ID: 1146058594

View in Genome Browser
Species Human (GRCh38)
Location 17:29593202-29593224
Sequence CTGTGGGGACCCGGGGGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 575}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146058571_1146058594 30 Left 1146058571 17:29593149-29593171 CCACATCCCCGTATCCCGCGCCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058579_1146058594 15 Left 1146058579 17:29593164-29593186 CCGCGCCGGCCGCTCGGGCTGAG 0: 1
1: 1
2: 2
3: 16
4: 135
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058573_1146058594 24 Left 1146058573 17:29593155-29593177 CCCCGTATCCCGCGCCGGCCGCT 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058589_1146058594 -10 Left 1146058589 17:29593189-29593211 CCGGGCTATGCAGCTGTGGGGAC 0: 1
1: 0
2: 1
3: 11
4: 201
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058578_1146058594 16 Left 1146058578 17:29593163-29593185 CCCGCGCCGGCCGCTCGGGCTGA 0: 1
1: 0
2: 2
3: 13
4: 103
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058585_1146058594 6 Left 1146058585 17:29593173-29593195 CCGCTCGGGCTGAGGGCCGGGCT 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058582_1146058594 10 Left 1146058582 17:29593169-29593191 CCGGCCGCTCGGGCTGAGGGCCG 0: 1
1: 0
2: 2
3: 5
4: 144
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058575_1146058594 22 Left 1146058575 17:29593157-29593179 CCGTATCCCGCGCCGGCCGCTCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575
1146058574_1146058594 23 Left 1146058574 17:29593156-29593178 CCCGTATCCCGCGCCGGCCGCTC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 60
4: 575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146058594 Original CRISPR CTGTGGGGACCCGGGGGCTG CGG Intronic
900148003 1:1166749-1166771 ACGTGGGGCCCGGGGGGCTGGGG + Intergenic
900252910 1:1680694-1680716 CTGTGGGGACAGGGATGCTGGGG - Intronic
900290357 1:1921120-1921142 CTGTGGGCCCTGGGGGGCTGGGG + Intergenic
900319854 1:2077370-2077392 CTGTGGGGACCCAGGTGCACTGG + Intronic
900387422 1:2416924-2416946 CTGGGGGGGCCCTGGGGCTCTGG + Intergenic
900521931 1:3110081-3110103 GTGTGGGGACACAGTGGCTGTGG + Intronic
900521978 1:3110238-3110260 GTGTGGGGACACAGTGGCTGTGG + Intronic
900524964 1:3124100-3124122 CTGCTGGGACCCGGGTGCTTAGG + Intronic
900542011 1:3207668-3207690 CTGTGGTCTCCCGGGAGCTGAGG + Intronic
900952624 1:5866337-5866359 CTTTGGGGACCTGGAGGCGGTGG - Intronic
901052266 1:6431095-6431117 CTGTGGGGGTCAGGGAGCTGGGG + Intronic
901109628 1:6784904-6784926 GCGTGGGGTCCCGGTGGCTGTGG - Intergenic
901235668 1:7666392-7666414 CTGAGGCGGCCTGGGGGCTGGGG - Intronic
902772812 1:18655553-18655575 TTGAGGGGAGCCGGGGCCTGTGG + Intronic
903365447 1:22802883-22802905 CTGTGGGCTCCTGGGGGCAGAGG - Intronic
903479881 1:23645312-23645334 CTCTGGGAAGCTGGGGGCTGAGG + Intergenic
904300387 1:29550055-29550077 CCTTGGGGAACTGGGGGCTGGGG + Intergenic
904457834 1:30658003-30658025 CCGTGGGGGCCTGGGGGCTGGGG - Intergenic
904498424 1:30900688-30900710 TTGCGGGCACCAGGGGGCTGTGG - Intronic
904575240 1:31501290-31501312 CTGTGGGGAGTGGGGAGCTGGGG + Intergenic
904801132 1:33093593-33093615 TTCTGGGGACCCTGGGACTGGGG - Intronic
905627368 1:39497909-39497931 CTGTGGGGACCTGGGGTCCCAGG - Intronic
905629105 1:39509017-39509039 CTGTGGGGACGCCCGTGCTGTGG - Intronic
905798275 1:40827606-40827628 CTCTGGGGCCCTGTGGGCTGGGG + Intronic
906126926 1:43432533-43432555 CTCTGGGGACCCAGGTGCTTGGG - Exonic
907549482 1:55292227-55292249 CTGTGGTGAGCAGGGGGCTCAGG + Intergenic
908392767 1:63698645-63698667 CCGTGGAGACACAGGGGCTGAGG + Intergenic
908501018 1:64744626-64744648 CTGGGGCGGCCCGGGGGCTGCGG - Intergenic
910331531 1:86077832-86077854 CTGTGGGGGTTGGGGGGCTGGGG + Intronic
910414069 1:86979372-86979394 CAGTGGTTACCCAGGGGCTGGGG - Intronic
913937200 1:125065769-125065791 CACCGGGGACCCGGGGGCTTGGG + Intergenic
914428228 1:147598861-147598883 CTGTGTGGCCCCGGTTGCTGCGG - Intronic
914802997 1:150974285-150974307 AGGTGGGGACGCGGGGGCTGCGG - Intronic
915347151 1:155203306-155203328 CTGTCGGGACCCAGGGTGTGAGG + Intronic
915625526 1:157111895-157111917 GTGTGCGGAGCCGGTGGCTGCGG + Intergenic
916786491 1:168090720-168090742 CTGTGGGGAAACGGAGGCTGGGG - Intronic
919728685 1:200899656-200899678 GTGTGGGGATGCGGGAGCTGGGG + Intronic
919782387 1:201229252-201229274 GTGTGGGGACCACAGGGCTGGGG + Intergenic
920118179 1:203636042-203636064 CTGAGGGAACCTGGGGACTGAGG + Intronic
920250295 1:204618538-204618560 CCGAGGGGACCCTGGAGCTGCGG - Exonic
920509268 1:206538627-206538649 CAGTGGGGATGCTGGGGCTGAGG + Intronic
920528361 1:206684970-206684992 CTCTGGGGACCGCGGGGCGGCGG - Intronic
921910981 1:220548676-220548698 CTGTGGTGAGCCGGAGGCTGCGG + Intronic
923092006 1:230747899-230747921 CGGTGGGGACCCGGGGCATCTGG + Intronic
923150830 1:231231836-231231858 CTGTGGGGACACCAGGGCTGAGG + Intronic
1063158699 10:3403394-3403416 CTCTGGGGACTGGGGGGCTCAGG + Intergenic
1063271634 10:4515592-4515614 CTGTGGTGAGCAGGGGGTTGGGG + Intergenic
1063395641 10:5684975-5684997 CGGCGAGGACCCCGGGGCTGGGG + Exonic
1064143144 10:12806871-12806893 CCGTGGGGACTTTGGGGCTGTGG + Intronic
1066202857 10:33158865-33158887 CTTTGGGGACTCGGGGGGAGAGG + Intergenic
1067552503 10:47245584-47245606 GTGTGGGGGTCCTGGGGCTGAGG - Intergenic
1067691455 10:48504676-48504698 CTGTGGGGCTCCGTGGGCTGAGG + Intronic
1069486774 10:68828380-68828402 CTCTGAGGGCCCGGGGGCTGCGG + Intronic
1070722390 10:78765579-78765601 CTGTGGGGTCCCTGAGGGTGAGG + Intergenic
1070777004 10:79115646-79115668 CTGGGGGGAACTGAGGGCTGAGG + Intronic
1070830132 10:79413127-79413149 CTGAGGGGACCAGTGGGCGGTGG + Intronic
1072500719 10:96015006-96015028 CTGTGGGGGCCAGGGAGGTGGGG - Intronic
1072570652 10:96654917-96654939 CTGTGGGGACCCGCCAACTGGGG + Intronic
1072629237 10:97134227-97134249 CTGTGGGGACACAAAGGCTGTGG - Intronic
