ID: 1146061027

View in Genome Browser
Species Human (GRCh38)
Location 17:29607487-29607509
Sequence AAGTAACTCTGGAAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146061027 Original CRISPR AAGTAACTCTGGAAGAGGGA GGG (reversed) Intronic
900810814 1:4800211-4800233 AAGTATCATTGGGAGAGGGAGGG + Intergenic
901809502 1:11759396-11759418 AAGCAATTCTTGAAGAAGGAGGG - Intergenic
902823702 1:18958192-18958214 AAGGAACTGTGGTTGAGGGAAGG - Intergenic
902878346 1:19354428-19354450 AAGTAACTACAGAAGGGGGAGGG - Intronic
905452323 1:38064660-38064682 AAGGACCTCTGGAACTGGGATGG - Intergenic
907230435 1:52993382-52993404 AGGTAACACAGGAAGAAGGACGG - Intronic
907339104 1:53721301-53721323 AAATAAATGTGGAGGAGGGAAGG - Intronic
908253343 1:62282610-62282632 AAGTAACTGGAGAAGAGGGCTGG + Intronic
909207759 1:72781121-72781143 AAGGAAATCTGGAAGTGGCATGG - Intergenic
909273319 1:73652252-73652274 AAGTAACTCAAGAATTGGGAAGG + Intergenic
909526302 1:76626610-76626632 AGGTATTTCAGGAAGAGGGAAGG - Intronic
911350597 1:96749235-96749257 AAGTAACTTTGGAAGACGATAGG - Intronic
911484986 1:98493995-98494017 AATTAACTGGGGAAGAAGGAAGG - Intergenic
911680934 1:100714373-100714395 AAGTAAATTTAGAAGAGGGAAGG + Intergenic
911778020 1:101839871-101839893 AAGTAACTCTGTAGTAGAGAAGG - Intronic
911934931 1:103958682-103958704 AAGTATCTCATGCAGAGGGAAGG - Intergenic
912875307 1:113351754-113351776 AAGTATCTTTGGAATAGGAAGGG - Intergenic
913147513 1:116006925-116006947 GAATAACACAGGAAGAGGGAGGG - Intronic
914241316 1:145854873-145854895 AGGTAACCCTGGAGAAGGGAGGG + Exonic
915198307 1:154207114-154207136 AAATAAACCTGGAACAGGGAAGG + Exonic
916306768 1:163344407-163344429 AAGTACAGGTGGAAGAGGGAAGG + Intronic
916646414 1:166790121-166790143 CAGTCACTATGGAAGATGGAAGG + Intergenic
917105946 1:171492252-171492274 AAATAACTATTAAAGAGGGATGG + Intronic
917459634 1:175218916-175218938 AACGTTCTCTGGAAGAGGGAGGG + Intergenic
918809752 1:189100891-189100913 AAGGAAGAATGGAAGAGGGAAGG + Intergenic
919061378 1:192638239-192638261 AAGTAATTTTGGAAGATGGAAGG - Intronic
920549437 1:206846204-206846226 AATTTGCTCTGGAAGATGGAAGG - Intergenic
920966173 1:210702877-210702899 AAGTAATTTTGAAAGACGGAAGG - Intronic
921326260 1:213988514-213988536 AAGTGATTCTGGAAAAGGGGAGG - Intronic
921681292 1:218035221-218035243 TAGTATCTCTGCAATAGGGAGGG - Intergenic
922653601 1:227361782-227361804 AAGTAATTCTGGAAGAGTTGAGG + Intergenic
924137016 1:240978576-240978598 AACTTAATCTGGAAGAGAGAAGG + Intronic
1062952555 10:1515682-1515704 AAGTGACTCTGGCTGAGGGGTGG - Intronic
1063226399 10:4019050-4019072 ATGTATATTTGGAAGAGGGAGGG + Intergenic
1063955603 10:11262638-11262660 AAGTAACTCAGCATCAGGGATGG + Intronic
1066463020 10:35628816-35628838 AGGTAACTATGGCAGAGAGAGGG + Intergenic
1066566917 10:36730647-36730669 GAGTGACTCTGGAAGACAGAAGG - Intergenic
1068744636 10:60516397-60516419 CAGTACCCCTGGAAGAGAGAGGG + Intronic
1069801732 10:71085912-71085934 AGGTGACTCTGGAAGCGGGTGGG + Intergenic
1071063991 10:81609317-81609339 AAGTAATTTTGCAAGAGTGAGGG + Intergenic
