGCGGGCAGGGGCCGG + Intronic
1067405876 10:46023250-46023272 GGCTGGCGCCGGGCAGGAGCCGG - Intronic
1067474467 10:46556749-46556771 GGCCGCGGCGGGGCGGTGGCAGG - Intergenic
1067478045 10:46579068-46579090 GGGCGCCGTCGGGCGAGCACAGG - Intronic
1067616695 10:47762719-47762741 GGGCGCCGTCGGGCGAGCACAGG + Intergenic
1067694174 10:48523630-48523652 GGGCGGCGCAGGGCGCGCGCCGG + Intronic
1068544937 10:58334929-58334951 GGGCGCGGCGGGGAGGGCGCAGG + Intergenic
1070257772 10:74826043-74826065 GGGCGCGGGCGGGCGCGCGCGGG - Intronic
1070570808 10:77638243-77638265 TGCCGCGGCCGGGCGCGCACTGG - Intronic
1070800600 10:79242689-79242711 GGAGGCCGCCGGGAAGGCGCTGG - Intronic
1071309385 10:84328586-84328608 GGCGGAGTCCGGGCGGGCGCCGG + Exonic
1071439750 10:85679846-85679868 GGCTGCCTCAGGGCAGGCGCTGG - Intronic
1071544861 10:86521569-86521591 GAGCGCCGCCGGCCGGGCCCAGG + Exonic
1072491271 10:95907940-95907962 GGGCGCCGTAGGGCTGGCGCAGG + Intronic
1072772494 10:98152998-98153020 GGCGGCGGCCGGGCGGAGGCGGG - Intronic
1072970061 10:100009799-100009821 GGCCGGAGCCGGGCGGGGGCCGG - Intronic
1072994275 10:100229494-100229516 GGCTGCGGCCGGGCGCGGGCGGG - Exonic
1073249794 10:102114582-102114604 GGCCGCCGCGGGGCGGGCCGAGG - Intronic
1073875284 10:107914999-107915021 GGCCGCGGCGGGGCGGGTGGAGG + Intergenic
1074008942 10:109457049-109457071 GGCCGCGGCGGGGCAGGCGTAGG + Intergenic
1075032168 10:119030615-119030637 GGCGGCGGGCGGGCGGGCGGCGG - Exonic
1075040629 10:119104389-119104411 GGCCGCGGGCGGGCGGGCGAGGG - Intronic
1075207066 10:120457156-120457178 GGCGGGCGCCGGGCGGGGGCAGG - Exonic
1075768903 10:124917093-124917115 GGCAGCAGCGGGGCGGGCGGCGG + Intergenic
1076657936 10:132036825-132036847 GGCGGCCGTGGGGCGGGCGGGGG + Intergenic
1076722204 10:132397562-132397584 GGCGGGCGCCGGGCCGGGGCGGG + Intronic
1076836022 10:133021310-133021332 GGCCGACGCCCGGCGGGCCTGGG + Intergenic
1076844210 10:133061017-133061039 GGCCCCCGCCGGGAGGGCACAGG - Intergenic
1076850079 10:133088348-133088370 CGCCGCGGCCGGGCTGGGGCGGG + Intronic
1076921503 10:133456824-133456846 GGCAGCAGCCGAGCGGGGGCGGG + Intergenic
1077021061 11:417342-417364 GGCTCGCGCCGGGCGGGGGCGGG + Intronic
1077043738 11:535459-535481 GGCCGGGGCGGGGCGGGGGCGGG + Exonic
1077105954 11:842732-842754 TGCCGCGGCCGCGCGGGCCCGGG - Intergenic
1077214527 11:1389952-1389974 GGCCGCTGACGGGCGTGCGCTGG + Intronic
1077253958 11:1572421-1572443 GGCTGCCGCGGGGGGGGGGCGGG + Intergenic
1077404604 11:2377482-2377504 GGCGGCGGGCGGGCCGGCGCGGG - Exonic
1077514241 11:2992150-2992172 GGCCGCCGCCGCGCCCGCGCCGG + Intronic
1077637841 11:3855631-3855653 GGGCGGCGCGGGGCGGGCCCGGG - Intronic
1077976260 11:7251849-7251871 GGCCGCCGGGGGGCGGGGCCAGG - Intronic
1078246128 11:9574220-9574242 GTCCGCGCCCGGGCAGGCGCCGG - Exonic
1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG + Intergenic
1079689412 11:23403546-23403568 CGCCGCCGCGGGACGGGCCCAGG + Intergenic
1080551349 11:33376260-33376282 GGCGGCCGCGGGGCGCGCTCGGG - Intergenic
1081705580 11:45180666-45180688 GGCGGGCGGGGGGCGGGCGCTGG + Intronic
1081812802 11:45922860-45922882 GGCCGCCGACGGGGGCGCTCAGG - Exonic
1081861076 11:46333570-46333592 GCCCGCCGCCTGCCTGGCGCTGG + Intronic
1081870803 11:46381775-46381797 GGCCGCGGCCGGGCGGACCAGGG - Intronic
1083120871 11:60510556-60510578 GGCGGCGGCCGGACGGGGGCTGG - Intergenic
1083171088 11:60924487-60924509 TGCAGCCGCGGGGCGGGCGGCGG + Exonic
1083970206 11:66070048-66070070 GGCCGCGGCCGGCCGTGGGCGGG + Intergenic
1084070072 11:66728171-66728193 AGCCGCGGCCGGGCGGGCGGGGG + Intronic
1084295756 11:68212939-68212961 GGCCGGTGCGGGGCCGGCGCGGG - Intronic
1084295761 11:68212950-68212972 GGCTGCGGCCGGGCCGGTGCGGG - Intronic
1084338321 11:68475522-68475544 GGCAGCGGCCGGGCGGGGGCTGG + Intronic
1084972993 11:72781595-72781617 CAGCGACGCCGGGCGGGCGCGGG + Intronic
1085295649 11:75430242-75430264 GGCGGCGGCCGTGCTGGCGCTGG - Exonic
1085312786 11:75526014-75526036 GCCCGCAGCCGGCCGGGGGCGGG - Intergenic
1085622262 11:78046349-78046371 GGGCGCTGCCGGGCAGGCCCAGG - Intronic
1085666214 11:78417609-78417631 GGCCGCCCAGGGGCGGGCGGGGG - Intronic
1086590481 11:88509178-88509200 GAGCGCGGCCGCGCGGGCGCCGG + Exonic
1087014614 11:93543213-93543235 GCGAGCCGGCGGGCGGGCGCGGG - Intronic
1087946248 11:104164018-104164040 GGCCAGCGCAGGGCGAGCGCAGG - Exonic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1089198185 11:116707566-116707588 GGCCGCCGCGGGTGGGGTGCGGG - Intergenic
1089262429 11:117232214-117232236 GGCAGGGGCCGTGCGGGCGCTGG + Exonic
1089520103 11:119057423-119057445 GGTCGCCCCGGGGCCGGCGCTGG - Intergenic
1089543639 11:119206226-119206248 GGGCGGCGCCGGGAGTGCGCGGG - Exonic
1090323062 11:125863403-125863425 GGCGGCTGGCGGGCGGGCGGAGG - Intergenic
1090344995 11:126062654-126062676 AGCCGCCGCCGCGCGCGCGCGGG - Intronic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091393253 12:138710-138732 GGAGGCCGAGGGGCGGGCGCCGG + Exonic
1091434057 12:460002-460024 GGAGGCAGGCGGGCGGGCGCCGG + Intergenic
1091473822 12:753073-753095 GGCCGCCACCGCCCGGGCGTCGG + Exonic
1091473869 12:753244-753266 AGCGGCGGCCGGGCGGGCGGTGG - Exonic
1091616122 12:2052686-2052708 GGCCGCCGGCGGGCGAGGGGCGG - Intronic
1091916177 12:4272967-4272989 GGCCGCCGCAGGCCGGGGGCAGG - Intergenic
1092046198 12:5433119-5433141 GGTGGCCACCGGGTGGGCGCTGG - Intronic
1092230635 12:6773735-6773757 GGGCGCCGCCGGGTGAGGGCCGG - Exonic