1072683558 10:97523676-97523698 ATTTGGGCACCTGGGGGCTGGGG + Intronic
1072881405 10:99232968-99232990 TTGTGGGGCCCCTGGGGCTGCGG - Intronic
1073484290 10:103806834-103806856 CTGAGGGGACCCAGGGGCTCAGG + Intronic
1073897097 10:108174548-108174570 GTCTGGAGACCCGGGAGCTGAGG - Intergenic
1074421166 10:113309768-113309790 CAGTGGGCCCCTGGGGGCTGGGG + Intergenic
1075446336 10:122516059-122516081 CTGTGTGGTCCCCGGAGCTGAGG + Intergenic
1075782389 10:125026024-125026046 CTGGGGGGAGCAGGGGGGTGCGG - Intronic
1076146374 10:128125883-128125905 CTTTGGGGCGCCGGGGGCTGCGG - Intronic
1076368390 10:129936528-129936550 GTGTGGGGAACCAGGGGCTGTGG + Intronic
1076368404 10:129936565-129936587 ATGTGGGGAACCAGGGGCTATGG + Intronic
1076462726 10:130657326-130657348 CTCAGGGGACACAGGGGCTGGGG + Intergenic
1076708814 10:132319689-132319711 CTGTGGGAATGCAGGGGCTGAGG + Intronic
1076792526 10:132784899-132784921 TTGTGAGGACCCGCGGGGTGGGG - Exonic
1076798640 10:132810722-132810744 CTGTGGGGACCCGGCTCCCGTGG + Intronic
1076849948 10:133087883-133087905 CAGCGGGGACCCGGGGCCGGAGG - Exonic
1076873217 10:133203608-133203630 CTGCGGGTGCCCTGGGGCTGTGG + Intronic
1077025730 11:439088-439110 CTGAGGTGACCTGGGGGCTGGGG - Intronic
1077090931 11:777853-777875 CAGGGGAGACCGGGGGGCTGCGG + Intronic
1077137471 11:1008225-1008247 CTGAGGGGACCCGGGGCGTGCGG + Intronic
1077233256 11:1468137-1468159 CTGTAGGGCACAGGGGGCTGGGG - Intergenic
1077333318 11:1992894-1992916 CTGCGGGGCCCCCGGGCCTGTGG + Intergenic
1077393111 11:2308859-2308881 CAGTGGGCACCTGGGGACTGGGG + Intronic
1077477479 11:2797248-2797270 CTCTGGGGAGCTGGGAGCTGGGG - Intronic
1077655067 11:4010865-4010887 CTGTTGGGGGCTGGGGGCTGGGG - Intronic
1077916581 11:6615546-6615568 CTGTGGTGACATAGGGGCTGAGG + Exonic
1078846073 11:15119423-15119445 CTGAGGGGACCCTGGAGCTGGGG - Intronic
1079083617 11:17430356-17430378 CTGTGAGGGCTCAGGGGCTGTGG + Intronic
1080601892 11:33829049-33829071 TTGTGGGGACCCGGGGAGAGGGG - Intergenic
1081528298 11:43942146-43942168 CTCTGGGGAGCCGGGCGCTCAGG + Intronic
1081893674 11:46566582-46566604 CAGACGGGACCCGGGGGGTGAGG + Intronic
1083669451 11:64291941-64291963 CTGTGCGGACGCGGGGGAGGCGG + Intronic
1083721890 11:64607511-64607533 ATGGGGGAAGCCGGGGGCTGAGG + Exonic
1083781670 11:64921548-64921570 CAGAGGTGGCCCGGGGGCTGCGG + Intronic
1083833330 11:65247600-65247622 TCATGGGGACCCTGGGGCTGTGG + Intergenic
1084116278 11:67044780-67044802 CTGTGGGCACCCGGAGGCATCGG + Intronic
1084189099 11:67490899-67490921 CTGTGGTGAGCCGAGAGCTGCGG + Exonic
1084402075 11:68950385-68950407 CTGTGTGGTCTCGGTGGCTGTGG + Intergenic
1084429572 11:69103567-69103589 CTGTGGGGACCCGAGCACAGGGG + Intergenic
1084546782 11:69818677-69818699 CTGCGGGGCCCCGGGGGAAGCGG - Intronic
1084942218 11:72618822-72618844 CAGTGGGGCCACAGGGGCTGAGG + Intronic
1084943203 11:72625319-72625341 GTCTGGGCACCCTGGGGCTGGGG - Intronic
1087108814 11:94440615-94440637 CTTTGGGCAGCCGTGGGCTGTGG - Intronic
1088578514 11:111295926-111295948 CTGTGGGTACCTGGGGTCTCAGG + Intergenic
1089018402 11:115186424-115186446 CTGTGCGCACCCGGGGAATGAGG - Intronic
1090194344 11:124801720-124801742 CTTTGGGGACTCGGGAGCTCAGG - Intergenic
1091041276 11:132284069-132284091 CTCTAGGGATCCTGGGGCTGAGG - Intronic
1202816298 11_KI270721v1_random:48075-48097 CTGCGGGGCCCCCGGGCCTGTGG + Intergenic
1091799782 12:3317456-3317478 CTGTGGGGGTCTGGGGGCAGTGG + Intergenic
1091844366 12:3644549-3644571 CTGTGGGGGACCAAGGGCTGTGG - Intronic
1092104622 12:5912657-5912679 CTGTGCGGTCCCAGGGGCAGGGG + Intronic
1094564874 12:31590632-31590654 CTGTGGGGACGCGCGGGAGGCGG - Intronic
1095688323 12:45060754-45060776 TTGTGGTGACCCGGGGCCTTAGG - Intergenic
1096460591 12:51819815-51819837 CTCTGGAGGCCCAGGGGCTGAGG - Intergenic
1096499137 12:52054861-52054883 CTGTGGGGGCCCAGAGGCTTTGG - Exonic
1096571096 12:52523809-52523831 CTGGAGGGGCCTGGGGGCTGGGG - Intergenic
1096977457 12:55707733-55707755 CTGGGGGGACCTGGGGCTTGGGG - Intronic
1097245418 12:57605089-57605111 CGGTGGGGATCCGGGGGCTTTGG + Intronic
1097290418 12:57909830-57909852 GTGTGTGGAGCCAGGGGCTGTGG + Intergenic
1097661457 12:62435596-62435618 ATGTGGAGATACGGGGGCTGTGG - Intergenic
1099590053 12:84575339-84575361 CTGTGGGGAGGGGGTGGCTGTGG + Intergenic
1100059180 12:90551779-90551801 CTTTGGGGACTCGGGGGATAGGG - Intergenic
1100969005 12:100046570-100046592 CTGTTGGGAGGTGGGGGCTGGGG + Intronic
1102037970 12:109782982-109783004 CTGGGGGGAGCCAGGGGCAGGGG - Intergenic
1102238395 12:111308861-111308883 CTGTGGGGAGCAGTAGGCTGCGG + Intronic
1102463743 12:113115816-113115838 CTTTGGGGTCCCAGGGGCCGAGG - Intronic
1102535483 12:113577516-113577538 CAGTGGGGACCCATGAGCTGAGG - Intergenic
1102555448 12:113723809-113723831 CGGTGGGCAGCCAGGGGCTGGGG + Intergenic
1103294262 12:119872878-119872900 CTCTGGGGCCCCGGAGGCAGAGG - Intronic
1103623770 12:122204099-122204121 CTGCGGGGACCCCCGGGCCGGGG - Intronic
1103718410 12:122959996-122960018 CGCTGGGGCCCCGGCGGCTGCGG - Exonic
1103944253 12:124517511-124517533 CGGTGGGGAGCCGGGCGCCGGGG + Intronic
1104127484 12:125861662-125861684 CTGCGGGGACGCCGGGGTTGGGG - Intergenic
1104727142 12:131084998-131085020 CTGCTGGGAGCCGGGCGCTGGGG + Intronic
1104804022 12:131573686-131573708 CAGTGGGGAGCCGGGGGGAGTGG - Intergenic
1104844533 12:131840247-131840269 CAGTGGGGAGCAGGGGGATGGGG + Intronic
1104921192 12:132291641-132291663 CGGTGTGGACCTGGGTGCTGTGG - Intronic
1104983148 12:132582824-132582846 CTGTGGGGGTGCGGGAGCTGTGG + Intronic
1105820449 13:24076607-24076629 CTCTGGTGACCCGGGGTCTGGGG + Intronic
1106234470 13:27850470-27850492 CTTTGGGGACTCGGGGGAGGAGG + Intergenic
1107768969 13:43769302-43769324 TTGTGGGGACCCAGTGGCAGAGG - Intronic
1110608029 13:77456360-77456382 CTGTGAGGACCAGTGGTCTGAGG + Intergenic
1111864055 13:93745664-93745686 CTGTGGGTAACTGGGAGCTGTGG - Intronic