1071286846 10:84156723-84156745 AAGCAATTCAGGAAGATGGACGG + Intergenic
1071712837 10:88066554-88066576 AAGAAACTCTGGAAAGGGGAAGG - Intergenic
1072457057 10:95585729-95585751 AAGTCACTCTAGAGCAGGGATGG + Intergenic
1072764838 10:98086953-98086975 GAATGACTCAGGAAGAGGGATGG + Intergenic
1073627483 10:105114356-105114378 CAGAAAATTTGGAAGAGGGACGG + Intronic
1073798330 10:107013211-107013233 AAGTATGTTTGGAAGAGGTAGGG + Intronic
1074120070 10:110487535-110487557 GATTTACTCTGGCAGAGGGAGGG - Intergenic
1074942444 10:118248491-118248513 AAGTCACACTGGAGGAGGGTGGG - Intergenic
1076129804 10:128005867-128005889 AATGGACTCTGGAGGAGGGAAGG - Intronic
1076256073 10:129025758-129025780 AAGTAGGGCTTGAAGAGGGAGGG - Intergenic
1077695896 11:4392911-4392933 AAGTATCTCTGGCACATGGAAGG - Intronic
1079770238 11:24449635-24449657 CAGTAAATCTGGATGTGGGATGG + Intergenic
1079881231 11:25929719-25929741 ACAAAACTCTGGAAGAGAGAAGG - Intergenic
1080778731 11:35410774-35410796 AAGGAGCTCTGGAACAGGGATGG - Intronic
1082081304 11:48014339-48014361 TGGTAACTCTTTAAGAGGGAAGG + Intronic
1082108714 11:48248410-48248432 AAGAAACTCTGAAAGAGGTGGGG - Intergenic
1083175432 11:60946886-60946908 AAGTGTCTCTGTAGGAGGGAGGG - Intronic
1083740735 11:64710358-64710380 GAGTAACTGTGTGAGAGGGATGG - Intronic
1083931709 11:65849905-65849927 AGGCAGCTCTGGAAGCGGGAAGG - Exonic
1084538357 11:69771940-69771962 AAGCAACCGTGGAAGAGGCAGGG - Exonic
1085192041 11:74635078-74635100 AAGCAATTCTGGAAAAGGGCTGG + Intronic
1085377733 11:76082055-76082077 AACTACCTCTGGAAGTGAGAAGG + Intronic
1087432515 11:98071408-98071430 AAGTTGCTCTGGGTGAGGGAGGG - Intergenic
1087562187 11:99803695-99803717 AAGAAACCCAGGAAAAGGGAGGG - Intronic
1089336157 11:117725347-117725369 GAGTCACTCTGGATAAGGGATGG - Intronic
1090033568 11:123228803-123228825 AACTAACTCAGGGAGAGAGAGGG + Intergenic
1090521648 11:127486267-127486289 AAGTCACTGGGGAAGAGGGTAGG + Intergenic
1091785879 12:3243183-3243205 CAGTAACTCGGGTACAGGGAAGG - Intronic
1091919848 12:4295378-4295400 AGGTAAGTCTAGAAGAGGGTGGG + Intronic
1093090008 12:14910549-14910571 AAGTAAGACTGGAAGTGGGATGG - Intergenic
1095498985 12:42815900-42815922 AAGTAACCCTTGAGTAGGGAAGG + Intergenic
1095567751 12:43646409-43646431 AGGAAACTCTGGCTGAGGGAGGG - Intergenic
1097220408 12:57446891-57446913 AAGAAAATATGGAAGAAGGAGGG + Intronic
1101476329 12:105052033-105052055 AAGTAACTCTGGTAGAGACAGGG - Intronic
1101575114 12:105990168-105990190 AATTAAATGTGGTAGAGGGAAGG - Intergenic
1102168496 12:110824556-110824578 AAGAAACAGAGGAAGAGGGAAGG + Intergenic
1103115304 12:118324076-118324098 ATATAAATCTGGAAGATGGAGGG + Intronic
1103292749 12:119860446-119860468 AAGAAACTTGGAAAGAGGGAAGG - Intronic
1103890007 12:124231664-124231686 AAGGAACCCTGGAAGACGGGAGG + Intronic
1106380316 13:29230685-29230707 AGGTAACTTTGGAAGAGTTAAGG + Intronic
1109159414 13:58953841-58953863 AAGGAACTGGGGAAGAGGAAGGG - Intergenic
1109602002 13:64643519-64643541 TGGGAAATCTGGAAGAGGGAAGG - Intergenic
1111958802 13:94786617-94786639 AAGTAAAAATGGAAGAGGAAGGG - Intergenic