1092241987 12:6840936-6840958 GGCAGGTGACGGGCGGGCGCGGG + Exonic
1092253424 12:6914102-6914124 GGCCGCCCTCGGGCAGGCGTGGG + Exonic
1093435281 12:19129577-19129599 GGCGGCCGGCCGGCGGCCGCCGG + Intergenic
1093464861 12:19439411-19439433 GGCGGGCGCCGGGCGGGGGCGGG + Intronic
1094155410 12:27332996-27333018 GGCCGGGGCAGGGCGGGCCCGGG + Intronic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1094719941 12:33052925-33052947 CGCCGCCGCCGGGCAGGCCGGGG + Intergenic
1095349192 12:41188895-41188917 GGGGGCCGCCGGGCGGCCGCTGG + Exonic
1095465513 12:42484104-42484126 CGCCGCCCGCGGGCGGGAGCGGG - Intronic
1096134587 12:49188795-49188817 CGCCGCCGCAGTGCGGGTGCAGG - Intronic
1097227672 12:57488138-57488160 GGCCGCCGCCGGGAGAGCCCGGG + Exonic
1097794170 12:63844449-63844471 TACGGCCGCTGGGCGGGCGCGGG - Exonic
1098288500 12:68933169-68933191 CGGCCCCGCCGGGCGGCCGCGGG - Exonic
1102256425 12:111418189-111418211 GGCCGCCGCCGGGGAGGCTGAGG - Exonic
1102278337 12:111599331-111599353 GGCCGGGGCCGGGCGGGGGAGGG + Exonic
1103085748 12:118060994-118061016 GGGCCCCGCCGGGCGGGAACGGG + Intronic
1103595385 12:122022025-122022047 GGCCGCCGCGGAGCGCGAGCAGG + Exonic
1103764331 12:123270692-123270714 GGCCGCAGCCGGGCGCTCCCAGG - Intronic
1104887038 12:132116915-132116937 TGACGGCGCAGGGCGGGCGCCGG - Intronic
1104891790 12:132143782-132143804 GGCCGCCTCGGCGCTGGCGCTGG + Exonic
1105830668 13:24160953-24160975 CGGCTCTGCCGGGCGGGCGCGGG + Intronic
1105927185 13:25018640-25018662 TGCCGCGGCCGGGCTGGCCCAGG + Intergenic
1105975500 13:25468882-25468904 GGCCGCGGGCGGGCGGCCACCGG - Intronic
1106157507 13:27171826-27171848 GGCGGCCGGCAGGCGGGGGCTGG - Exonic
1107604048 13:42040856-42040878 GGCGGCCGGCGGGCGCGGGCTGG + Intronic
1107978694 13:45714063-45714085 GGCAGCCGTCGGGCAGGCCCGGG - Exonic
1108643661 13:52406208-52406230 GGCGGGCGCCGGGAGGGCGGGGG + Intronic
1110569858 13:76991921-76991943 AGCCGCCGCGGGCCGGGCGCGGG + Exonic
1110860509 13:80341028-80341050 GGGCCGGGCCGGGCGGGCGCGGG + Intergenic
1111230590 13:85340732-85340754 GGCGGCTGCCAGGCGGGGGCGGG + Intergenic
1112504543 13:99968335-99968357 CGCGGCCGCCGGGAGGGGGCAGG + Intronic
1112507855 13:99985575-99985597 GGCGGCGGCGGGGCGGGCGGCGG + Exonic
1112520366 13:100089291-100089313 GGCTGGCGCCGGGAGAGCGCTGG + Intronic
1112652763 13:101416515-101416537 CGCCGCCGCCGGGCAGGCTGGGG + Intergenic
1113254850 13:108495734-108495756 AGCCGCCGCCGAGCGGGTGGCGG + Intergenic
1113541796 13:111115201-111115223 GGGCGGCGCGGGCCGGGCGCGGG + Intronic
1113655888 13:112067685-112067707 GGGCGCCGCCGGGCGAGTGCAGG - Exonic
1113985694 13:114314268-114314290 AGCCGCGCCCGGGCGCGCGCGGG + Intergenic
1115120094 14:29927937-29927959 AGCCACCACCCGGCGGGCGCGGG + Intronic
1115257616 14:31420035-31420057 GGACGCCGCAGGGCGGGTCCCGG + Intronic
1115566584 14:34630043-34630065 AGCGGGCGCGGGGCGGGCGCGGG - Intronic
1115576122 14:34714283-34714305 GGTCGGGGCCGGGCGGGCGGGGG - Intronic
1115851299 14:37592317-37592339 GGCCGCAGCCGCGCGGGCGGCGG - Exonic
1116018205 14:39431891-39431913 GCCCGCAGCCGGTCGGGCGCCGG + Exonic
1116657979 14:47675013-47675035 GGCCGGCGGCGGGCGCGGGCAGG + Intergenic
1116958041 14:50944086-50944108 GGCCGCGGCCGGGCGGGACGAGG - Intronic
1117424454 14:55580368-55580390 GGCCGCACCGGGACGGGCGCCGG + Intronic
1118220701 14:63852902-63852924 GGCCGCCGAGGGGCGAGCGCGGG + Intergenic
1119325886 14:73759428-73759450 GGCCGCGCCCGGGTGGGCGGGGG + Intronic
1120789215 14:88563458-88563480 GGGCGCCGCGGGGCTGGGGCTGG + Intronic
1120905689 14:89619173-89619195 CGCCGACCCCGGGCGGGCGCCGG - Intergenic
1121352445 14:93184577-93184599 GGCCGCCGGCGCACGGACGCGGG - Exonic
1122162385 14:99793627-99793649 GGCCGAGGCCCGGCGGCCGCGGG + Intronic
1122425245 14:101601893-101601915 GGCCTCGGCAGGGCTGGCGCAGG + Intergenic
1122469347 14:101955827-101955849 GCCCGGCTCCGAGCGGGCGCTGG - Intergenic
1122516729 14:102314292-102314314 TGCAGCTGCAGGGCGGGCGCGGG - Intergenic
1122666676 14:103334690-103334712 GGCGGACGGCGGGCGGGCGCGGG + Intronic
1122688942 14:103522593-103522615 GGCCGCGTCCCGGGGGGCGCCGG - Intronic
1122904493 14:104795561-104795583 GGCCGGCGCTGGGCGGGGCCGGG + Intronic
1122917323 14:104865189-104865211 CGGCGCGGCCGGGCGGGGGCGGG + Intergenic
1122975366 14:105168667-105168689 CGTCGCCGCCGGGTGGGAGCCGG - Exonic
1122978561 14:105181086-105181108 GGCCGCCGGCGGGGGCGCGGGGG + Intronic
1123004445 14:105314667-105314689 GGAGGGCGCCGGGCGCGCGCGGG + Exonic
1123082150 14:105700316-105700338 GGGAGCGGCCGAGCGGGCGCTGG - Intergenic
1123630788 15:22258303-22258325 GGCCTCCCCCGCGCGGGCCCCGG + Intergenic
1123710011 15:22980247-22980269 GGAGGCCGCAGGGCAGGCGCGGG + Intronic
1123964083 15:25438500-25438522 GGCCGCCGCAGCCCAGGCGCGGG - Exonic
1124629368 15:31327987-31328009 CGCGGTCGCCTGGCGGGCGCCGG - Intronic
1125301028 15:38253081-38253103 AGCGGCGGCCGGGGGGGCGCGGG - Exonic
1125328938 15:38564289-38564311 GGAAGTCGGCGGGCGGGCGCCGG + Intronic
1125577172 15:40763940-40763962 GTCCGCCGCCGGGAGGGCGGGGG + Intergenic
1125589325 15:40844577-40844599 GGCCGGGGCGAGGCGGGCGCGGG - Exonic
1125752065 15:42036176-42036198 GGCCGCAGCAGGGAGGGTGCGGG + Intronic
1126827744 15:52568769-52568791 GCCCTCCGCCTGGCGGGAGCAGG + Intronic
1127071246 15:55289906-55289928 GGCCCCCGCCCGGCTGGCGGGGG + Intronic
1127084085 15:55408451-55408473 GGCCGCCGCCGGGCGGCTGCGGG + Intronic
1127867467 15:63043679-63043701 GGGCAGCGGCGGGCGGGCGCGGG - Intronic