1113467036 13:110520065-110520087 CTGGGGGGATCCGTGTGCTGGGG + Intergenic
1113467061 13:110520151-110520173 CTGGGGAGACCCGTGTGCTGGGG + Intergenic
1113512981 13:110870491-110870513 CTGTGGGCAGCCTGGGGATGAGG - Intergenic
1113927843 13:113951276-113951298 CCGTGGGGGCCCCGGTGCTGAGG - Intergenic
1113950227 13:114067245-114067267 CTGCGGACACCCCGGGGCTGAGG + Intronic
1114553668 14:23549221-23549243 CTATGCGGACTCGGGGGCAGGGG - Intronic
1114637328 14:24195325-24195347 CGGTGAGGACCCCGGGGCTGTGG - Intronic
1115139002 14:30145998-30146020 CTGTGTGGGCCCAGGTGCTGAGG - Intronic
1115949809 14:38708265-38708287 CTGTAGCTACCCAGGGGCTGTGG - Intergenic
1116844448 14:49852474-49852496 CTGGGAGGACGCGGGGGATGGGG + Intronic
1119113214 14:71994986-71995008 CTATGTGGAACTGGGGGCTGAGG + Intronic
1119453635 14:74735136-74735158 TTGTGGGGCCGCGGGGGTTGGGG + Exonic
1121052543 14:90828833-90828855 TTGTGGGGAGCCCTGGGCTGTGG - Intergenic
1121463667 14:94100800-94100822 CTGGGGGGAGGCGGGGGATGGGG - Intronic
1121781507 14:96625071-96625093 CTGTGAAGATCCGGGGTCTGGGG + Intergenic
1122374097 14:101247216-101247238 CCTTGGGGTGCCGGGGGCTGGGG - Intergenic
1122471014 14:101965505-101965527 TTGTGGGGACCCAGAGGCCGAGG + Intronic
1122692117 14:103536371-103536393 CTGTGGGTCACCGGGGGCTGTGG + Exonic
1122781172 14:104144176-104144198 CTTTGGGGTCCCAGGGGTTGAGG + Intronic
1122981853 14:105195625-105195647 CTGTGGGGACACGGCAGCAGTGG + Intergenic
1122982093 14:105196558-105196580 CTCGGGGCTCCCGGGGGCTGGGG - Intergenic
1123014648 14:105367898-105367920 CTTGGGGGACTCGGGGGCTCGGG + Intronic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1123104963 14:105837004-105837026 CAGAGGGGAGCCGGGGGCAGGGG + Intergenic
1123117305 14:105900509-105900531 CTGTGGGGCTCCGCGTGCTGGGG + Intergenic
1123996559 15:25721941-25721963 CCGTGAGGACCAGGGAGCTGGGG + Intronic
1124890337 15:33726430-33726452 CTGTGGGGACCAGGGAGCGCAGG - Exonic
1125501009 15:40240350-40240372 CTGTGGGGACCAGGGGCTTGAGG - Intronic
1127142658 15:55993488-55993510 GTGCGGGGACCGCGGGGCTGCGG - Intronic
1127433329 15:58933311-58933333 CTGCGGGCAGCCGGAGGCTGCGG + Intronic
1127703247 15:61522778-61522800 CTCTGGGGAAGTGGGGGCTGGGG + Intergenic
1128112846 15:65087425-65087447 CTGTGAGGCCCTGGGGGCAGGGG - Intergenic
1128318427 15:66675910-66675932 CTGGTGGGAGCCGGGTGCTGGGG + Intronic
1128377683 15:67089033-67089055 CTGTGTGGGCCAGGGTGCTGAGG - Intronic
1128462921 15:67884795-67884817 CTGTGGGGAGGCGGGGGCGGCGG - Intergenic
1128666152 15:69539728-69539750 CTGTGGGGTTGCGGGGGGTGGGG + Intergenic
1128750989 15:70148826-70148848 CTGTCGGGAGCCTGGGGTTGGGG + Intergenic
1129236894 15:74229082-74229104 TTGTGGGGAGCCTGGGGGTGGGG - Intergenic
1129428246 15:75480688-75480710 CTGTGGGGCGGCGGTGGCTGCGG - Intronic
1130094353 15:80844865-80844887 CCATGGGCACCCTGGGGCTGGGG - Intronic
1130255369 15:82323458-82323480 CGGGGGGGACTGGGGGGCTGGGG - Intergenic
1131285256 15:91051550-91051572 CTGTGGGGACCTGGCAGCTGGGG - Intergenic
1131380443 15:91959258-91959280 CTCTGGGGACTTGGGGGTTGGGG + Intronic
1132251973 15:100341306-100341328 CCGTCGGGGCCCGGGGGCTGCGG + Exonic
1132569001 16:635924-635946 CTGTGCGGCCCCCGCGGCTGCGG - Intronic
1132570182 16:641069-641091 CTGGGGGGATCCCTGGGCTGGGG - Intronic
1132710962 16:1267230-1267252 CTGTTGGGAGCCGGGAGCAGTGG + Intergenic
1132973749 16:2701442-2701464 CTGTGAGGACACAGGGGCTCCGG + Intronic
1133006288 16:2883437-2883459 CTCGGGGGTCCCGAGGGCTGCGG + Intronic
1133253582 16:4501914-4501936 CTGTACAGACCTGGGGGCTGGGG - Intronic
1133300255 16:4778057-4778079 GTGTGGGGAGCCTGGGGCTAGGG - Intronic
1134084781 16:11348893-11348915 CTTTGGGGAGCCTGGGGCAGTGG + Intronic
1134690319 16:16187014-16187036 CTGGGGGGAGATGGGGGCTGCGG - Intronic
1134930759 16:18205891-18205913 CTGTGGGGACTCGGGGGAAAGGG + Intergenic
1135548357 16:23380398-23380420 CTGTGGGGAACAGGGAGCTGGGG - Intronic
1135884819 16:26296136-26296158 CTCTGGGGATCCTGGGGCTTGGG + Intergenic
1136267234 16:29128909-29128931 CTATGAGGACCCGGGGGTGGTGG + Intergenic
1136270648 16:29146382-29146404 CTGTGGGGACGCGGGGATGGAGG + Intergenic
1136270665 16:29146442-29146464 CTGTGGGGACGCGGGGACGGGGG + Intergenic
1136284181 16:29231564-29231586 CACTGGGGACCTGGGGGGTGAGG - Intergenic
1137001858 16:35235858-35235880 TTGTGGGGCCCCAGGAGCTGTGG - Intergenic
1137354551 16:47748229-47748251 CATGGGGGACCCTGGGGCTGAGG - Intergenic
1137567610 16:49543322-49543344 CTGTGGGGATTGGGGGGCTGAGG - Intronic
1138287400 16:55820815-55820837 CTGTGGGGTCCAGTGGGCTAGGG - Intronic
1138428191 16:56950467-56950489 GTGTAGGGACCCGGAGGGTGGGG + Intergenic
1139518260 16:67464612-67464634 CAGGGGAGACCCTGGGGCTGTGG + Intronic
1139786583 16:69397874-69397896 CTTTTGGGACTTGGGGGCTGGGG - Intronic
1139947373 16:70650462-70650484 CCCTGGGGACCCGGCAGCTGTGG - Intronic
1141456332 16:84144939-84144961 CGGAGGGGGCCCGGGGCCTGGGG + Intronic
1141638720 16:85329116-85329138 CTGGGGGGCCCAGGGAGCTGTGG - Intergenic
1141769043 16:86077771-86077793 CTGTCAGGACCCCGAGGCTGAGG + Intergenic
1142050720 16:87956460-87956482 CTTTGGGGGCCTGGGGGCCGTGG + Intronic
1142064173 16:88051115-88051137 CGGGAGGGACCCGGGTGCTGCGG - Intronic
1142070525 16:88089232-88089254 CTGTGAGAACCCGGGGGTGGTGG + Intronic
1142129999 16:88428084-88428106 CTGGGGGGGCCCCGGGGCTGGGG - Exonic
1142147242 16:88497753-88497775 CTGTCGGGACCCTGGGGCGGGGG - Intronic
1142149238 16:88505489-88505511 CTGAGGGCACCAGGGGGCAGAGG - Intronic
1142168378 16:88605960-88605982 CTCTGGGGACGCGGGGCCTCTGG + Intronic
1142229329 16:88892376-88892398 CTGTGTGGACAAGGAGGCTGTGG + Exonic
1142255821 16:89013454-89013476 CTGTGGGGACCAGGAGGAAGTGG + Intergenic
1142353702 16:89591259-89591281 CTGTAGGTGCCCGGGGGGTGTGG + Exonic
1142406165 16:89891399-89891421 CTGTGGGGAGCCCGGGGCCAGGG + Intronic