1112310402 13:98313080-98313102 AAGTCACTCTGGAATCGGGTGGG + Intronic
1112653499 13:101423849-101423871 AAGTATCTCTGGAGTAGGAAAGG + Intergenic
1113109733 13:106810234-106810256 GAGTTAATCTGGAAGAGGGTAGG - Intergenic
1114345689 14:21792292-21792314 ATGTCTCCCTGGAAGAGGGAGGG + Intergenic
1114802265 14:25790511-25790533 AAGTTTTTCTGGAAGAGGGCTGG + Intergenic
1115451435 14:33552200-33552222 AAGAAATGCTGGAAGAGGCAAGG + Intronic
1115849724 14:37581368-37581390 AAGAAACTCAGGAAGTGGAAGGG + Intergenic
1115946790 14:38670825-38670847 AAGTTTCTCTGCCAGAGGGAAGG + Intergenic
1116306292 14:43261819-43261841 CAGTATCTCTGGAAGAGAAAAGG + Intergenic
1116656671 14:47662428-47662450 AGCTCTCTCTGGAAGAGGGAAGG + Intronic
1117694993 14:58352094-58352116 AAATAACTATGGAAGAGAGCTGG - Intronic
1118930482 14:70235632-70235654 AAAGAACTCTGAAAGACGGAAGG + Intergenic
1118954378 14:70466539-70466561 AAAGAACTCTGAAAGATGGAAGG - Intergenic
1121902703 14:97708495-97708517 GAGAAAGTCTGGAAGAGAGAAGG + Intergenic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1124424829 15:29555131-29555153 AAGGAACCGGGGAAGAGGGAAGG + Intronic
1124468218 15:29959529-29959551 CAGGAACTCTGGCAGAGAGATGG + Intronic
1125059099 15:35397646-35397668 AGGTACCTCTGGAAGTGAGAGGG + Intronic
1125876242 15:43148533-43148555 AAATAACTCTGCAATAGGTAGGG - Intronic
1126138530 15:45416392-45416414 AAGAGACTCAGAAAGAGGGAGGG - Intronic
1126507201 15:49419093-49419115 AAATAATTCTGGAAGTAGGAGGG - Intronic
1127242742 15:57136306-57136328 AAAAAACACTGGAAGTGGGAAGG + Intronic
1127501595 15:59558967-59558989 AAGTAACTCTGTAGGAAAGAAGG - Intergenic
1127698648 15:61475570-61475592 AAGTACCTGTGGGTGAGGGAGGG + Intergenic
1130087159 15:80787343-80787365 GAGGAACTCTAGCAGAGGGAAGG + Intronic
1131338030 15:91569123-91569145 AAGTAACTCTTGAAGAAATAAGG - Intergenic
1131813305 15:96196593-96196615 AAGAAGTTCTGGAAGAGGGGAGG + Intergenic
1132384302 15:101389300-101389322 ACGAAGCTCTGGGAGAGGGATGG + Intronic
1133226591 16:4343682-4343704 CAGAAACTCAGGAAGAGTGATGG - Intronic
1133790292 16:9004450-9004472 CAGTGACTCTGGAAGTGGGAGGG - Intergenic
1134684178 16:16147162-16147184 AAGTATCTGTGGATGATGGATGG + Intergenic
1134877990 16:17719282-17719304 AAATAAGTCAGGAAGAAGGATGG + Intergenic
1134896797 16:17895378-17895400 AAGTCACTCTGGACCAGGGGTGG + Intergenic
1136043776 16:27600167-27600189 TAGTAAATCTGGAAGAAGGTAGG + Intronic
1137337589 16:47565661-47565683 AAGAAACTCAGGAACAGGGATGG - Intronic
1138395826 16:56703894-56703916 AAGTAAAGCTGGAAGAGGAGTGG - Intronic
1139321305 16:66116700-66116722 GAGTAACTCTGGATGAGGGCGGG - Intergenic
1142977769 17:3655905-3655927 AAGTAGCTCTTCAAGAGGGCAGG + Intronic
1144763777 17:17722198-17722220 CAGTAACTCCGGTAGATGGATGG + Intronic
1145117543 17:20225359-20225381 AAGTAAATCTGAAAGAGGCTAGG - Intronic
1145802574 17:27698143-27698165 ACGTAAGTCTGGAAAATGGATGG - Intergenic
1146061027 17:29607487-29607509 AAGTAACTCTGGAAGAGGGAGGG - Intronic
1146528354 17:33585964-33585986 AAGTAACTAGGGAAGAAGGATGG + Intronic