1127906737 15:63381728-63381750 GGCTCCTGCGGGGCGGGCGCGGG + Exonic
1128145183 15:65329008-65329030 GGCAGCCGCCAGGCCGGCGCAGG + Exonic
1128309629 15:66622177-66622199 GCCCACGGCCGGGAGGGCGCAGG - Intronic
1128423971 15:67521175-67521197 GCGCGCCCCCGGGCGAGCGCCGG - Exonic
1128999452 15:72320061-72320083 GGCCGGGGCGGGGCGGGCCCGGG + Exonic
1129298936 15:74614751-74614773 GGCGGCCGCCGGGGCGGTGCTGG + Intronic
1129348277 15:74938163-74938185 CGCCGCCGCCGGCCGCGCGGTGG - Exonic
1130305353 15:82709486-82709508 GGCCGGGGCGGGGCCGGCGCTGG + Intronic
1130531234 15:84748830-84748852 GACCGCCGCCTGGCGGGCCCGGG + Intronic
1131272666 15:90956691-90956713 GGCCGCCGCCTGGCTGCGGCGGG - Exonic
1132055641 15:98648856-98648878 GGCGGGGGCCGGGCGGGGGCCGG + Intergenic
1132055649 15:98648873-98648895 GGCCGGCGCGGGGCGGGCGGCGG + Intergenic
1132314561 15:100880244-100880266 GCCCGGCCCCGCGCGGGCGCTGG - Intronic
1132342351 15:101086510-101086532 AGCCGCGGCCGCGCAGGCGCCGG - Intergenic
1132365279 15:101252154-101252176 GGCCCCCGCCCGGCGCCCGCGGG + Intergenic
1132499897 16:280619-280641 GGCGGCGGCGGGGCGGGCGGCGG + Exonic
1132570457 16:641892-641914 GGGCGCCGCGGGGAGGGGGCGGG - Exonic
1132585992 16:705953-705975 GGCCGGGGCGGGGCGGGGGCGGG - Intronic
1132687683 16:1169126-1169148 GGCCGCTGCCAGGCAGGCTCTGG - Intronic
1132759026 16:1500038-1500060 GGCCGCCGCCTGGCCAGCCCGGG - Intronic
1132805150 16:1771804-1771826 GGCCCTGGCCGGGGGGGCGCGGG - Intergenic
1132815912 16:1826530-1826552 GGCTGGCGCGGAGCGGGCGCGGG - Intronic
1132879517 16:2155833-2155855 TGCCGCTCCCGGGCGGCCGCGGG + Exonic
1132889497 16:2196783-2196805 GGGCGTCCCGGGGCGGGCGCGGG - Intergenic
1132947125 16:2537941-2537963 GCCCGGCGCCGCGCGGGGGCGGG + Intergenic
1132989443 16:2785418-2785440 GCCGGGCGGCGGGCGGGCGCCGG + Exonic
1134441555 16:14302180-14302202 GGCCGGCCCGGGGCGGGGGCTGG - Intergenic
1135976149 16:27109951-27109973 GGGCGCGGCGGGGCGGGAGCGGG - Intergenic
1136025958 16:27469296-27469318 GGCCTGAGCCGGGCGGGCACAGG + Exonic
1136544866 16:30949202-30949224 GGCCGCCCCCGGGCTTGGGCCGG + Exonic
1136550404 16:30979717-30979739 GGGGGCCGCAGGGCTGGCGCAGG - Exonic
1136778908 16:32885363-32885385 GGCCGCCGCCGGGTGTCCCCAGG + Intergenic
1136891710 16:33976155-33976177 GGCCGCCGCCGGGTGTCCCCAGG - Intergenic
1137261086 16:46830869-46830891 GGCCGCCGCCAGGTGGACGCTGG + Intronic
1138265318 16:55656107-55656129 AGGCGCCGCCGGTCGGGGGCCGG + Intronic
1138360674 16:56425134-56425156 GCGCTCGGCCGGGCGGGCGCCGG + Exonic
1138386435 16:56638572-56638594 GGACTCAGCGGGGCGGGCGCAGG + Intergenic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1139691110 16:68642742-68642764 GTCTGGCTCCGGGCGGGCGCGGG + Intronic
1140442638 16:74999303-74999325 GGCGAGCGGCGGGCGGGCGCGGG - Exonic
1141430489 16:83968421-83968443 CACCCCCGCCGGCCGGGCGCGGG - Intergenic
1141430563 16:83968592-83968614 GGCCGCAGCTGGGCGGGGGTCGG + Intergenic
1141608759 16:85169900-85169922 GGCGGCCGCCGTGGCGGCGCCGG + Intergenic
1141972257 16:87492270-87492292 GGCCGCCCCCGCGCGGTCCCCGG - Intergenic
1141989619 16:87602603-87602625 GGGGGCCGCGGGCCGGGCGCGGG - Intronic
1142120096 16:88382963-88382985 GGACGCCGGCCGGCGGCCGCGGG - Intergenic
1142155468 16:88530974-88530996 GGCCGCAGAGGGGAGGGCGCGGG + Intronic
1142271838 16:89093920-89093942 GTCCTCCGCCGCGCGCGCGCCGG - Exonic
1142474543 17:181285-181307 GGCCACAGCCGGGCGCGCGGGGG + Exonic
1142509830 17:386259-386281 GGGCGGGGCGGGGCGGGCGCCGG - Intergenic
1142518915 17:491601-491623 GGCCCCCACCGGGCGGCCGGTGG - Intergenic
1142549984 17:732522-732544 GGCCAGCGCCGGGCGGAGGCGGG + Exonic
1142611107 17:1109531-1109553 GGCCGCGGCCGGGCCGGGGTGGG + Intronic
1142848413 17:2692910-2692932 GGCCGGGGCCAGGCGGGCTCTGG - Intronic
1142941841 17:3386285-3386307 CGCCGCCGTCGGGCGGTCGTAGG - Intergenic
1143321255 17:6070528-6070550 GGCCGGAGACGTGCGGGCGCCGG + Intronic
1143783225 17:9240190-9240212 GTGCGCCGCCGGCCGGGCCCTGG + Exonic
1144490469 17:15704387-15704409 GGCCGAAGCCGGGCGGGCCCTGG - Intronic
1144490590 17:15704901-15704923 GGCTGCGGCCGGCCGGGGGCGGG + Intronic
1144656890 17:17042606-17042628 CGCCGCCGCCCGGCCGCCGCGGG - Intronic
1144724916 17:17496910-17496932 GGCGACCGCCGGGCGGACGCGGG + Intergenic
1144910501 17:18677582-18677604 GGCCAAAGCCGGGCGGGCCCTGG + Intronic
1145889732 17:28406061-28406083 GGCAGCCGCAGGGCGGGCGCGGG + Exonic
1146057640 17:29589266-29589288 GGCCGCCGCCGGGCGGGCGCCGG - Intronic
1146356911 17:32142351-32142373 GGCCGCCGCAGCGCAGGCCCAGG - Exonic
1146790916 17:35750105-35750127 GGCTGGCGCCTGGGGGGCGCTGG + Exonic
1146912524 17:36657898-36657920 GGCCGCCGCCGAGCAGCCGCGGG - Intergenic
1147161786 17:38572833-38572855 GGCCGCCGCCGTGCCGGCCCGGG + Intronic
1147258994 17:39197728-39197750 GGGCGGGGCCGGGCGGGCGGAGG - Intergenic
1147317334 17:39627231-39627253 GCCCGCCGAGGGGAGGGCGCGGG - Exonic
1147907552 17:43832917-43832939 GCGCGCGGCGGGGCGGGCGCGGG + Intronic
1148284053 17:46372658-46372680 GGCGGCCGCCTGGGGTGCGCGGG - Intergenic
1148306274 17:46590579-46590601 GGCGGCCGCCTGGGGTGCGCGGG - Intergenic
1150061545 17:62073005-62073027 GGCGGCGGCCGGGCGGGGGCTGG - Intergenic
1150250066 17:63700172-63700194 GGCGGGCGCGGGGCGGGGGCCGG - Intronic
1150489006 17:65561689-65561711 GGGCGGGGCGGGGCGGGCGCGGG - Intronic
1151370369 17:73643586-73643608 GGCCCCTGCCGGGCAGGCGATGG - Intronic