1142596273 17:1031529-1031551 CTGCGGGGCTCGGGGGGCTGCGG - Intronic
1142611373 17:1110603-1110625 CTGGGGGGAGTGGGGGGCTGTGG - Intronic
1142685578 17:1575347-1575369 CCCCGGGGACCCGGGGCCTGGGG - Exonic
1142757389 17:2024304-2024326 CTCTGGGCACCCAGCGGCTGAGG - Intronic
1142878119 17:2864594-2864616 GTGTGGGGAGCAGGAGGCTGGGG + Intronic
1142982362 17:3679590-3679612 CTGTGGGGCTCCAGGAGCTGTGG + Exonic
1143136788 17:4716626-4716648 CTCTGAGGGCCAGGGGGCTGGGG + Exonic
1144429275 17:15175525-15175547 CTGTGGGGACTTGGGGGTAGGGG - Intergenic
1144800287 17:17921591-17921613 CTTTGGGGAAGAGGGGGCTGTGG + Intronic
1144968293 17:19091366-19091388 CCATCGGGACCAGGGGGCTGGGG + Intergenic
1144979624 17:19160697-19160719 CCATCGGGACCAGGGGGCTGGGG - Intergenic
1144988598 17:19217535-19217557 CCATCGGGACCAGGGGGCTGGGG + Intronic
1145413525 17:22694480-22694502 CTGTGGGGGCCCGGGCGGGGAGG - Intergenic
1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG + Intronic
1146172079 17:30642015-30642037 CTTTGGTCACCCTGGGGCTGAGG - Intergenic
1146329601 17:31916933-31916955 GTGCGGGGTCCCGGGGGCAGGGG - Intergenic
1146345531 17:32058041-32058063 CTTTGGTCACCCTGGGGCTGAGG - Intergenic
1146692714 17:34887789-34887811 CAGTGGAGACCAGGGTGCTGGGG - Intergenic
1146907445 17:36626957-36626979 ATGTGGGGATTTGGGGGCTGGGG - Intergenic
1147166932 17:38598487-38598509 CTGTGGGGTCTCTGGGTCTGGGG + Intronic
1147677917 17:42220064-42220086 CTGGGGGCACACGGGTGCTGGGG + Intronic
1147688131 17:42299508-42299530 CTGGGGGCACACGGGTGCTGGGG - Intronic
1147723971 17:42554986-42555008 CTGTGTGGTCCCTGGGGATGGGG + Exonic
1147782228 17:42951799-42951821 CTGTGGAGACCCTGGGGCCCAGG - Exonic
1148048666 17:44758917-44758939 CTGGGGGGGCCGGGGGGCGGCGG + Intergenic
1148178448 17:45586485-45586507 CTGTGGAGAGCAGGTGGCTGTGG + Intergenic
1148245293 17:46026242-46026264 CTGTTGGGTCCCAGGTGCTGAGG - Exonic
1148270712 17:46259970-46259992 CTGTGGAGAGCAGGTGGCTGTGG - Intergenic
1148443766 17:47725658-47725680 CTGACGGGCCCAGGGGGCTGGGG - Intergenic
1148843745 17:50516340-50516362 CTGTGGTGAGCCAGGGGCTGTGG + Intronic
1149615699 17:57996195-57996217 CTTTGGGGAGCCGGGCGCGGTGG + Intronic
1151131031 17:71896101-71896123 CTGTGCGGCCCCGGGGGATTGGG - Intergenic
1151217009 17:72583868-72583890 CCGTGGGGACCTGGGGTGTGTGG - Intergenic
1151341205 17:73472082-73472104 CAATGGGGACCCAGGGGCAGGGG - Intronic
1151368155 17:73630476-73630498 CTGGGGGAACCTGGGGGTTGAGG - Intronic
1151494794 17:74453003-74453025 CTCTGGGGACCCAGGGCATGAGG - Intergenic
1151529699 17:74696438-74696460 ATGTGGGGAGCAGGGGGCTGGGG - Intronic
1151630760 17:75309339-75309361 CTGTGGCGTCCCTGGTGCTGTGG + Intergenic
1151710416 17:75801828-75801850 CTGGGGGGAGCCGGGTGCAGTGG - Intronic
1151717885 17:75840649-75840671 CTTTGGGGTCCAGGTGGCTGCGG - Intronic
1152092717 17:78256080-78256102 CTCTGAGGGCCCGGGGGCTTTGG + Intergenic
1152093250 17:78258380-78258402 CTGGGGGGTCCCAGGGGCAGGGG - Intergenic
1152147299 17:78576066-78576088 CTCTGGGGGTCCGTGGGCTGGGG + Intronic
1152227112 17:79097621-79097643 CCGTGGGGCTCCGGGGGCTCTGG - Intronic
1152242065 17:79165995-79166017 CTGTGTAAACCCGGGGCCTGTGG - Intronic
1152281927 17:79389982-79390004 CTGCGGAGACCTGGAGGCTGCGG - Intronic
1152281931 17:79389999-79390021 CTGCGGAGACCTGGAGGCTGCGG - Intronic
1152281944 17:79390050-79390072 CTGCGGAGACCCGGCGGCTGCGG - Intronic
1152281949 17:79390067-79390089 CTGCGGAGACCCGGAGGCTGCGG - Intronic
1152281954 17:79390084-79390106 CTACGGAGACCCGGAGGCTGCGG - Intronic
1152282121 17:79390980-79391002 CTGTGGGAATCAGGGGGCTGTGG - Intronic
1152352512 17:79791471-79791493 CTGCGGGGACTCGGGGGCGGGGG + Intergenic
1152363544 17:79843168-79843190 AAGTGGGGACCCGGGGGTTGGGG - Intergenic
1152413905 17:80146730-80146752 CGGGGGCGAGCCGGGGGCTGAGG - Intronic
1152468431 17:80477941-80477963 CTGCGCGCAGCCGGGGGCTGGGG + Intergenic
1152569106 17:81113666-81113688 CTCTGAGGACCCTGGGGCTGGGG - Intronic
1152575839 17:81140666-81140688 CCGTGGGGACCATGGGGCCGTGG + Intronic
1152576485 17:81143531-81143553 CTGCGTGGACACGGGGGGTGGGG - Intronic
1152627125 17:81393027-81393049 CTGCGTGGACCCGGGGCCTCGGG + Intergenic
1152736303 17:81998979-81999001 CTGTGGGGTCCCTGGCCCTGTGG + Intronic
1152825425 17:82461869-82461891 CTGTGGGGACTGTGGGGCTTAGG + Intronic
1152961350 18:82162-82184 CTGTGGGGACCAGGGGACCAGGG + Intergenic
1153040836 18:812082-812104 CGGTGGGGCCCCGCGGGCGGAGG - Intronic
1153512287 18:5869053-5869075 CTGAGGGGAATCTGGGGCTGAGG - Intergenic
1153733706 18:8043007-8043029 CTGTGGGGAACAGAGGGCTGAGG - Intronic
1154092877 18:11381312-11381334 CTGTAGGGACACAGGGGCTGGGG + Intergenic
1156088669 18:33440282-33440304 CAGTGGGGACTGGGGGACTGGGG + Intronic
1156350210 18:36296938-36296960 TTGTGGGGCCGCGGGGGCTTGGG - Intergenic
1156450368 18:37263165-37263187 CTGTGAGGACACTGAGGCTGAGG + Intronic
1156502424 18:37567847-37567869 CTGAGCGGACTCGGGGCCTGGGG - Intergenic
1157307194 18:46525835-46525857 CTGTGGGGTCCTGGGGGCAGAGG - Intronic
1157586772 18:48806074-48806096 ATGAGGAGTCCCGGGGGCTGTGG + Intronic
1157616213 18:48989154-48989176 CTGGGGCTGCCCGGGGGCTGTGG + Intergenic
1157619288 18:49006792-49006814 CTGTGGTGAGGAGGGGGCTGGGG + Intergenic
1157930108 18:51812367-51812389 CTGTGGGGTTCCAGGTGCTGTGG - Intergenic
1160158763 18:76455012-76455034 CTTTGGGGACCAAGGGGATGGGG - Intronic
1160163281 18:76491422-76491444 CTGTGCGGGCCGGGGGGCGGGGG - Intronic
1160406967 18:78652866-78652888 CTGGGGGGTTCCCGGGGCTGAGG - Intergenic
1160407007 18:78652968-78652990 CTGAGGGGCTCCCGGGGCTGAGG - Intergenic
1160407129 18:78653314-78653336 CTGGGGGGTTCCCGGGGCTGAGG - Intergenic
1160407323 18:78653849-78653871 CTGGGGGGTTCCCGGGGCTGAGG - Intergenic
1160659398 19:291255-291277 CCTTGGGGACCCGGGTGTTGGGG - Intronic
1160757460 19:765140-765162 CTGTGGGGACCCTGGGGAGGCGG + Intergenic