1146650373 17:34602662-34602684 GAGTCAATCTGGCAGAGGGAGGG + Intronic
1146709131 17:35025736-35025758 CACTGCCTCTGGAAGAGGGAGGG + Intronic
1149560813 17:57606765-57606787 AATTAATTCTGGAAGTGGTAAGG + Intronic
1149582070 17:57757709-57757731 ACTCCACTCTGGAAGAGGGACGG - Intergenic
1151783412 17:76262793-76262815 AGGTCACTCAGGAAGAAGGAAGG - Intergenic
1151910885 17:77082490-77082512 AACTTACTTTAGAAGAGGGAGGG + Intergenic
1152145103 17:78563738-78563760 AACTAACTCCGGAACAGGCAGGG + Intronic
1153351362 18:4084024-4084046 AAGTAGCTCCAGAAGATGGATGG + Intronic
1153394285 18:4600500-4600522 AAGTAACTTTGGGAGATGGTGGG + Intergenic
1155014667 18:21821507-21821529 AGGTAGCTCTGGAAGAAAGACGG - Intronic
1155049738 18:22136181-22136203 TTGTAAGTCTGAAAGAGGGAAGG + Intergenic
1155108461 18:22690038-22690060 TTGTAACTCTGGGGGAGGGAGGG - Intergenic
1155400786 18:25436860-25436882 AAATATCTCTGTGAGAGGGAAGG + Intergenic
1155483615 18:26316790-26316812 AAGGAACACAGGGAGAGGGAGGG - Intronic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157557708 18:48623401-48623423 TACCGACTCTGGAAGAGGGACGG + Intronic
1157897918 18:51486132-51486154 ATGGAACTCTAGAGGAGGGATGG + Intergenic
1159845583 18:73455668-73455690 AAGTAACTTTGGAAGTGAGTGGG + Intergenic
1161079902 19:2305553-2305575 AGGTAACCTTGCAAGAGGGAGGG - Intronic
1161658179 19:5528921-5528943 AAGTAAGCCAGGAAGGGGGACGG - Intergenic
1162329457 19:10018674-10018696 AAGTAATGCTAGAAGAGTGAGGG + Intronic
1162731859 19:12722963-12722985 AAGTACCTCTGGATGGGGGAAGG - Intronic
1163718910 19:18888861-18888883 AAGAAATTCTGGAATAGGGGAGG - Intronic
1164839589 19:31382466-31382488 CAGCAACTCTGGCAGAGGAAGGG + Intergenic
1165106605 19:33473594-33473616 AAGTACCTCTGGAAGCGTCAGGG - Intronic
1167470281 19:49671925-49671947 AAGTAAAGCAGGAAGGGGGAAGG - Intronic
926579874 2:14623304-14623326 TATTAACTCTGGAAGAGATAAGG - Intergenic
927973765 2:27322613-27322635 AAGTCACATTGGAAGTGGGAAGG - Intronic
928208710 2:29307078-29307100 AATTACCTCTGGAGGAGGAATGG - Intronic
931425412 2:62166464-62166486 AAGTAACTTTGGAAGTGAAAGGG + Intergenic
932036857 2:68253926-68253948 AAGTAGCTCCTGAAGGGGGAAGG - Intronic
932256272 2:70289867-70289889 AAGTAATTTGGGAAGAGGAAAGG + Intronic
932627811 2:73312856-73312878 AAGTCACCCTGGGTGAGGGAAGG - Intergenic
932915429 2:75853280-75853302 AAGTAATTGGGGAAGAGGGTTGG - Intergenic
933881904 2:86678081-86678103 AAATAACTCTGGCAGTGGGAAGG + Intronic
935887236 2:107635549-107635571 CTGTGACTCTGGCAGAGGGAGGG - Intergenic
937077348 2:119116903-119116925 AGGTCACTCTGGGAGAAGGAGGG + Intergenic
938297714 2:130188787-130188809 AGGTACCTCTGGAAGAGCGGGGG + Intronic
938459056 2:131485879-131485901 AGGTACCTCTGGAAGAGCGGGGG - Intronic
939895589 2:147787210-147787232 AGGTAACACCGGAAGTGGGAGGG + Intergenic
940424310 2:153513524-153513546 AACTAACTGAGGAAGAGGGTAGG - Intergenic
940650546 2:156436306-156436328 GAGGAAGTCGGGAAGAGGGAAGG + Intronic
940692794 2:156940409-156940431 AAATAAGTCAGGAAGAGGAATGG + Intergenic
941036967 2:160579461-160579483 AAATAACCATTGAAGAGGGATGG + Intergenic