1151559171 17:74861555-74861577 GGGCGCGGCGGGGCGGGGGCGGG + Intergenic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1152267544 17:79305080-79305102 GGCCGCCGCCTGGCCAGGGCAGG + Intronic
1152354030 17:79798079-79798101 GGCCGAAGCCTGGCGGGGGCGGG - Intronic
1152357247 17:79813284-79813306 GGCGGCCGCGGGGCGAGCGGGGG - Intergenic
1152357399 17:79813720-79813742 GGCCCCCGCCGGCCCGGGGCGGG - Intergenic
1152433101 17:80260503-80260525 CGCCGCCGCCGGCCCCGCGCAGG - Intergenic
1152675252 17:81636888-81636910 TGCGGCGGCCGGGCGGGAGCGGG - Intronic
1152745511 17:82036950-82036972 GGAGGCCACCGAGCGGGCGCTGG - Exonic
1152751814 17:82065759-82065781 GGCCGCCGCCGGGCCGCAGCCGG + Intronic
1152844839 17:82593431-82593453 GGGCTCCGCCAGGGGGGCGCGGG - Intronic
1152924520 17:83080961-83080983 GGTGTCCGCGGGGCGGGCGCAGG + Intronic
1153226945 18:2906833-2906855 GGCCTCGGCGGGGCGGGCTCGGG - Exonic
1153457579 18:5296468-5296490 AGCCTCCCCCGGGCGCGCGCAGG + Intronic
1154070571 18:11148829-11148851 GGCCGCAGGGGGCCGGGCGCCGG - Intergenic
1155570287 18:27185142-27185164 GGCCGCTGCCGGGCGCTTGCAGG + Exonic
1156275731 18:35581530-35581552 GGGCGCCGCAGGGCGCCCGCAGG - Intronic
1158478785 18:57803076-57803098 GGCTGGGGCCGGGCGGGCGGCGG - Exonic
1158976749 18:62716586-62716608 GGCCGCCGACGGGCAGGGGTAGG - Exonic
1159511360 18:69401164-69401186 GTCCGCCGCCGGGTCTGCGCGGG - Exonic
1160453345 18:78979750-78979772 GGCGGCGGCGGGGGGGGCGCGGG + Intergenic
1160745414 19:709044-709066 GGACGCGGCCTGGCGGGGGCCGG - Intergenic
1160818510 19:1047263-1047285 GGCCGCAGCCAGGTTGGCGCGGG - Exonic
1160851408 19:1194664-1194686 GGCCGCCAGGTGGCGGGCGCGGG - Intronic
1160858935 19:1229506-1229528 GGCCGGGGCCGCGCGGGCGCCGG + Exonic
1160909866 19:1469461-1469483 GGCCGCTGCCGGGCCGGGGCCGG - Exonic
1160930756 19:1568444-1568466 GGCCGGGGCGGGGCCGGCGCCGG + Intergenic
1160935523 19:1592774-1592796 GCCCCCAGCCGGGCGCGCGCCGG + Intronic
1160967597 19:1753472-1753494 GGCCGCCGGCGCCCGGGCCCGGG - Exonic
1161040090 19:2105804-2105826 GGCTGCCGTCAGCCGGGCGCGGG + Intronic
1161257996 19:3320410-3320432 GGCGGCGGCCGGGCGGGCGCGGG - Intergenic
1161301179 19:3543902-3543924 GGGTGGTGCCGGGCGGGCGCTGG - Exonic
1161399149 19:4059849-4059871 GGCCCCCGCCGGGGGTGCTCTGG - Intronic
1161924940 19:7293529-7293551 GCCCGCGGCGGGGCGGGCACCGG + Intronic
1162421646 19:10568905-10568927 GGCCCCCAAGGGGCGGGCGCCGG - Exonic
1162471017 19:10871970-10871992 GGCCGGCCCGGGGCGGGGGCCGG + Intronic
1162909859 19:13842866-13842888 GGCCGCCCCCGGCCGGTCTCGGG - Intergenic
1162935238 19:13978702-13978724 GGCAGCGGGCGGGCGGGGGCGGG - Intronic
1163019251 19:14473844-14473866 GGCCAGCGCCAGGCGCGCGCGGG + Exonic
1163019666 19:14475420-14475442 GGCCCCCAGCGGGCGTGCGCGGG - Intergenic
1163121932 19:15223526-15223548 GGCCGCCGGCGGGAGGGAGGCGG - Intergenic
1163154555 19:15432712-15432734 GGCGGCCGCCCCGCGTGCGCCGG - Intronic
1163320602 19:16572402-16572424 GCCCGACGCCGGGCGGGGGCGGG + Intronic
1163578456 19:18123989-18124011 GCCCGGCGCCCGGCTGGCGCTGG + Exonic
1163607270 19:18281987-18282009 GGCCCCGGCCGGGCGGGGGCGGG + Intergenic
1163666706 19:18606903-18606925 GCCCGCGGGCGGGCGGGCGGCGG - Intronic
1163695694 19:18762206-18762228 CGCAGCTCCCGGGCGGGCGCTGG - Intronic
1163701882 19:18790218-18790240 GGCCGCCCCGGGGCGGGGGGTGG - Intronic
1163715154 19:18869017-18869039 GGCCTCGGCCAGGCGCGCGCAGG + Exonic
1163762621 19:19145825-19145847 AGCCGGCGCAGGGCGGGCCCAGG + Exonic
1163844127 19:19628848-19628870 GGCCGCCGCAGGGAGGCCGAGGG - Exonic
1164137568 19:22428072-22428094 GGCCACTGCCGGGCAGGGGCTGG + Intronic
1164160641 19:22623614-22623636 GGCCACCGCCGGGCAGGGGCTGG - Intergenic
1164179546 19:22807137-22807159 GGCCACCGCCGGGCAGGGGCTGG + Intergenic
1164602036 19:29568647-29568669 GGCCGCTGCCTGGAGGGCGCAGG - Intergenic
1165065382 19:33225523-33225545 GGACCCAGGCGGGCGGGCGCCGG - Intronic
1165065423 19:33225668-33225690 CGCAGCAGCCGAGCGGGCGCGGG - Exonic
1165459505 19:35936448-35936470 GGCGGGGGCCGGGCGGGGGCCGG - Intronic
1166306842 19:41940223-41940245 GGGCGAGGCCTGGCGGGCGCGGG + Intergenic
1166347738 19:42176855-42176877 GGCGGGAGCCGGGCGGGAGCCGG - Intronic
1166361316 19:42254028-42254050 CGCCGCCCCCGGGCTCGCGCGGG - Intronic
1166721798 19:45001420-45001442 GGCGGGCGGCGGGCGGGGGCGGG - Exonic
1167072990 19:47231253-47231275 GGGACCCGCCGGGCGGGGGCGGG - Intronic
1167258127 19:48443092-48443114 CGCGGCCACCGCGCGGGCGCCGG - Exonic
1167268311 19:48494034-48494056 GGCCGCCGCGGGCCCGGCCCCGG + Exonic
1168300386 19:55401591-55401613 GGCCGAAGCCGGTCGGGCCCTGG - Exonic
1168301515 19:55407590-55407612 GGCTGCGGCCGGCCGGGGGCGGG + Exonic
1168308910 19:55451236-55451258 GGGCTGGGCCGGGCGGGCGCCGG + Intergenic
1168315151 19:55481859-55481881 GGGCGGCGCCGTGCGTGCGCTGG - Exonic
1168332770 19:55579527-55579549 GGCCGTGGCAGGGGGGGCGCTGG - Exonic
1168718974 19:58544598-58544620 GGCCGCTGCCCGCCGCGCGCGGG - Exonic
1202712432 1_KI270714v1_random:25656-25678 GGCAGCCGGCGGGCGCGGGCTGG + Intergenic
925217623 2:2110897-2110919 GGCCACCCCAGGGCGGGCCCTGG + Intronic
925927197 2:8678968-8678990 GGCCGCGGCGGGGCCGGAGCCGG - Exonic
925984731 2:9206729-9206751 GGCGGCGGCCGGCCGGGCGTGGG - Intergenic
926077159 2:9951174-9951196 CGCCCCCGCCGGGCGAGCGCAGG + Intergenic
926095735 2:10079943-10079965 GGGCGGCGCGGGGCGGGCTCCGG + Exonic
927168583 2:20350324-20350346 GGCCGCCGCCTCGGGGGCGTGGG - Intronic
927472263 2:23385389-23385411 GGCGGCCGCGGGGCTGGGGCTGG - Exonic
