ID: 1146061697

View in Genome Browser
Species Human (GRCh38)
Location 17:29611268-29611290
Sequence CCCACAGTGCCTGCCGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146061690_1146061697 21 Left 1146061690 17:29611224-29611246 CCTATGGAAGTGCCTGAAGCAAA 0: 1
1: 0
2: 0
3: 7
4: 176
Right 1146061697 17:29611268-29611290 CCCACAGTGCCTGCCGGGGCAGG 0: 1
1: 0
2: 0
3: 29
4: 289
1146061691_1146061697 9 Left 1146061691 17:29611236-29611258 CCTGAAGCAAACACACACACGCA 0: 1
1: 0
2: 12
3: 252
4: 2447
Right 1146061697 17:29611268-29611290 CCCACAGTGCCTGCCGGGGCAGG 0: 1
1: 0
2: 0
3: 29
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146061697 Original CRISPR CCCACAGTGCCTGCCGGGGC AGG Intronic
900358436 1:2275923-2275945 CCCACCCTCCCTGCCCGGGCAGG + Intronic
900368753 1:2322271-2322293 TCCCCTGAGCCTGCCGGGGCTGG + Intronic
900381247 1:2385143-2385165 CCCGCAGTGCCTGCGGAGCCCGG - Intronic
900413280 1:2523352-2523374 CCCCCAGTGCTGGCCGGGCCCGG + Intronic
900523889 1:3119216-3119238 CCCACTGTGGCCGCCGGGGTGGG - Intronic
900615980 1:3565841-3565863 TCCACAGTGCCTGCCCTGGACGG - Intronic
902482148 1:16717691-16717713 CCCACAGCCCCTCCCTGGGCAGG + Intergenic
903330787 1:22596093-22596115 GCCACAGTGCCTGCAGAGGAGGG - Exonic
908751742 1:67430448-67430470 CCCACAGTGCCTTGCGGCGCAGG - Intergenic
912517884 1:110227291-110227313 CCCACAGAGCCTGCATGGGCTGG - Intronic
912543440 1:110433947-110433969 CCCACAGTGGGGGCAGGGGCAGG + Intergenic
915279683 1:154813970-154813992 CACACAGAGACTGCCAGGGCTGG + Intronic
915590314 1:156866756-156866778 CACACACTGCCTTCCAGGGCTGG + Intronic
920312376 1:205056293-205056315 CCAGCAGTGCCAGCTGGGGCAGG + Intronic
920401666 1:205680194-205680216 CCCACACGCTCTGCCGGGGCGGG - Intronic
920703281 1:208233783-208233805 CCCACAGTGCCTCTCGGGGAGGG + Intronic
921625265 1:217372632-217372654 TCCACAGAGCCTGCAGGAGCTGG + Intergenic
921868235 1:220109112-220109134 GCCACCGTGCCTGGCCGGGCTGG - Intronic
922566005 1:226602236-226602258 CCCACAGTGCTTTCCAGAGCAGG - Exonic
924099377 1:240588011-240588033 CCCACGGTGCCTGCAGGCACAGG + Intronic
1064007850 10:11712610-11712632 CCCACATTTTCTGCAGGGGCGGG + Intergenic
1065359456 10:24876118-24876140 CCCAAAGTGCCTGCCTCTGCAGG - Intronic
1066526409 10:36284033-36284055 CCCACAGGGCATGCAGGGGCGGG + Intergenic
1066745501 10:38602209-38602231 TCCACAGTGTCTGTCGGGCCGGG + Intergenic
1067065655 10:43102655-43102677 CCCACAGTGCCTGCTACTGCTGG + Intronic
1067639396 10:48031771-48031793 CCCACAGCCCTAGCCGGGGCCGG - Intergenic
1068544927 10:58334908-58334930 CCCAGTGTGCCAGGCGGGGCGGG + Intergenic
1070307418 10:75247954-75247976 CCCAGAGAGGCTGCCAGGGCTGG - Intergenic