941470871 2:165885315-165885337 AAATAACTCTGGAATAGAGAAGG + Intronic
941757610 2:169204611-169204633 AAGTCACTAAGGAAGTGGGATGG - Intronic
942296864 2:174526322-174526344 AGGAAACTTTGGAAGGGGGAAGG + Intergenic
942604327 2:177674421-177674443 AAGGAAAACTGGAAGAGGCAAGG - Intronic
944066884 2:195628721-195628743 AAGTTAGTCTGGAAGAGATAGGG + Intronic
944914554 2:204344744-204344766 AAGTAACTCTGGAAATGAGTGGG + Intergenic
947229462 2:227870804-227870826 ATGGATCTCTGGAAGAGGTAAGG + Intergenic
947384683 2:229579186-229579208 AGCTAACTCTGCCAGAGGGAGGG - Intronic
1169529944 20:6474459-6474481 AAGTAGCCCTGGCAGAGGCAGGG + Intergenic
1170615662 20:17947756-17947778 AAAATACTCTGGGAGAGGGAAGG - Intronic
1170744364 20:19085752-19085774 AAGTACCTCTGGGAAAAGGATGG - Intergenic
1171248444 20:23631931-23631953 AAGTAACTCTTGCAGATGAAAGG + Intronic
1171409782 20:24938353-24938375 TAGTGTGTCTGGAAGAGGGAAGG + Intergenic
1172983597 20:38964095-38964117 ATGGAAGTATGGAAGAGGGAGGG + Intronic
1173475996 20:43360155-43360177 GAGTAGGTCTGGGAGAGGGAAGG + Intergenic
1174286132 20:49474888-49474910 AGAAAACTCTGGAAGAGGGGAGG + Intronic
1175515946 20:59569901-59569923 AAGCAACTCTGGAAGTTGGGGGG - Intergenic
1181760438 22:25054735-25054757 AAGTCTCCCTGGAGGAGGGAGGG + Intronic
1182042744 22:27251027-27251049 ACGTGACTCTGGCAGGGGGATGG - Intergenic
1184003723 22:41693911-41693933 AAGTAAGTTTGGAAGAGAGGTGG - Exonic
1184073803 22:42163418-42163440 AAGTAACTCTTGAAAAGTTAGGG - Intronic
949607666 3:5672172-5672194 AAATAACTGTGGAAGTGGTATGG + Intergenic
950025902 3:9819762-9819784 GAGTCTCTCTGGAAGAGGCAGGG - Intronic
951022118 3:17792413-17792435 AAGTAGCACAGGAAGAGAGAGGG - Intronic
951354867 3:21652970-21652992 GAGTGACACTGGAAGAGGTAAGG - Intronic
953376262 3:42430963-42430985 ACGTAACTCTGGAACTGGGACGG + Intergenic
953743082 3:45553659-45553681 CAGCAACTCTGCAGGAGGGAAGG + Intergenic
954002682 3:47570240-47570262 AAGATAATCTGGAAGAGGGAAGG - Intronic
954441493 3:50524711-50524733 AAGAAACTCAGGACGAGGCAGGG + Intergenic
954583943 3:51718496-51718518 AAGTTACTCTGGGATGGGGAGGG + Intronic
956872468 3:73431376-73431398 AATTATCTCTGGATGAGGAAAGG + Intronic
959252963 3:103971985-103972007 AAATAAATCTAGATGAGGGATGG - Intergenic
959649490 3:108737819-108737841 AAGTATCACTGGAAAAGGGAAGG + Intergenic
959698358 3:109273949-109273971 AAGTAAGTAAGGAAGAAGGAAGG + Intergenic
960039737 3:113138766-113138788 AAGTAACTATGGAAGATGATGGG - Intergenic
961033693 3:123627997-123628019 CAGTAACTCTGGTACAAGGATGG - Intronic
962135395 3:132726301-132726323 AAGGAACTCTGCAAAAGGAAGGG + Intergenic
963002337 3:140694105-140694127 AACTAAGTCTGGAACAGGGTAGG + Intronic
963005650 3:140724191-140724213 AGGTCACTGTGGGAGAGGGAAGG - Intergenic
963051273 3:141146093-141146115 AGGCAGCTCTGGAAGAGGGTGGG - Intronic
963208059 3:142656765-142656787 AAGTAACATAGGAAAAGGGAAGG + Intronic
963279418 3:143367613-143367635 AAATCACCCTGGAACAGGGAAGG + Intronic
964471962 3:157065654-157065676 GAGCATCTGTGGAAGAGGGATGG - Intergenic
964786184 3:160399229-160399251 AAGTATCGCGGGAAGAGGAAGGG - Exonic