927714077 2:25341524-25341546 GCCCGGAGCCGGGCGGGGGCGGG + Intronic
927900621 2:26815766-26815788 GGCCGCCGGGTGGGGGGCGCCGG + Intergenic
927904286 2:26846531-26846553 CCCCGCCGCCGGGAGGCCGCTGG + Intergenic
928093422 2:28390448-28390470 AGGCGCCGCCGGGAGCGCGCGGG - Intergenic
928606383 2:32947689-32947711 GGCGGCTGCCGGGTGGCCGCCGG - Exonic
928998759 2:37324906-37324928 GGCCACCTCCCGGCGGGCGCGGG - Intergenic
929242314 2:39665766-39665788 GGCCGGGGGCGGGCGGGCGGTGG + Intronic
929874036 2:45781634-45781656 GGGGGCCGGGGGGCGGGCGCGGG - Intronic
931681134 2:64750843-64750865 GGCCGCGGCGGGGCGAGCGGCGG + Intronic
931710977 2:64989091-64989113 GGCCGGCTCCGGGCGACCGCGGG - Intronic
932178311 2:69622314-69622336 GCCCACCGCCGGGCGGGGGAGGG - Intronic
933741719 2:85539105-85539127 GGCCCGAGCCGGGCGCGCGCGGG + Intergenic
934539089 2:95159684-95159706 GGCTGGCGCGGGGCGGACGCGGG - Intronic
934539098 2:95159707-95159729 GGCTGGCGCGGGGCGGACGCGGG - Intronic
934539107 2:95159730-95159752 GGCTGGCGCGGGGCGGACGCGGG - Intronic
934856474 2:97733218-97733240 GGCAGCAGGCGGGCGGGCGGTGG + Intronic
935361707 2:102251122-102251144 GGGTGGCGCCGAGCGGGCGCCGG + Intergenic
935396950 2:102619505-102619527 GGCGGCCCGCGGGCGGGGGCGGG - Intergenic
936278674 2:111120593-111120615 GGCCGCCGCCGGGTTGGGGTAGG + Intronic
936370399 2:111898373-111898395 GGCCGCCGCTGGGCAGACGGCGG - Intergenic
936412878 2:112275930-112275952 GGCCGGCGGCGGCGGGGCGCGGG - Exonic
936775334 2:115965735-115965757 GGCTGCAGCCGGGCGGGGGGAGG - Intergenic
938073043 2:128318419-128318441 CGCGGCCGCCGGGCGCGCCCAGG + Exonic
938537076 2:132256254-132256276 GGGCGCGGCAGGGCGGGCGATGG + Intronic
938727285 2:134120123-134120145 GGCCGCCGCCGAGCGGGCCGCGG - Intronic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
941119097 2:161507812-161507834 GGCCTAGGCCGGGCGTGCGCGGG - Intronic
941463092 2:165794045-165794067 AGCGGCGGCCGGGCAGGCGCTGG + Exonic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942346272 2:175005506-175005528 GGCCGCCTCCAGGGGGGCGCTGG - Intergenic
943669792 2:190648857-190648879 GGCCGCCGCCGGGCGGGGGCGGG - Intronic
945245163 2:207711362-207711384 GGCAGCTGCCAGGCGGGGGCGGG + Intergenic
945939332 2:215932561-215932583 GGCAGCCCCCGGGAGGGCTCAGG - Intergenic
946185561 2:217978736-217978758 GGCCGCGGGCTGGCGGGCCCGGG - Intronic
946362835 2:219229409-219229431 GGGCGCCGCCGGCGGGGCGGGGG - Intronic
946395528 2:219442101-219442123 GGGCGGCGCCGGGAGGGGGCAGG + Intronic
946856760 2:223957630-223957652 GCCCGCCGCCGCCCGTGCGCCGG + Exonic
947353600 2:229271170-229271192 CACCGCCGCCGGGTGGGCGTAGG + Exonic
947353632 2:229271304-229271326 CGCCGCCGCCGCGCGCTCGCCGG - Intergenic
947592937 2:231395592-231395614 GGCGGCGGCGGGGCGGGCCCTGG + Exonic
948209117 2:236179287-236179309 AGCCGACGCCGGGCGGCCGCGGG - Intergenic
948393394 2:237627764-237627786 GGGGGGCGCCGGGCGGGCGCGGG + Intronic
948479264 2:238239991-238240013 GGCTGCTGCTGGGCGGCCGCGGG - Exonic
948505909 2:238426934-238426956 GGCTTCCGGCGGGCGCGCGCCGG - Exonic
948645181 2:239400329-239400351 GGGCGGGGGCGGGCGGGCGCCGG - Intronic
948874702 2:240820360-240820382 GGCCGCCGCGGGGATGGGGCTGG + Intergenic
1168795887 20:610053-610075 GGCGGGCGGCGGGCGGGCGGCGG - Exonic
1168855027 20:1002229-1002251 GGCGGCGGCACGGCGGGCGCGGG + Exonic
1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG + Intergenic
1170847580 20:19975157-19975179 AGCGGCGGCCGGCCGGGCGCAGG + Exonic
1170890176 20:20369233-20369255 GCCCGCCGCCGCCCGCGCGCCGG + Exonic
1172118331 20:32584214-32584236 GGCAGCCCCGGGGCGGGCGGGGG + Intronic
1172146616 20:32762313-32762335 GGGCACCCCCGGGCGGGGGCGGG + Intergenic
1172155328 20:32820079-32820101 GGCCAAGGCCGGGCGTGCGCGGG + Intronic
1172155357 20:32820172-32820194 GGCCGTCACCCGGCGCGCGCGGG + Intronic
1172421994 20:34825589-34825611 GGCTGCGGGCGGCCGGGCGCGGG - Intronic
1172644542 20:36461601-36461623 GGGCGGCGCTGGGCGGGCCCCGG - Intronic
1172841095 20:37903179-37903201 GGCCGGAGCCGGGCGAGGGCTGG + Exonic
1174246888 20:49188250-49188272 GGGCGCCGCCGGGCCGGGGGGGG + Exonic
1175562316 20:59940460-59940482 GGGCGTCCCCGCGCGGGCGCCGG + Intronic
1175847397 20:62065884-62065906 GGCGGGCGCTGGGCGGGCGGGGG + Intergenic
1175859549 20:62143095-62143117 GGGCGCCCGCGGGCGTGCGCGGG - Intronic
1175968477 20:62671900-62671922 CGCCGTGGCCGGGTGGGCGCGGG - Exonic
1176066823 20:63202134-63202156 GGCCGCAGGTGGGCGGGCCCAGG - Intronic
1176194524 20:63831132-63831154 CGCGGCCGCCGGGCCGGCGCCGG + Intronic
1176194592 20:63831343-63831365 AGCGGCGGCCGGGCGCGCGCCGG - Intergenic
1176380783 21:6111287-6111309 GGCGGGCTCCGGGCGGGCGGAGG + Intronic
1176548978 21:8213457-8213479 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1176556871 21:8257669-8257691 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1176567907 21:8396487-8396509 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1176575811 21:8440706-8440728 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1177010927 21:15729903-15729925 AGGAGCCGCCGGGCGGGGGCGGG + Intergenic
1177074475 21:16554796-16554818 TGCCGCAGCCGGGCGGACGGAGG - Intergenic
1178417022 21:32412525-32412547 GGCAGCCGCGGGGCGCGCGAAGG + Exonic
1178561533 21:33642980-33643002 GGCGGCCGCGGGACGGGCGTGGG + Intronic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1179375458 21:40846762-40846784 GGCGGGCGGCGGGCGGGCGGCGG - Exonic