1161061887 19:2219404-2219426 GTTCGGGGGCCCGGGGGCTGGGG - Intronic
1161262754 19:3346657-3346679 CTGAGGGGACCCAGGGTCTCTGG + Intergenic
1161581549 19:5083486-5083508 CTGTCTGGAGCTGGGGGCTGGGG + Intronic
1161605435 19:5212289-5212311 CTGCGGGGACCGGGGGGAAGCGG + Intronic
1161718925 19:5892638-5892660 CTGTGGTCACCGCGGGGCTGGGG + Exonic
1161808771 19:6459694-6459716 CTGCGGGGTCCCGGGGGGGGAGG - Exonic
1161952122 19:7473417-7473439 TTTTGGGGAGGCGGGGGCTGAGG + Intergenic
1162158561 19:8696148-8696170 CTGGGAGGAGCTGGGGGCTGAGG + Intergenic
1162292871 19:9792450-9792472 GTGAGGGGAACCGGGGGCCGGGG - Intronic
1162352286 19:10158142-10158164 CTTGGGGGAGCCTGGGGCTGGGG - Intronic
1162363858 19:10236207-10236229 GTGTGGGGACCTGAAGGCTGGGG + Intergenic
1162367473 19:10258232-10258254 TTGTGGGGCCCCGGGGGCCATGG - Exonic
1162410625 19:10503092-10503114 CGGAGGCGACCTGGGGGCTGAGG - Intronic
1162517797 19:11159810-11159832 ATGGTGGGTCCCGGGGGCTGGGG + Intergenic
1162534746 19:11256229-11256251 CCGTGGGCACACAGGGGCTGGGG + Intronic
1162780225 19:13002797-13002819 CTGAGGGGAGCCGGGGGTGGTGG + Intronic
1162799513 19:13103020-13103042 CTGTAGGGACCCCGGGCCTCTGG + Intronic
1162990345 19:14298022-14298044 CTTTGGTCACCCCGGGGCTGAGG + Intergenic
1163115229 19:15185091-15185113 AGGTGGGGACCCTGGGGTTGGGG - Intronic
1163133110 19:15288902-15288924 CAGTGGGGACCTGGTGGCTGTGG - Intronic
1163556071 19:17993467-17993489 CTGTGGGGACACGGGGTTGGGGG - Intronic
1163558828 19:18007316-18007338 CTGTGGCGGGACGGGGGCTGAGG + Intronic
1163560190 19:18014397-18014419 GAGTGGGGAGCAGGGGGCTGGGG + Intergenic
1163579218 19:18128436-18128458 CTCTGGGGACTCAGGTGCTGGGG - Exonic
1163677778 19:18663833-18663855 CTCTGGGGTGCAGGGGGCTGTGG + Intronic
1163740580 19:19009455-19009477 CTGTGGAGACCCTGGGGATGAGG + Intronic
1164989652 19:32674892-32674914 ACCTGGGGACGCGGGGGCTGGGG + Intronic
1165106736 19:33474566-33474588 TAGTGGGGAGGCGGGGGCTGAGG + Intronic
1165699494 19:37926577-37926599 CTGCGGGGACCAGGTGGCTCAGG + Intronic
1165901971 19:39173386-39173408 CAGTGGGGGCCCTGGGGCGGGGG - Intronic
1166393340 19:42422554-42422576 GTTTGGGGTCCCTGGGGCTGAGG + Intronic
1166861948 19:45816130-45816152 CTGAGGGGGCCGGGGTGCTGGGG + Exonic
1166886431 19:45963815-45963837 CTGAGGGGGCCCGGGCGCGGTGG - Intronic
1166932308 19:46308640-46308662 CTGGGGAGGCCCGGGGGCAGCGG - Intronic
1167019188 19:46861350-46861372 CGGCGGGGCCCGGGGGGCTGGGG - Intergenic
1167050040 19:47072486-47072508 CTGAGGGGGCCCGGGCGGTGGGG + Exonic
1167076178 19:47250908-47250930 CTGTGGGGAGGCGGGGGAGGCGG - Intergenic
1167079789 19:47271123-47271145 CTGTGGAGTCTCAGGGGCTGGGG - Exonic
1167135395 19:47612608-47612630 CTGTAGGGGCTGGGGGGCTGAGG + Intronic
1167486443 19:49765878-49765900 CTCTGGGGAGCTGGGGGTTGGGG + Intergenic
1167489016 19:49781250-49781272 CTGTGGGGACAAAGGGGGTGAGG + Intronic
1167561115 19:50226673-50226695 AGCTGGGGACCAGGGGGCTGGGG + Intronic
1167676202 19:50887694-50887716 GAGTGGGGACCTGGGGTCTGGGG - Intergenic
1167909506 19:52690363-52690385 CTGTGGGGACCCTAGGTCCGAGG + Intronic
1168314116 19:55476693-55476715 CTGTGGGGACCGGGGAGGGGGGG - Exonic
1168687786 19:58358791-58358813 CTGAGAGGGCCTGGGGGCTGTGG - Intronic
925131261 2:1495776-1495798 CTGAGTGGTCCCGGGTGCTGGGG + Intronic
925131280 2:1495847-1495869 CTGTGTGGCCCCGGGTGCTGGGG + Intronic
925892568 2:8447661-8447683 CTGTGGGGACCCCTGGGCTCTGG - Intergenic
926127860 2:10282997-10283019 CTGTGGGGTCCCGGGGGACTGGG - Intergenic
926335337 2:11858573-11858595 CTGTGGAGACCCCAGGCCTGAGG - Intergenic
928373558 2:30758079-30758101 CTGTGGAACCCCTGGGGCTGGGG - Exonic
929075573 2:38076685-38076707 CTGTCGGGGCCCCGGGGCGGGGG - Intronic
930122002 2:47768126-47768148 CAGTGGGGACCCGGCCTCTGAGG + Intronic
931786575 2:65624101-65624123 CTGTAGGGAATCTGGGGCTGTGG + Intergenic
932110300 2:68993145-68993167 CTGTGGTGACCCTGAAGCTGAGG + Intergenic
932584963 2:73021968-73021990 CTGTGGAGACCAGGAGGCAGAGG - Intronic
932595711 2:73092362-73092384 CTGAGGGGACCGGGGCCCTGTGG + Intronic
933693400 2:85196934-85196956 CTGGGGAGTGCCGGGGGCTGAGG - Intronic
935280929 2:101517147-101517169 CAGTGTGGACCCTGGAGCTGGGG + Intergenic
935918077 2:107979462-107979484 CTGTGGTGGCTGGGGGGCTGGGG + Intergenic
936250868 2:110867161-110867183 CTGTGGGGATCCGGGGGATGAGG + Intronic
936531025 2:113277321-113277343 CTGCGGGGGCCCGGGCTCTGCGG - Intronic
937909076 2:127066663-127066685 CCATGGGGAACCAGGGGCTGGGG - Intronic
937913020 2:127085389-127085411 GTGTGGGGCCCTGAGGGCTGGGG - Intronic
938128849 2:128693795-128693817 CTGAGGGGACCTGAGGGGTGAGG - Intergenic
938176902 2:129142051-129142073 CTGTGTGGTGCCTGGGGCTGGGG + Intergenic
938294274 2:130167731-130167753 CAGTGTGGATCAGGGGGCTGGGG - Intronic
938462375 2:131506159-131506181 CAGTGTGGATCAGGGGGCTGGGG + Intergenic
941228565 2:162879915-162879937 CTGTGGGGAGTGGGGGGCTACGG + Intergenic
942104892 2:172624265-172624287 GTATGGGGCCCCAGGGGCTGGGG - Intergenic
942444184 2:176067328-176067350 CTGACGCGACCCGGAGGCTGAGG + Intergenic
942919767 2:181358183-181358205 CTGTGGCTGCCAGGGGGCTGAGG - Intergenic
944154170 2:196593344-196593366 CGGCGGGGAGCCGGGCGCTGCGG - Intronic
944507308 2:200425764-200425786 CTTTGGGGTCGCGGGGGATGGGG + Intronic
946386154 2:219385707-219385729 CTGTGGGGAGACGTGGGTTGTGG + Intronic
947626314 2:231621380-231621402 CCCTGGGGACCCGGATGCTGGGG - Intergenic
947716258 2:232340345-232340367 CTCTGGGGACCTCTGGGCTGGGG + Intronic
947871695 2:233442182-233442204 TTGTGGAGGCCCGGGGGCTCTGG + Intronic
948814376 2:240502429-240502451 CTGTGGAGACGTGGGAGCTGTGG - Intronic
1168801502 20:646243-646265 CTCTGGGGGGCCGGGGGCAGTGG + Intergenic
1168987046 20:2058304-2058326 CACTGGGCACCTGGGGGCTGGGG + Intergenic
1169116120 20:3067129-3067151 CTGTGGGGAACCAGGCGCGGTGG - Intergenic