965237013 3:166137068-166137090 AAGAGACACTGGAAGAGGGTAGG - Intergenic
965386285 3:168050081-168050103 AAGGAACCCTGGTAGAGGAAGGG - Intronic
966386291 3:179402756-179402778 AGGTATCTCTGGAACAGGTAGGG + Intronic
966738525 3:183210616-183210638 AAGTAATTCTAGAAGAGGCTAGG + Intronic
966752238 3:183333341-183333363 AAATTACTCTGAAAGAGGGCTGG - Intronic
966855162 3:184188856-184188878 AAGGAAATCTGAAGGAGGGAGGG - Intronic
967174567 3:186851605-186851627 AAGGAAGAGTGGAAGAGGGAAGG - Intronic
967233074 3:187359252-187359274 AGGTGAAGCTGGAAGAGGGAAGG - Intergenic
968524874 4:1051352-1051374 AAGGAACTCTGCCAGAAGGAAGG - Intergenic
970331135 4:14985532-14985554 AAGTAACTTTGTAAGATGGGGGG - Intergenic
970334098 4:15015440-15015462 AAGTAACACTGAATGACGGAAGG - Intronic
970485467 4:16520683-16520705 AGATCACTCTGGAAGAAGGATGG - Intronic
971697239 4:29922038-29922060 AAGTGACTTTGAAAGATGGAGGG + Intergenic
971982944 4:33778322-33778344 ACGAAACTCTAGAAGAGGAAAGG + Intergenic
973090334 4:46127742-46127764 AAGTAGATATTGAAGAGGGAAGG - Intergenic
974176013 4:58325635-58325657 AAGCATCTCTGGAATAGGAAGGG - Intergenic
974235245 4:59172691-59172713 AAGTAACTGTGCAAGAGAGAGGG - Intergenic
974455990 4:62130045-62130067 AAATAACTCTAGAAGAGCTAAGG + Intergenic
975084559 4:70322183-70322205 CAGCAACCATGGAAGAGGGAAGG + Intergenic
977121113 4:93103205-93103227 AGGGAGCTCTGGAAGTGGGATGG - Intronic
978410767 4:108423162-108423184 AAGTAACTTTGGAAAATGGTGGG + Intergenic
979099900 4:116600110-116600132 AAGTGAGTCTGGAGCAGGGAGGG - Intergenic
982068175 4:151672868-151672890 GAGGAACTGTGGAAGAGGGAAGG - Exonic
985356263 4:189122785-189122807 AAGTAACTCAGGAATGGGAAAGG + Intergenic
986646085 5:9917318-9917340 TGATAACTCTGGAAGAGGGGTGG - Intergenic
988029557 5:25745470-25745492 AAGTATCTCTGGAAGAGGTGGGG + Intergenic
988879037 5:35480306-35480328 TAGAAAATCTGGAGGAGGGATGG + Intergenic
990842604 5:60100520-60100542 AAGGAAGTATGGATGAGGGAAGG - Intronic
990988204 5:61660415-61660437 AAGAAACACTGGACGAGGAAGGG + Intronic
991627533 5:68619533-68619555 AAATAACTTAGGAAGAGTGAAGG - Intergenic
992369253 5:76126122-76126144 AAGTTACACTGTAATAGGGAAGG + Intronic
993008968 5:82458537-82458559 AAGCAACCCAGGTAGAGGGAGGG + Intergenic
993230019 5:85223250-85223272 AAATAACTCATCAAGAGGGAAGG - Intergenic
993734167 5:91456477-91456499 AAGTAATTCTGGAGGAGTTAAGG - Intergenic
996052183 5:118947384-118947406 AAGGAGAGCTGGAAGAGGGATGG + Intronic
997058024 5:130467670-130467692 AGGTCACTCTGGCACAGGGATGG - Intergenic
998701089 5:144700804-144700826 AGGTAACTCAGGAGGAGGGGAGG + Intergenic
999545175 5:152621255-152621277 AAGTAAATAGGGAAAAGGGATGG - Intergenic
1000233335 5:159335495-159335517 AAGTACACTTGGAAGAGGGAGGG - Intergenic
1000557709 5:162747173-162747195 AAGTATCTCTTGAAGATGAATGG - Intergenic
1001295473 5:170495897-170495919 AAGAAACCCAGGAAGAGGGAAGG - Intronic
1001310981 5:170610629-170610651 AAGAAACTGAGGCAGAGGGAGGG - Intronic
1002573977 5:180161293-180161315 AAGACACTCTGGAAGCGGGGCGG - Intronic