1179742689 21:43426953-43426975 GGCGGGCTCCGGGCGGGCGGAGG - Intronic
1180615003 22:17121042-17121064 GGCTGCAGCCGGGCGGCTGCCGG + Exonic
1180649983 22:17369600-17369622 GGCGGGCGCCGGGCGGGGGGCGG - Exonic
1181026820 22:20131719-20131741 GGCCGCGGCGGGGCGGGACCGGG - Intronic
1181057761 22:20268030-20268052 CCCCGCCGCCGGCCGGGCTCGGG + Intronic
1181085521 22:20437764-20437786 GGCAGGCGCGGGGCGGGCACGGG + Exonic
1181478095 22:23180839-23180861 CGCCGCCGCCGCGCGGGCCATGG + Exonic
1183479757 22:38057106-38057128 GGCAACCGCCGGGCCGGCGCGGG + Intronic
1183665225 22:39242820-39242842 GGCCGCAGCCGGGCGGAGGTGGG + Intronic
1183683773 22:39350211-39350233 GCCCGCCGCCGCGCCGCCGCCGG - Intronic
1183710864 22:39502459-39502481 GGCCGCCGGCGGCTGGGCGGCGG + Intronic
1184086793 22:42270366-42270388 GGCCTCCGCCGGGGGCGGGCGGG + Intronic
1184274158 22:43400648-43400670 GGCAGCAGCCGGGCTGGCGGCGG + Intergenic
1184439091 22:44497934-44497956 GTTCTCCCCCGGGCGGGCGCGGG - Intronic
1184679170 22:46061326-46061348 GGCTCCGGCCGGGCGGGCCCGGG - Intronic
1184766909 22:46576982-46577004 GCCGGCCGCGGGGCGGGGGCGGG + Intronic
1185259618 22:49854099-49854121 GGCCGGGGCCAGGCGGGCGGGGG + Intronic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
1185388386 22:50546877-50546899 GGCCCCTGGCAGGCGGGCGCGGG + Intergenic
1203253862 22_KI270733v1_random:129764-129786 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1203261918 22_KI270733v1_random:174843-174865 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
950454755 3:13086014-13086036 GGCCGCCGCAGGGCTGGCGCTGG + Intergenic
950729784 3:14947603-14947625 CGCCGCCGCCGCCCGCGCGCTGG - Intronic
950903002 3:16513716-16513738 CGCCGCCGCCGCGCGTCCGCCGG + Intronic
951080440 3:18445195-18445217 GGGAGAAGCCGGGCGGGCGCTGG - Intronic
952334307 3:32391820-32391842 GGCCGGGGGCGGGCGGGGGCGGG - Exonic
953326116 3:42013727-42013749 GGCGGCGGCCGGGTGGGCCCCGG - Intergenic
953404824 3:42654961-42654983 GGGCGGCGCCGTCCGGGCGCAGG - Intronic
953526051 3:43690970-43690992 AGCCGCCGCCGCGCAAGCGCCGG - Exonic
953638696 3:44685524-44685546 GACCGGGGCCGAGCGGGCGCAGG - Intergenic
954076910 3:48188189-48188211 GCCAGCGGGCGGGCGGGCGCCGG + Exonic
954141624 3:48609715-48609737 GGCCGCCTCCTGGCGGGAACCGG + Exonic
954664781 3:52245943-52245965 GGCCGCCCCGGGGCTGGAGCTGG - Intronic
954778802 3:53045118-53045140 GGGCGCTGCCGGGTCGGCGCGGG + Intronic
955769251 3:62372558-62372580 AGCAGCCTCCGGGCGGGCGGCGG - Exonic
956681433 3:71785202-71785224 GTGTGCTGCCGGGCGGGCGCCGG - Intronic
956761299 3:72447206-72447228 GGCCGGCGCCGCGAGGGCGGAGG + Intergenic
956813555 3:72888078-72888100 CGCCGCCGCCGGCCGCCCGCCGG + Exonic
956813557 3:72888083-72888105 GGCGGCCGGCGGGCGGCCGGCGG - Exonic
958900097 3:99876084-99876106 CGCCGGGGCCGGGCGGGGGCCGG + Intronic
959591861 3:108090773-108090795 GGGCGCCGCCGGGCTGGCTGGGG + Intronic
961377212 3:126475259-126475281 GACCGCCGCCGTGCGTGAGCAGG + Exonic
961603358 3:128076887-128076909 GGCAGCTGCGGGGAGGGCGCGGG - Intronic
962520748 3:136195853-136195875 CGCCGCCGGCGGGCGGGAGGGGG + Intronic
965590421 3:170356958-170356980 GGCCGCCGCCCGGCTGCCTCCGG + Intergenic
966378784 3:179323184-179323206 GCCCGCCGCCGTGCGTCCGCGGG + Intronic
966866456 3:184261286-184261308 GGCGGGCGCGGGGTGGGCGCGGG + Exonic
966911437 3:184562328-184562350 GCCCGCCGGCTGCCGGGCGCTGG + Exonic
967596364 3:191329824-191329846 GGCCAACGCAGGGCGGGCACCGG - Intronic
967867734 3:194204148-194204170 GGCAGCCGCGGGGGCGGCGCTGG + Intergenic
968178121 3:196568822-196568844 GGACGCCCCCGGGCAGGGGCGGG + Exonic
968479171 4:826232-826254 CGCGGGCGCCGGGCGGGGGCGGG + Intergenic
968701322 4:2059462-2059484 GGACGCGGCCGGGCGGCGGCGGG - Intergenic
969379396 4:6783624-6783646 GGCCGCAGGCGGGCGGGGCCGGG + Intronic
969413284 4:7043248-7043270 GGCCGGCGCGGGGGGCGCGCAGG + Intronic
969650878 4:8467257-8467279 TGCCCCCGCCGGGCGGCCGAGGG + Intronic
971257973 4:25031029-25031051 GGGCGCCACGGGGCCGGCGCTGG - Intergenic
972793972 4:42398260-42398282 GGCCGACGCCAGGCTGGAGCAGG + Exonic
974047275 4:56908360-56908382 CGGCCCCGCCGGGCGGGGGCTGG + Intronic
975701999 4:77075737-77075759 GGCCGCCGCCGCTCGAGCCCGGG + Exonic
976226586 4:82799019-82799041 GGCCGCCTCCGCCCGGGGGCGGG + Intergenic
982745790 4:159103338-159103360 GGCCGCGGCGGCGCCGGCGCCGG + Intergenic
983940233 4:173529411-173529433 TGCGGCTGCCGGGCGGGCCCGGG - Exonic
984698154 4:182799679-182799701 GCGCGCCGCCGGCCCGGCGCCGG - Exonic
984871585 4:184330147-184330169 GCACGCCACCGAGCGGGCGCGGG - Intergenic
985068419 4:186144913-186144935 GCCAGCCGCGCGGCGGGCGCGGG + Exonic
985616559 5:926562-926584 GGCCCCCGCAGGGCGGGAGGAGG - Intergenic
985784464 5:1886706-1886728 GGCCGGCGCGGGGCGGGGGGTGG - Intronic
986608252 5:9544806-9544828 GGCCGCCGCGGGGAGCGAGCCGG + Intronic
986706325 5:10457410-10457432 AGCAGCCGCCAGGCGGGCTCTGG - Intronic
988264154 5:28928194-28928216 TGCCGCGGCCGGGCTGGCCCCGG + Intergenic
988578003 5:32444839-32444861 GGCCTCGGCGGTGCGGGCGCGGG + Intergenic
990308584 5:54517718-54517740 AGCCGCCGCCGGTCGGGGGCGGG - Intergenic
990557748 5:56952199-56952221 CTCCGCCGCCGGGCGGGTGCCGG - Intronic
992320789 5:75611637-75611659 GGACCCCGCCGGGCGCGCCCGGG + Exonic
992627629 5:78649060-78649082 CGCCGCTGCCCGGCGGGCTCAGG - Intronic
993168437 5:84384915-84384937 GGCGGAGGGCGGGCGGGCGCCGG - Intergenic
995574424 5:113514133-113514155 GGCCGCCGTTTGGGGGGCGCTGG - Intronic