1169427767 20:5509897-5509919 CTGTGGGGCCCCAAGGCCTGCGG + Intergenic
1170748721 20:19124699-19124721 CTGTGGGGGGGCGGGGGCGGGGG - Intergenic
1171342817 20:24444032-24444054 CTGTGGGGAGTCGTGAGCTGTGG - Intergenic
1172040374 20:32040544-32040566 CTGGGGGGACCCGTCAGCTGGGG + Intergenic
1172452782 20:35040078-35040100 TTGTGGGGGCGCGGGGGGTGGGG - Intronic
1172650147 20:36496936-36496958 CTCTGGGGCCTCAGGGGCTGGGG - Exonic
1174168732 20:48603495-48603517 CTGTTGGGGGCAGGGGGCTGGGG - Intergenic
1174411405 20:50339075-50339097 CTGTGAGGCCTTGGGGGCTGTGG - Intergenic
1175618336 20:60422498-60422520 CTGTGGGGAGCTGGAGGGTGGGG - Intergenic
1175897621 20:62346338-62346360 CTGGGGGGACATGAGGGCTGGGG + Intronic
1175928191 20:62481019-62481041 CTCTGGGGGCCCGGGGCATGCGG - Intergenic
1175948852 20:62571807-62571829 CTGTGGGGAGGTGGGGCCTGTGG + Intergenic
1175948872 20:62571858-62571880 CTGTGGGAAGGCGGGGTCTGTGG + Intergenic
1175948878 20:62571875-62571897 CTGTGGGAAGGCGGGGTCTGTGG + Intergenic
1175948909 20:62571960-62571982 CTGTGGGAAGGCGGGGTCTGTGG + Intergenic
1175948915 20:62571977-62571999 CTGTGGGGAGGCAGGGCCTGTGG + Intergenic
1176383384 21:6124995-6125017 GTGGGGGGTGCCGGGGGCTGGGG + Intergenic
1178251484 21:31007517-31007539 CTATTGGCACCCGGGGGCAGAGG - Intergenic
1179141544 21:38730215-38730237 CTGTGGGTGGCCAGGGGCTGGGG - Intergenic
1179459983 21:41528084-41528106 CTGTGGGGAGACGGGGTCTCTGG - Intronic
1179471649 21:41614342-41614364 CTGTGAGGACTCTGGGCCTGCGG - Intergenic
1179740084 21:43413244-43413266 GTGGGGGGTGCCGGGGGCTGGGG - Intergenic
1179896536 21:44366486-44366508 CCGTGGGGGCACGAGGGCTGGGG + Intronic
1179976714 21:44872713-44872735 CAGTGAGGGCGCGGGGGCTGGGG - Intronic
1180161511 21:46000526-46000548 GTGCGGGGACCCGGGGGCCTGGG - Intronic
1180185355 21:46136619-46136641 GTCTGGGGACCCTGGCGCTGAGG + Intronic
1180594103 22:16962478-16962500 CTGTTGGGAGCCCGGGTCTGAGG + Exonic
1180871651 22:19150138-19150160 CTCTGGCGACCGGCGGGCTGCGG + Exonic
1181140958 22:20804577-20804599 CTGCGGGGACAAGGGGGCTTAGG - Intronic
1181179134 22:21055017-21055039 CAGTGGGCACCCTGGGGCAGTGG + Intronic
1181463187 22:23097209-23097231 TTGTGGGTACCCTGGGGCTAGGG + Intronic
1181469090 22:23127091-23127113 CTGTGGGGATCTGGGGAATGTGG - Intronic
1181593067 22:23896468-23896490 CTGGGGGCACCCAGGAGCTGAGG - Intronic
1181596318 22:23917285-23917307 CAGAGGGGACCAGGAGGCTGGGG - Intergenic
1182109840 22:27715320-27715342 CTGTGGGGAGCAGGCGGGTGGGG - Intergenic
1182152997 22:28043601-28043623 CTGTGGGAACCCCTGGGCTGTGG - Intronic
1183430258 22:37761676-37761698 CTTTGGGGGCCCTGAGGCTGGGG + Intronic
1183508655 22:38222806-38222828 CTGTGGGGCCTGGGGGGGTGGGG - Intronic
1183731603 22:39621630-39621652 CAGAGGGGGCCTGGGGGCTGGGG + Intronic
1183734909 22:39639002-39639024 CTGTGTGGCCCCGGGGTTTGGGG + Intronic
1184402469 22:44282019-44282041 CTGTGGGGACCAAGAGGCGGGGG + Intronic
1184412148 22:44331634-44331656 CTGCGGGGACGCGGGGACTCCGG + Intergenic
1184645112 22:45891247-45891269 CTGTGGGGGGCCGGGGGACGTGG - Intergenic
1184717706 22:46291292-46291314 CTGTGTGGACAGGAGGGCTGAGG + Intronic
1184767147 22:46577713-46577735 CTGTAGGGAAGCAGGGGCTGGGG - Intronic
1184890170 22:47374517-47374539 CTCTGAGGAGGCGGGGGCTGAGG - Intergenic
1185131821 22:49043670-49043692 CTGTGGGCACCCAGGCGCTGGGG + Intergenic
1185301041 22:50081452-50081474 CTGTGGGGACAAGAAGGCTGAGG - Intronic
1185331742 22:50255077-50255099 CTGTGTGGACCCGTGAGTTGGGG - Intronic
949993739 3:9600666-9600688 CTGTTGGGGCCGGGGGGCGGGGG + Intergenic
950829610 3:15860202-15860224 GGGTGGGCACCTGGGGGCTGCGG + Intergenic
952312976 3:32207112-32207134 CAGTGGTGACCCAGGGGCAGGGG + Intergenic
952866987 3:37861413-37861435 GTGTGGGAGCCCGGGGGCCGAGG - Intergenic
952944809 3:38472219-38472241 CTTTGTGGAGCTGGGGGCTGTGG + Intronic
954607936 3:51928540-51928562 CAGGGGAGACCCAGGGGCTGCGG + Intergenic
954693796 3:52409950-52409972 CTGAGGGGCCCCGGGGGCGGTGG - Exonic
954806800 3:53225295-53225317 CTGTGGGGACTTGGGGGAGGTGG + Intronic
955079023 3:55640600-55640622 TTGTGGGAACACGGAGGCTGTGG + Intronic
959894784 3:111593802-111593824 CTGTGGGGAGCTGGGGCCCGTGG + Exonic
960579229 3:119260183-119260205 CTGTGGTGACTCAGTGGCTGGGG - Intergenic
961205665 3:125079462-125079484 CTGAGTGGACCTGGAGGCTGAGG - Intergenic
961220738 3:125197630-125197652 CTGAGTGGACCTGGAGGCTGAGG + Intronic
961367161 3:126407307-126407329 CTGAGGGGATCTGGGGGCAGAGG - Intronic
961454076 3:127015766-127015788 CTGAGGGGGCCTGGTGGCTGTGG + Intronic
961536157 3:127572266-127572288 CTGTGGGGACCCTGAGGATCAGG - Intergenic
961663542 3:128482902-128482924 GTGTGGGGGGCTGGGGGCTGAGG + Intronic
961664190 3:128486162-128486184 CTCTGTGTACCCAGGGGCTGGGG - Exonic
961770990 3:129249814-129249836 CTGTCCTGACCCGGAGGCTGAGG + Intronic
961786760 3:129352179-129352201 CTGTGTGGTCACGGGGGTTGGGG + Intergenic
963430551 3:145196893-145196915 CTGTGGGGAGTTGGGGGATGGGG - Intergenic
964526142 3:157616792-157616814 CTGAGGGGGCCCAGGGGCTGAGG - Intronic
966874851 3:184315834-184315856 CTGTGGGAGTCCGGGGGATGGGG - Exonic
967268922 3:187717094-187717116 CTGTCGGGAGCTGGGGGCTAGGG - Intronic
968178202 3:196569071-196569093 CTCTGGGGCCGCGGGGGCCGGGG + Exonic
968540815 4:1167439-1167461 CCGGGGGGCCCCAGGGGCTGCGG + Exonic
968545516 4:1195728-1195750 GTGTGGGCATCCTGGGGCTGGGG - Intronic
968618742 4:1594077-1594099 CTGGGGGGACCTGGGGCCCGCGG - Intergenic
968730937 4:2268885-2268907 CTGTGAGGAGCCAGGGGATGTGG + Intergenic
968813459 4:2810264-2810286 GTGAGGGGACCCTGGGGGTGGGG - Intronic
968908870 4:3466622-3466644 CTGTCCTGACGCGGGGGCTGAGG - Intronic
969224169 4:5783773-5783795 ATTTGGGAACCCAGGGGCTGGGG + Intronic
969439376 4:7208289-7208311 CTGTGGGGGCTGGAGGGCTGGGG - Intronic
969630711 4:8334277-8334299 CTGGGGGGTCCCTGGGGCTTGGG + Intergenic