1002857128 6:1047973-1047995 AAGTGACAGTGGCAGAGGGAGGG - Intergenic
1003327249 6:5101196-5101218 AAATAGGGCTGGAAGAGGGAGGG - Intergenic
1003362893 6:5445693-5445715 AAGTAGCTCTGTTTGAGGGAGGG + Intronic
1003868638 6:10384701-10384723 AAGTAAATAGGGAAGGGGGAAGG + Intergenic
1006251691 6:32792587-32792609 AAGTAACTGTGTAAGACAGAAGG - Intergenic
1006930307 6:37683793-37683815 AGGAAACTCTGGTAGAGGAATGG - Intronic
1007245431 6:40458608-40458630 AAGCAACCCTGGAGGAGGGATGG - Intronic
1007800119 6:44385104-44385126 CAGTGACTCTGCAAGAGGGGAGG + Intergenic
1008604486 6:53127204-53127226 AAGTCAGTGAGGAAGAGGGAAGG + Exonic
1009291098 6:61883549-61883571 AAATAACACTAGAAGAAGGATGG + Intronic
1009458280 6:63882447-63882469 AACTAACTCTGGTCGAGGCATGG - Intronic
1010924393 6:81726015-81726037 AAGTAAATCTGCAAGAAGGATGG + Intronic
1010964689 6:82190976-82190998 TAGAAACACTGGAAGTGGGAAGG + Intronic
1011688179 6:89840862-89840884 GAGGAACACTGGAAGAGGAAGGG - Intronic
1013006881 6:106081987-106082009 AAGCCATTCTGGAAGAGGGGAGG - Intergenic
1013020575 6:106212132-106212154 AATTAAATCTAGAAAAGGGATGG + Intronic
1014056433 6:117021143-117021165 AAATAACACTGGAAGCAGGAAGG + Intergenic
1014189742 6:118481087-118481109 AAGTAAATCTGGAAGATACATGG + Intronic
1015443651 6:133277709-133277731 AAGAAAAGCTGGGAGAGGGAAGG - Intronic
1015534737 6:134256277-134256299 AAGTATCTCTGAAAAAGAGAAGG - Intronic
1017850651 6:158302674-158302696 AAGTTACTGTAGAAGAGGGCTGG - Intronic
1017869657 6:158476220-158476242 AACTTACTCTGGGAGAGGGCAGG - Intronic
1018334455 6:162771362-162771384 ATATAACCCTGGAAGAGGAATGG - Intronic
1019213859 6:170427719-170427741 TAGTAACTCTGGAAGAAAGTTGG + Intergenic
1019770452 7:2880964-2880986 AAGCATCTCTGAAAGAGGGTGGG + Intergenic
1021704946 7:23357575-23357597 CAACATCTCTGGAAGAGGGAAGG + Intronic
1022590151 7:31653870-31653892 AAGTAACAACAGAAGAGGGAAGG + Intronic
1023295535 7:38711540-38711562 AGGTGACTCTGGGAGATGGAGGG - Intergenic
1023658538 7:42450344-42450366 AATTAAATGTAGAAGAGGGAGGG + Intergenic
1026015043 7:66666044-66666066 AAGCAGCTATTGAAGAGGGAAGG + Intronic
1026677970 7:72444221-72444243 AAGTAGCACATGAAGAGGGAAGG + Intronic
1027108624 7:75420632-75420654 GAGAAAATCTGGGAGAGGGAAGG - Intronic
1027557505 7:79684727-79684749 AAGTAGCAGTGGAATAGGGAAGG + Intergenic
1028257060 7:88611773-88611795 AAGTGACTGTGGAAGAGTGGTGG + Intergenic
1028479185 7:91286062-91286084 AAGAAAATGTGGAAGAGGGAGGG + Intergenic
1029990376 7:104957724-104957746 AAGTGACTGTGGCAGAGGCAGGG + Intergenic
1030085901 7:105815475-105815497 TAGTAACACTGGAAGCTGGAAGG + Intronic
1031883826 7:127225136-127225158 AAGTGACCCTGGCAGAAGGAGGG - Intronic
1033346883 7:140532629-140532651 AAGTAACTCTGAATGTAGGATGG + Intronic
1034843796 7:154424537-154424559 ACTTAAATGTGGAAGAGGGAGGG - Intronic
1034857798 7:154569184-154569206 AAGTAATTTTAGAAAAGGGAGGG + Intronic
1035850696 8:2916320-2916342 ACGTGACTCTGGAAGAGAAAAGG - Intergenic
1036003853 8:4639178-4639200 AAGTAACTTGGGAAGGGGAAGGG - Intronic
1036478598 8:9117640-9117662 AAGTAATGCAGGAAGAGGCATGG + Intergenic