996379113 5:122845766-122845788 GGCCGCCGCCGCCTTGGCGCAGG + Intronic
996442989 5:123512602-123512624 GGCAGCCGCCGGGCCGGGGCTGG - Intronic
996769733 5:127073504-127073526 GGCCGGCGCCTGGTGGGTGCGGG - Intergenic
1000014745 5:157266657-157266679 GGCGGCTGCCAGGCGGGCCCAGG - Intronic
1001617754 5:173056594-173056616 GGCCGGCGCGGGGCGGGGGCCGG + Intronic
1002046210 5:176543116-176543138 AGCTCCCGCCGTGCGGGCGCCGG + Intronic
1002047312 5:176549364-176549386 GGCAGGCGCCGGACAGGCGCTGG - Intronic
1002754712 6:148226-148248 GCACGCCGCCGGGCGGGGGTTGG + Intergenic
1002856527 6:1042991-1043013 GGCCGGCGCATGGCTGGCGCTGG + Intergenic
1002896315 6:1382370-1382392 TGCGGCTGCCGTGCGGGCGCGGG + Intergenic
1002897998 6:1390176-1390198 GGCGGCGGCGGCGCGGGCGCCGG + Exonic
1003049255 6:2765432-2765454 GGCCGAGGGCGGGCGGACGCGGG + Exonic
1003290788 6:4776654-4776676 TCCCGCGGCCGGCCGGGCGCTGG - Exonic
1003426068 6:5999276-5999298 GGCCGCCAGCGGGGAGGCGCAGG - Intronic
1005040186 6:21594470-21594492 GGCGGCCGCCGCGCGATCGCCGG - Exonic
1005303777 6:24495065-24495087 GGCCGCCGGCGCGGGGGCGGAGG - Exonic
1006369216 6:33633818-33633840 GGCGGGCGCGGGGCGGGCGCGGG + Intronic
1006617917 6:35342474-35342496 GGCCGCCGCCGGGCGGAAGGGGG + Intergenic
1007451139 6:41941075-41941097 GGCCGCCCCCGCCCGGGAGCCGG - Intronic
1009905663 6:69867476-69867498 GGCCACCGCCGAGAGCGCGCCGG + Intronic
1010032979 6:71289118-71289140 GTCCGGCGCGGGGCTGGCGCCGG - Exonic
1010703259 6:79077610-79077632 TGCCGCCGCCGGCAGGGCGCGGG - Intronic
1013099431 6:106974701-106974723 CGCTGGCTCCGGGCGGGCGCAGG + Intronic
1013459017 6:110358009-110358031 GGGCGCCGCCGGGGGGCGGCGGG - Exonic
1014019523 6:116571477-116571499 GGCGGCGGCCAGGCGGGCGCAGG - Exonic
1015366251 6:132401124-132401146 GGGCTCGGCCGGGCGGGCTCCGG + Intronic
1016400851 6:143678233-143678255 CGCTCCCGCCGCGCGGGCGCAGG + Intronic
1017671971 6:156777710-156777732 GGCGGCGGCGGCGCGGGCGCGGG + Intergenic
1017954945 6:159169679-159169701 GGCCGCCGCCGAGGAGGCGACGG - Exonic
1018046317 6:159969283-159969305 TGCGGGCGGCGGGCGGGCGCGGG - Exonic
1018400209 6:163414294-163414316 GACGGCCGCGGGGGGGGCGCGGG - Intronic
1018419669 6:163630864-163630886 GGCCTCTGCCGGGCGGGAGGCGG + Intergenic
1019305568 7:332877-332899 GAACGGCGCAGGGCGGGCGCGGG - Intergenic
1019395706 7:816699-816721 GGGCACCCCGGGGCGGGCGCCGG + Intronic
1019531142 7:1504109-1504131 TCGCCCCGCCGGGCGGGCGCGGG - Intronic
1019563940 7:1670550-1670572 GGCGGCGGCGGAGCGGGCGCAGG + Intergenic
1020002657 7:4764617-4764639 GGGCGCTCCCGGGAGGGCGCCGG - Exonic
1021106791 7:16646533-16646555 GACCGCGGGCGGGCGGGCGGGGG + Intronic
1021719247 7:23490434-23490456 GGGCGGGGGCGGGCGGGCGCGGG + Intergenic
1022096271 7:27143362-27143384 GGCGGGCGCCGCGCTGGCGCTGG + Exonic
1022102981 7:27180186-27180208 GGCGGGCGGCGGGCGGGCGCGGG - Intronic
1023879499 7:44310061-44310083 GGCCGAGACCGGGCGGGGGCGGG + Intronic
1024074147 7:45810287-45810309 GGCCGCCGACAGGCAGGGGCTGG - Intergenic
1025131367 7:56375714-56375736 GGCCGCCGACAGGCAGGGGCTGG + Intergenic
1025695682 7:63773139-63773161 GGCCGCCGACAGGCAGGAGCTGG - Intergenic
1025976758 7:66376642-66376664 GGCCGCCGGGAGGCGGGAGCTGG + Intronic
1025976876 7:66377093-66377115 GGCCCCCGGCAGGCGGGAGCCGG + Intronic
1027374642 7:77537521-77537543 GACCGCAGCCGGGGGGACGCGGG + Exonic
1027774215 7:82444080-82444102 TCCCGCCGCCCGGCGTGCGCAGG + Intergenic
1028417595 7:90596414-90596436 GGCCGCAGCTGGGCGGGCGGGGG - Intronic
1029207734 7:98879188-98879210 GGCCCAGGCCGGGCTGGCGCCGG - Intronic
1029683039 7:102125463-102125485 GGCCGCCGCTGGGAGGGCCTTGG + Intronic
1032344360 7:131105946-131105968 GGGCGGCGGCGGGCGCGCGCGGG + Intergenic
1032391302 7:131556744-131556766 GGCCGGGGCTGGGCGGGCGCTGG + Intronic
1033654275 7:143362548-143362570 TACCGCGGCCGGGCGGGGGCAGG - Intronic
1034147074 7:148883620-148883642 GCCCGCCGGCGGGCGGGAGAGGG - Intronic
1034192806 7:149224575-149224597 GGCCGCCGCTGTGCACGCGCAGG - Exonic
1034446081 7:151115007-151115029 GGCGGCCGAGGCGCGGGCGCAGG - Intronic
1034462310 7:151204738-151204760 TGCCGCTCCCGGTCGGGCGCAGG + Exonic
1034478698 7:151303592-151303614 GGCTGCGGCTGGGCGGGCTCTGG + Intergenic
1034911569 7:155002674-155002696 GGCGACCGCGGGGTGGGCGCGGG - Intronic
1035553012 8:544649-544671 CGCCGCCGCCGCCCAGGCGCAGG - Exonic
1035671094 8:1417623-1417645 GGCCGCCTCCAGGGGGGCACGGG + Intergenic
1036454127 8:8893158-8893180 GGCCGCCGGCCGCCGAGCGCGGG - Exonic
1036578821 8:10054386-10054408 GGGCGCGGGCGGGCGGGCGCGGG - Exonic
1036811178 8:11868286-11868308 GGCCACCGCCGGGGGCGGGCGGG + Intronic
1037260451 8:17001910-17001932 CGCCGCTGCTGGGCGAGCGCAGG - Exonic
1038540342 8:28385856-28385878 GGCCGCGGCGGGCGGGGCGCGGG - Intronic
1041449797 8:57994648-57994670 GGTCGCCGCCGCGGGGCCGCGGG - Exonic
1041673721 8:60517265-60517287 GGGCGCGGCCGGGCGGGTGTCGG + Intronic
1043388156 8:79768018-79768040 CACCGCCGCCGGGCAGGGGCGGG - Intergenic
1043388418 8:79768919-79768941 GGCCGCCGGGGGGAGGGGGCGGG - Intergenic
1044336012 8:90985312-90985334 GGCGGGCCCAGGGCGGGCGCGGG + Intergenic
1044340443 8:91040862-91040884 TGCCGCCTCCGGGAGGGCCCGGG + Exonic
1044698690 8:94948521-94948543 GGCCGCGGACAGGCGGGGGCCGG + Intronic
1044819256 8:96144930-96144952 CGCCGCCGGCGGCCGGGCGAGGG + Exonic
1045564437 8:103299020-103299042 GGCAGGGGCCGGGCGGGTGCCGG + Intronic
1047961848 8:130016726-130016748 GGCCGGCGCGGGGCGGTCCCGGG - Intronic