969665125 4:8553005-8553027 CTGTGGGTAACCCGAGGCTGGGG + Intergenic
969728406 4:8939316-8939338 CTTTGGGGACCAGGGGGCTGAGG - Intergenic
973082540 4:46011999-46012021 TTGTATGGACCCTGGGGCTGAGG - Intergenic
976389274 4:84492951-84492973 CGAGGGGGACCCGGGCGCTGAGG + Exonic
978194641 4:105956782-105956804 CTGTGGATACCCAGGGGATGAGG - Intronic
980280915 4:130718262-130718284 CTATGGTGGCCTGGGGGCTGGGG + Intergenic
984883323 4:184429176-184429198 GGCTGGGGACCAGGGGGCTGGGG + Intronic
985025753 4:185737601-185737623 AGGTGGGGACCCGAGGGGTGGGG + Intronic
985549100 5:524300-524322 ATGTGGGGACTCGGGGCCCGGGG - Exonic
985658786 5:1145319-1145341 CTGTGGGGACACAGCTGCTGGGG + Intergenic
985745324 5:1643520-1643542 CTGGGGGCAGCCGGAGGCTGCGG + Intergenic
985758837 5:1734439-1734461 GGGTGGGGACTCGGGGGCGGGGG + Intergenic
985778434 5:1857286-1857308 CCGTGGGGACCCGGCTGCTCAGG - Intergenic
986454251 5:7899661-7899683 CTGTCGGGACCTGGAGCCTGTGG + Intronic
986665831 5:10103320-10103342 CTGTGGGGAGCCTGAGACTGAGG + Intergenic
986866555 5:11995948-11995970 CTGTGGGAAGATGGGGGCTGGGG + Intergenic
989239557 5:39188484-39188506 CAGTGGGGCTACGGGGGCTGTGG - Intronic
989665400 5:43847932-43847954 CTCTGGGGACTCGGGGGCAAGGG - Intergenic
992487429 5:77210388-77210410 CAGTGGGGCCCGGGCGGCTGCGG + Intergenic
992507100 5:77397904-77397926 GTGTGGGGAGGCGGGGGGTGGGG - Intronic
995548025 5:113252234-113252256 ATCTGTGGGCCCGGGGGCTGGGG - Intronic
997622317 5:135306846-135306868 CTGTGGGGACCCACGGATTGTGG + Intronic
997675194 5:135707519-135707541 CTGCGGGGACCCAAGGGCGGGGG - Intergenic
998266597 5:140671715-140671737 CTGTGGAGAGCAGGTGGCTGTGG - Exonic
999133640 5:149302711-149302733 ATGTGGGGCCCCAGGGGCTGGGG + Intronic
999171520 5:149599254-149599276 CTTCGGGGGCCTGGGGGCTGTGG - Intronic
999306251 5:150521419-150521441 CTGCGGGGACCCGCCGCCTGTGG + Exonic
999977094 5:156922418-156922440 CTGTGGGGCTCAGGGGTCTGAGG + Intronic
1000288193 5:159846186-159846208 CCTTGGGGACCCTGAGGCTGGGG - Intergenic
1001541589 5:172543304-172543326 TTGTGGGGACCCTGGGTTTGTGG - Intergenic
1001859481 5:175040938-175040960 CTGTGGGGTCCCTGGTGCTGAGG + Intergenic
1002078980 5:176726650-176726672 CGGTGGAGAACAGGGGGCTGGGG + Intergenic
1002189295 5:177470434-177470456 AGGTGGGGAGCCAGGGGCTGAGG - Intronic
1002195018 5:177496887-177496909 CTGCCGGGACCTGGGGGCGGGGG - Intronic
1002566791 5:180116668-180116690 CCGCTGGGACACGGGGGCTGTGG - Intronic
1003002812 6:2351705-2351727 CTGTGGAGAGCCGGGGGTTCGGG - Intergenic
1003049509 6:2766418-2766440 CTGTGGGGGCCGCCGGGCTGCGG + Exonic
1003965223 6:11246434-11246456 CTGGTGGGGCCCGGGGCCTGGGG - Intronic
1005592959 6:27348007-27348029 ATGTGGAGATGCGGGGGCTGTGG - Intergenic
1006170205 6:32087900-32087922 CCGTGGGGGCCGCGGGGCTGGGG + Intronic
1006547219 6:34790339-34790361 CTGTGAGGCCCCTGTGGCTGAGG + Intergenic
1006905262 6:37528941-37528963 GTGTGCAGACTCGGGGGCTGGGG - Intergenic
1010214715 6:73391366-73391388 CTTTTGGGTCCCGGGGGATGAGG + Intronic
1011496923 6:87945935-87945957 ATGTGTGGACCCAGGCGCTGCGG - Intergenic
1011517380 6:88167462-88167484 CTGCAGGGCCCCGGGGGCGGAGG - Intergenic
1016189208 6:141240269-141240291 CTGTGTGGCCACGGGGGCAGGGG + Intergenic
1016389562 6:143561284-143561306 CTGTCGGGAAGCGGGGGCAGGGG + Intronic
1017302529 6:152879181-152879203 CTGAAGGGACCCTGGGGGTGGGG + Intergenic
1017826730 6:158087082-158087104 CTGTGGGGACCGGAAGGCCGGGG - Intronic
1018375889 6:163212309-163212331 CTGTGAGGGCCCGGGAGCAGTGG + Intronic
1018698890 6:166411950-166411972 CTGTGTGGCCACGGGAGCTGGGG + Exonic
1018827665 6:167421772-167421794 GTGTGGGGAGCCGCAGGCTGTGG - Intergenic
1018848613 6:167572214-167572236 CTGAGGGGACCCCGGGCCTCAGG - Intergenic
1018860638 6:167708567-167708589 CTGTGGGGTGCCTGCGGCTGTGG - Intergenic
1018889376 6:167972347-167972369 TTGTGAGGACCTGGGAGCTGCGG + Intergenic
1019065505 6:169292729-169292751 CTGCAGGGTGCCGGGGGCTGGGG - Intergenic
1019164055 6:170087437-170087459 GTGGGGGGACCCGGAGGCCGTGG + Intergenic
1019164072 6:170087477-170087499 GTGGGGGGACCCGGAGGCCGTGG + Intergenic
1019322721 7:422936-422958 CTCTGGGGACACTGGGCCTGCGG - Intergenic
1019354663 7:572298-572320 CTGTGGGGATCGGGTGTCTGAGG + Intronic
1019398620 7:837227-837249 CTGGGGCGAGCCGGGGTCTGTGG + Intronic
1019419690 7:945326-945348 CTGTGGGGGCCCTGCTGCTGGGG - Intronic
1019464526 7:1180083-1180105 CTGAGGGCACCCAGGGGCTCTGG + Intergenic
1019513281 7:1429069-1429091 TTCTGGGGTCCCGGGTGCTGGGG - Intronic
1019547040 7:1583171-1583193 CTGTAGGGACCCCGTGGGTGTGG + Intergenic
1019666264 7:2253648-2253670 CTGTGCTGACTCGGTGGCTGTGG - Exonic
1019713971 7:2529974-2529996 TGGTGGGGCCCCGGGGGCAGAGG + Intergenic
1019911547 7:4103285-4103307 CTGTGGGGGGCCGGGCGCGGTGG - Intronic
1021514338 7:21466450-21466472 CTTTGAGGACCTGGGAGCTGTGG - Intronic
1021560653 7:21965830-21965852 CTGAGGGGAGGTGGGGGCTGGGG - Intergenic
1022396249 7:29989879-29989901 CGGCGGGGCCCCGGGGGCCGGGG - Intronic
1022492257 7:30830065-30830087 TTGTGGGGGCCAGGGGGTTGGGG + Intronic
1023863873 7:44229648-44229670 CTGTGGGGGTCCTGGGCCTGTGG + Intronic
1023980793 7:45068835-45068857 CGGTGGGGAGCCTGGGCCTGGGG - Intronic
1024093694 7:45968023-45968045 CTGTGAGGACCTTGGGGGTGAGG - Intergenic
1024189660 7:46993186-46993208 CAGTGGAAACCCTGGGGCTGGGG + Intergenic
1024274472 7:47666865-47666887 ATGTGGAGACCCGGGGGCCTTGG + Intergenic
1024601505 7:50985627-50985649 CTGTTGTGAGCCGGGGGCTTTGG + Intergenic
1025035902 7:55592349-55592371 CTGTGGGGAGCCTGGGAATGGGG + Intergenic
1025089603 7:56051528-56051550 CTTTGCGGACCCGGGAGCTCGGG - Exonic
1025664127 7:63573154-63573176 CTGGGAGGATCCGGGGGCGGGGG - Intergenic
1025854592 7:65266250-65266272 CTGTGTGGAGACAGGGGCTGTGG + Intergenic
1026679248 7:72452850-72452872 CTGTGGGTATCCTGGAGCTGAGG - Intergenic
1027494613 7:78871341-78871363 CTTTGGGGACTCAGGGGGTGAGG + Intronic