1037510585 8:19577916-19577938 AATTAACTGTGGCAGAGGGCTGG - Intronic
1038298387 8:26318217-26318239 CAGTAACACTGGAAGGAGGAAGG - Intronic
1039519047 8:38155165-38155187 AAGTATCCCTGGAACAGAGAAGG - Intergenic
1040977097 8:53205641-53205663 AAGTCACACTGGAATAGGGTGGG + Intergenic
1041469899 8:58197102-58197124 AAGATACTCTGAAATAGGGAGGG + Intronic
1041789037 8:61670916-61670938 AAATGACCCTGGAAGAAGGAAGG + Intronic
1041837251 8:62230374-62230396 AAATAAAGCCGGAAGAGGGAGGG - Intergenic
1042151372 8:65789186-65789208 AAGTAATGTTGGAAGAGGGGAGG + Intronic
1043581685 8:81722019-81722041 AAGTAACACTGGTTGAGGGATGG - Intronic
1044954182 8:97462516-97462538 AAGGCACTGTGGGAGAGGGATGG - Intergenic
1045045336 8:98269838-98269860 TGGGAACTCTGGAGGAGGGAGGG - Intronic
1046639478 8:116711202-116711224 AAGTATCTCTGAAAGGGGCAGGG + Intronic
1046772900 8:118134578-118134600 CAGAAACTCTGGAGCAGGGAGGG + Intergenic
1047740205 8:127800600-127800622 AAATAACTCAGGAAGGGGAATGG - Intergenic
1048399463 8:134050880-134050902 CAGTAGCTCTGGAGAAGGGAAGG - Intergenic
1048644776 8:136408050-136408072 AGGTAAGTTTGGAAGAGTGAAGG + Intergenic
1051049433 9:12913898-12913920 GAGTAACAATGTAAGAGGGAGGG + Intergenic
1052381616 9:27777459-27777481 AAATAACTCTGTAAGAAGCAGGG - Intergenic
1057811665 9:98261867-98261889 AAGAAACTCTGGACGAGGGATGG - Intergenic
1058852581 9:109027178-109027200 AAGTAACTCCGGAAGTAGGGTGG + Intronic
1059861994 9:118475068-118475090 AATTAAACCTGGAAGTGGGATGG + Intergenic
1060039826 9:120290505-120290527 CAAGAACTCTGGAAGAGGGCAGG + Intergenic
1060773790 9:126353333-126353355 AATTACCTCTGGGAAAGGGAAGG - Intronic
1187567343 X:20464570-20464592 ATGCAACTCTGGAGAAGGGATGG + Intergenic
1188092957 X:25986056-25986078 AAGAATCTATGGAAGAGGAAAGG + Intergenic
1188524003 X:31070615-31070637 AAGAATCTCAGGAAGAAGGAAGG - Intergenic
1188623901 X:32260680-32260702 AGGCAACTGTGGCAGAGGGAGGG - Intronic
1188798881 X:34501996-34502018 GAGTAACTCTGGTAGTAGGATGG - Intergenic
1189394104 X:40604649-40604671 AGTTACCTCTGGATGAGGGAGGG - Intronic
1190864170 X:54370700-54370722 AAGAAACACTGCAACAGGGATGG - Intergenic
1191675597 X:63789170-63789192 GAGTAACTCTGGGGGAGGAAAGG + Intergenic
1192696235 X:73418990-73419012 AATTAACTCTGAAAGAAAGAAGG + Intergenic
1192737446 X:73862631-73862653 AAATATCTCTGGAAGAGGCTAGG - Intergenic
1193042105 X:77014790-77014812 AAACCACTCTGGGAGAGGGAAGG + Intergenic
1193596370 X:83451288-83451310 AAGTAAGTTTGGAAAGGGGAGGG - Intergenic
1194046259 X:89007560-89007582 AAGAAAGTTTGGAATAGGGAAGG + Intergenic
1194356263 X:92888310-92888332 TAGTAACTCTGGAGGTGGGATGG + Intergenic
1195478410 X:105314871-105314893 CAGTCCCTCTGGAAAAGGGAGGG + Intronic
1195673074 X:107485163-107485185 AAGTAACTTGGTAAGGGGGAAGG + Intergenic
1199507923 X:148586955-148586977 AAGAAAATATGGAAGGGGGAAGG - Intronic
1199688594 X:150288013-150288035 AAATAACTCTAAAAGAGAGAAGG + Intergenic
1200664611 Y:6005310-6005332 TAGTAACTCTGGAGGTGGGATGG + Intergenic
1200950062 Y:8889382-8889404 AAGAAACTCTAGAAGATGTAGGG - Intergenic