ID: 1146058594

View in Genome Browser
Species Human (GRCh38)
Location 17:29593202-29593224
Sequence CTGTGGGGACCCGGGGGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 575}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146058589_1146058594 -10 Left 1146058589 17:29593189-29593211 CCGGGCTATGCAGCTGTGGGGAC 0: 1
1: 0
2: 1
3: 11
4: 201
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058571_1146058594 30 Left 1146058571 17:29593149-29593171 CCACATCCCCGTATCCCGCGCCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058573_1146058594 24 Left 1146058573 17:29593155-29593177 CCCCGTATCCCGCGCCGGCCGCT 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058582_1146058594 10 Left 1146058582 17:29593169-29593191 CCGGCCGCTCGGGCTGAGGGCCG 0: 1
1: 0
2: 2
3: 5
4: 144
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058579_1146058594 15 Left 1146058579 17:29593164-29593186 CCGCGCCGGCCGCTCGGGCTGAG 0: 1
1: 1
2: 2
3: 16
4: 135
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058575_1146058594 22 Left 1146058575 17:29593157-29593179 CCGTATCCCGCGCCGGCCGCTCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058585_1146058594 6 Left 1146058585 17:29593173-29593195 CCGCTCGGGCTGAGGGCCGGGCT 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058578_1146058594 16 Left 1146058578 17:29593163-29593185 CCCGCGCCGGCCGCTCGGGCTGA 0: 1
1: 0
2: 2
3: 13
4: 103
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058574_1146058594 23 Left 1146058574 17:29593156-29593178 CCCGTATCCCGCGCCGGCCGCTC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146058594 Original CRISPR CTGTGGGGACCCGGGGGCTG CGG Intronic