1027973787 7:85122081-85122103 CTGTTGGGGGCTGGGGGCTGGGG + Intronic
1028641172 7:93043627-93043649 CTGTGTGGCCGCGGGGGCTGCGG + Intergenic
1029092355 7:98058148-98058170 TTGTGGGGACTTGGGGGCTGGGG - Intergenic
1030750586 7:113227252-113227274 CTGTGGGGACTCTGCCGCTGTGG - Intergenic
1032087166 7:128890541-128890563 CCGTGGGGACTAGAGGGCTGTGG + Intronic
1032087689 7:128892438-128892460 CTGTTGGGCCCATGGGGCTGTGG + Intronic
1032294905 7:130627756-130627778 CTTTGGGGATGCGGGGGGTGGGG + Intronic
1032593343 7:133214169-133214191 CTGTGGGGGGTCGGGGGCTAGGG + Intergenic
1033268014 7:139903102-139903124 CTTTGGGGACTTGGGGGTTGGGG - Intronic
1034336822 7:150329365-150329387 CTGTGGGCACCCGGGAGACGGGG + Intronic
1034354702 7:150443273-150443295 CTGGGGAGAGCCAGGGGCTGAGG + Intergenic
1034439175 7:151077781-151077803 CTGTGGGGAGGCGGGGACTGGGG + Intronic
1034441262 7:151087073-151087095 GTGAGCGGAGCCGGGGGCTGCGG + Intronic
1034560720 7:151877703-151877725 GGGGCGGGACCCGGGGGCTGCGG - Intergenic
1034963044 7:155374251-155374273 CCTTGGGGAGCCGGAGGCTGGGG - Intergenic
1034993001 7:155559858-155559880 ATGTGGGGAACCCGGGCCTGGGG + Intergenic
1035535472 8:387575-387597 CTGTGGGGTCCCGAGGGAAGCGG + Intergenic
1036632564 8:10525706-10525728 CTGGGGGGATGAGGGGGCTGAGG - Exonic
1036645437 8:10609217-10609239 CTGAGCGGACCCTGGGCCTGGGG - Exonic
1037841468 8:22248277-22248299 ATGTGGGTACCAGGAGGCTGGGG + Exonic
1037889147 8:22614128-22614150 CTGAGGGGACCAGGAGGCTGCGG - Exonic
1037986656 8:23294582-23294604 CTGTGGGGCTCTGGGGGATGAGG + Intronic
1038253242 8:25926025-25926047 CTATTGGGACTTGGGGGCTGAGG - Intronic
1039270059 8:35870167-35870189 CTTTGGGGACTCGGGGGTCGGGG - Intergenic
1040539718 8:48341700-48341722 CTGTGGGTACCAGAGGGTTGAGG - Intergenic
1040573066 8:48626619-48626641 CTGAGGGGTCACGGGGGCTTTGG + Intergenic
1040981607 8:53251150-53251172 CGCTGGGGACCCGGAGCCTGCGG + Intronic
1041765993 8:61418908-61418930 ATGTGAGGACCCAGGGGCTGGGG + Intronic
1042649555 8:71024342-71024364 CAGTGTGGACCAGGGTGCTGGGG + Intergenic
1047824284 8:128556652-128556674 GGGTGGGGATCCGGGGGCAGTGG + Intergenic
1048929149 8:139297154-139297176 CTGGGGGCACCCCGGTGCTGAGG + Intergenic
1049347084 8:142144849-142144871 CACTGGGGGCCCCGGGGCTGGGG + Intergenic
1049361229 8:142213281-142213303 CTGTGCGGACTCCGGGGCTGGGG + Intronic
1049398754 8:142415391-142415413 CTGTGGGGACCCGGTGGACAGGG + Intergenic
1049501818 8:142971269-142971291 CTGTGGGGACCTGGGGGGGTTGG - Intergenic
1049644845 8:143731640-143731662 CTGTGGGCACCAAGGGGCTGTGG - Intronic
1049745158 8:144260194-144260216 CTGTGAGGAGCTGGGGGCCGTGG - Exonic
1049773649 8:144395024-144395046 CTGTGGGGGCCAGGGGCCTCAGG + Intronic
1049782262 8:144434433-144434455 CTGTGAGGCCCTGGGGGCCGGGG + Intronic
1051105020 9:13569530-13569552 CTGGGGGGCCGAGGGGGCTGGGG - Intergenic
1052997364 9:34558234-34558256 CCGTGGGGAGCAGGGGGCTGCGG + Intronic
1054450454 9:65401097-65401119 CTGGAGGGCCCCGGGGGCTGAGG - Intergenic
1054798518 9:69324995-69325017 CGGCGGGGACCCTGAGGCTGTGG + Intronic
1055723480 9:79201443-79201465 CAGTGAGGGCCTGGGGGCTGTGG + Intergenic
1056901276 9:90602047-90602069 CTTTGGGGACTCGGGGGATAGGG - Intergenic
1057957070 9:99418698-99418720 CAGTGGGGACCTGGTGGCAGGGG - Intergenic
1058995130 9:110292185-110292207 GCGTGGGCAGCCGGGGGCTGTGG - Intergenic
1059219025 9:112594417-112594439 CTAGGGGGTCCCAGGGGCTGAGG - Intronic
1060405134 9:123369194-123369216 GTGTGGGGGCCCTGGGGCAGAGG + Intronic
1061192121 9:129088111-129088133 ATGTGGGGACGTGGGAGCTGGGG + Intronic
1061247481 9:129408157-129408179 CTGTGGGGAGCCCGGAGCAGAGG - Intergenic
1061671150 9:132188836-132188858 CTGAGGAGGGCCGGGGGCTGGGG + Intronic
1061986285 9:134132052-134132074 CTGTGGAGATCCTGGGGATGGGG + Intergenic
1062022599 9:134326523-134326545 CGGCGGGGAGCCGGCGGCTGCGG - Intronic
1062044195 9:134417627-134417649 CCGAGGGGACACGGCGGCTGAGG - Intronic
1062247356 9:135576063-135576085 CTGTGGGGGCCCAGGTGCCGGGG - Intergenic
1062250922 9:135593007-135593029 GGCTGGGGACTCGGGGGCTGGGG + Intergenic
1062250929 9:135593022-135593044 GGCTGGGGACTCGGGGGCTGGGG + Intergenic
1062405780 9:136395570-136395592 GTGTGGGCACCGGGGGGCCGAGG + Intronic
1062461262 9:136663477-136663499 CTGCGGTGTCCCGAGGGCTGAGG + Intronic
1062494581 9:136825668-136825690 CTGGTGGGAGCCGGTGGCTGCGG + Intronic
1062523722 9:136969979-136970001 CTCTGGGGGCCCTGGCGCTGTGG - Exonic
1062532816 9:137009250-137009272 CTGTGGGGCCAGGGGGGCTGGGG - Intronic
1062586356 9:137251634-137251656 CTGGGAGCAGCCGGGGGCTGAGG + Intronic
1062599190 9:137312388-137312410 CTGTTGGCACCCAGTGGCTGAGG - Intronic
1062616554 9:137399241-137399263 CTGGGGAGACCCCGGGGCCGTGG + Intronic
1062736808 9:138141974-138141996 CTGTGGGGACCAGGGGACCAGGG - Intergenic
1187098111 X:16167853-16167875 AGGTGGGTACCCGGGGGCGGGGG - Intronic
1187648298 X:21374040-21374062 CTGAGGGGACCCGGCGGTGGCGG - Intergenic
1190114822 X:47619613-47619635 CTGTGGGCACCGGGCGGCGGTGG + Exonic
1190261709 X:48801851-48801873 CTGTGGGGACGCGAGCGCTCAGG - Intronic
1190554274 X:51618132-51618154 CGGTGGCGACCCGGGGGAGGAGG - Intergenic
1190560569 X:51682090-51682112 CGGTGGCGACCCGGGGGAGGAGG - Intergenic
1190563722 X:51711231-51711253 CGGTGGCGACCCGGGGGAGGAGG + Intergenic
1194012380 X:88578506-88578528 CTTTGGGGACCCGGGGGAAAGGG + Intergenic
1194499561 X:94663738-94663760 CTTTGGGGACCTCGGGGCGGGGG - Intergenic
1195346456 X:103954819-103954841 CTGTGGGGAGCAGGGAGCAGGGG - Intronic
1195750203 X:108156823-108156845 CTCTATGGACCCGAGGGCTGGGG + Exonic
1197120570 X:122886115-122886137 CTTTGGGGACTCGGGGGAAGTGG + Intergenic
1199760180 X:150898872-150898894 CTGCGGGCACCCGGTGGGTGGGG + Intergenic
1200138579 X:153886368-153886390 CTGGCGGGACCCGTCGGCTGGGG - Intronic
1201010766 Y:9547080-9547102 CTGCGCAGGCCCGGGGGCTGTGG - Intergenic