1047974105 8:130112383-130112405 GGCCTCCGCAGGGCGGGCTCAGG + Intronic
1048472058 8:134712723-134712745 GGCCGCCGGCCGCCGGCCGCCGG - Intronic
1049218318 8:141417753-141417775 GGGCCGCGCAGGGCGGGCGCGGG - Intronic
1049697188 8:143990102-143990124 AGCGGCCGCCGAGCGGGTGCGGG + Exonic
1049788488 8:144462534-144462556 GGCGGCCGCCGGGCAGGCGGCGG - Intronic
1049976012 9:861792-861814 GGCGGCTGCCGGGCGGGGGGGGG + Intronic
1050230890 9:3525488-3525510 GGCCGGCGCAGGGCCGGGGCCGG + Intronic
1051170447 9:14314996-14315018 GGCCGCCCCCAGGCCGGGGCTGG + Intronic
1051513668 9:17906720-17906742 GGCGGCCGGCAGGCGGGCTCGGG - Intergenic
1053072931 9:35111614-35111636 GGCCGCCGCGGCGCGGGTGGTGG - Intronic
1053732751 9:41074373-41074395 CCCCGCCGCCGGACGGCCGCTGG + Intergenic
1053732823 9:41074590-41074612 GTCCCCAGGCGGGCGGGCGCAGG - Intergenic
1054695676 9:68357181-68357203 CCCCGCCGCCGGCCGGCCGCTGG - Exonic
1055069231 9:72149455-72149477 GGCGGCTGCCGGGCGGACACAGG - Exonic
1055090987 9:72364796-72364818 CGCCGCCGCGGGCCGGGAGCGGG + Intronic
1056386317 9:86099703-86099725 GGCCGCCCCTCGGCGGGAGCAGG + Intronic
1056643251 9:88388543-88388565 GGCCCGCGCAGGGCGGGCGTGGG + Intronic
1057146972 9:92764947-92764969 GCCGGGGGCCGGGCGGGCGCCGG - Intergenic
1057199892 9:93134307-93134329 GCTCGCCGCCGGGCGGGCCGGGG - Intergenic
1057228888 9:93306896-93306918 TCCCGCGGCCGGGCGGGCGTGGG + Intronic
1057432254 9:95004996-95005018 TGCGGACCCCGGGCGGGCGCAGG + Intronic
1057489572 9:95510878-95510900 TGCCCCGGCCGCGCGGGCGCGGG - Intronic
1057494959 9:95553501-95553523 GGCCGCGGCGGGGCGGCGGCTGG - Intergenic
1057716623 9:97501450-97501472 GGCTGCAGCCGAGCGAGCGCGGG - Intronic
1058053350 9:100427417-100427439 GGCCGCAGCCGGGCGGGGGCGGG + Intronic
1059633944 9:116154357-116154379 CGCCGCCGCCGGGCGGTGCCTGG + Exonic
1060514691 9:124258257-124258279 GTCGGCGGCCGGGCGGGCGGGGG + Intronic
1060544747 9:124453341-124453363 GGGAGCAGCGGGGCGGGCGCTGG + Exonic
1061212674 9:129202922-129202944 GGCCCGGGCGGGGCGGGCGCTGG - Intergenic
1061257403 9:129460638-129460660 GGCCGCCGCGGGCCCGGCTCCGG + Intergenic
1061262627 9:129488531-129488553 GGCGGCCGCGGGGCGGGGGCGGG - Intergenic
1061365845 9:130172238-130172260 GGCCGCGGCCAGGCGGGTGCGGG + Intergenic
1061365925 9:130172485-130172507 GGCGGCCGCTGGGCAGGCCCGGG - Intergenic
1061472123 9:130835203-130835225 GGCGGCGGCGGGGCGGGGGCGGG + Intronic
1061472199 9:130835421-130835443 GGCCCCCGACGTGCTGGCGCGGG + Intronic
1061559679 9:131394352-131394374 GGCCGCCGCCGGGGGCCCGGGGG + Intronic
1061666725 9:132164342-132164364 GGACGCCGCCGGGCGCGGGGAGG - Intronic
1061825579 9:133256425-133256447 GGCCGCTGGCGGGCGGGTGCAGG - Intronic
1061975936 9:134068087-134068109 GTCCGCGGCCGGGCCCGCGCCGG + Intronic
1062036842 9:134386249-134386271 GGCCGCTGGCCGGCGGGCTCAGG - Intronic
1062387511 9:136318843-136318865 GACAGACGCAGGGCGGGCGCAGG + Intergenic
1062696291 9:137877877-137877899 GGCCCCGGCAGGGAGGGCGCGGG - Exonic
1203768390 EBV:38328-38350 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768440 EBV:38453-38475 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768490 EBV:38578-38600 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768540 EBV:38703-38725 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768590 EBV:38828-38850 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768640 EBV:38953-38975 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768690 EBV:39078-39100 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768740 EBV:39203-39225 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768790 EBV:39328-39350 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768840 EBV:39453-39475 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768890 EBV:39578-39600 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768940 EBV:39703-39725 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203773375 EBV:60356-60378 CGCCGCCGCCAGGTGGGCCCTGG - Intergenic
1203470262 Un_GL000220v1:112908-112930 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1203478083 Un_GL000220v1:156880-156902 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1186463358 X:9765645-9765667 GGCCGCCGGCCCGCGGGCCCCGG - Exonic
1187507267 X:19887755-19887777 CGCGGCCGCCGGGCGGGGGCGGG + Intergenic
1187507291 X:19887805-19887827 GGCCGCGTCGGGGCAGGCGCCGG + Intergenic
1189324580 X:40105041-40105063 GGCCGCTCCCTGGCTGGCGCCGG + Intronic
1189331444 X:40146965-40146987 GGCCGGCGGCGTGCGGGCCCGGG + Intronic
1189446728 X:41086489-41086511 AGCGGCCGCCGGGCGGGGGGCGG - Intronic
1199445080 X:147911964-147911986 GGCCGCCTCTGAGCGGGCGGCGG + Intronic
1199699081 X:150363372-150363394 GGCCGGCGGCGGGCGGGCGCGGG + Intronic
1199772727 X:150984347-150984369 GGGGGCCGACGGGCGGGCGGCGG + Intronic
1199942222 X:152637932-152637954 CGCAGCTGCCGGGCGGGCCCTGG + Intergenic
1200001912 X:153066525-153066547 GGCCGCGGCCGGTGGGGAGCTGG + Intergenic
1200005820 X:153083500-153083522 GGCCGCGGCCGGTGGGGAGCTGG - Intergenic
1200217533 X:154374679-154374701 GCCGGGCGCGGGGCGGGCGCGGG - Intergenic
1200292464 X:154886265-154886287 GGCTGCCGCCGTGCCCGCGCCGG - Intronic
1200339308 X:155382005-155382027 GGCTGCCGCCGTGCCCGCGCCGG - Intergenic
1200347162 X:155458688-155458710 GGCTGCCGCCGTGCCCGCGCCGG + Intergenic
1201895884 Y:18992764-18992786 CGCTGGCTCCGGGCGGGCGCAGG + Intergenic