1070415998 10:76189994-76190016 CCCACAGTACCTGTTGGAGCTGG - Intronic
1073582519 10:104681336-104681358 CCCACACTGCAGGCAGGGGCGGG - Intronic
1074818767 10:117163816-117163838 CCCCCAGCACCTGGCGGGGCGGG + Intergenic
1075316922 10:121460287-121460309 CACACAGTGTCTGCAGGGACAGG - Intergenic
1076214955 10:128686253-128686275 CACACAGTGCGTGACGGGGCAGG + Intergenic
1076404042 10:130200814-130200836 CCCACAGTGCCCCCCGGGTCAGG - Intergenic
1077093597 11:790167-790189 CCCACGGTTCCCGGCGGGGCGGG - Intergenic
1077472705 11:2771764-2771786 GCGACAGGGCCTGCTGGGGCTGG - Intronic
1077484401 11:2832188-2832210 CCCACTGTGCCTGAGGGGCCAGG - Intronic
1077543385 11:3158172-3158194 CCCAAAGGGCAGGCCGGGGCAGG - Intronic
1077746865 11:4916192-4916214 CCCACAGTGCCAGCAGAGGGAGG - Intronic
1078091613 11:8267949-8267971 CCCACAGATCCTGCAGGTGCAGG - Intronic
1081672815 11:44950968-44950990 CCCAGGGTGGCCGCCGGGGCGGG + Intronic
1081713353 11:45232231-45232253 CCCTCAGTGCCGGCTGGGCCAGG - Intronic
1081809044 11:45905138-45905160 CCCAAAGTACCTGCAGGGACAGG - Exonic
1081995266 11:47359722-47359744 CCCACAGTGCCAACGGCGGCTGG - Intronic
1082011840 11:47455082-47455104 ACCAGAGTGCCTGCTGGGCCAGG + Intergenic
1083477814 11:62925476-62925498 CCCACAGTCCCTGCCGTCTCTGG - Intergenic
1083955133 11:65978714-65978736 GGCCCTGTGCCTGCCGGGGCAGG + Intronic
1084496927 11:69510603-69510625 CCCACAGCCCCTGCTGGGTCTGG + Intergenic
1084630057 11:70342090-70342112 TCCCCAGTCCCTGCCCGGGCGGG - Intronic
1084654433 11:70506857-70506879 CCCCAAGTGCTTGCCAGGGCAGG - Intronic
1084676584 11:70639066-70639088 CTCACAGAGCCAGCCTGGGCTGG + Intronic
1087368184 11:97248355-97248377 CTCACACTGCCTGCCTGGGAAGG - Intergenic
1089286450 11:117410943-117410965 CTCACTGTGCCTCCCTGGGCAGG + Intronic
1090799081 11:130159668-130159690 CCCCCAGGGCCGGCGGGGGCGGG + Exonic
1091293971 11:134459601-134459623 TCCTCAGGGCCTGCCCGGGCAGG + Intergenic
1091631510 12:2164264-2164286 CTCACAGTGCCTGGCTGTGCTGG + Intronic
1093736375 12:22625153-22625175 GCCGCAGAGCATGCCGGGGCTGG - Exonic
1096110813 12:49028035-49028057 GGCTCAGTGCCTGCCCGGGCGGG + Exonic
1096674443 12:53218943-53218965 GCCGCAGTGCCTGGCGGGGGTGG - Intronic
1096706819 12:53427294-53427316 CCCACAGGGCCTGGTGTGGCTGG - Intronic
1102559646 12:113753195-113753217 CTTCCAGTGCCTGCAGGGGCTGG - Intergenic
1103320933 12:120092582-120092604 GCCCTAGGGCCTGCCGGGGCTGG + Intronic
1103899237 12:124295014-124295036 CCCACCGCGCAGGCCGGGGCGGG + Intronic
1104429529 12:128705385-128705407 CTCATAGTCCCCGCCGGGGCTGG - Exonic
1104857235 12:131907979-131908001 GCCACAGTGCCGGCGGGCGCGGG + Intronic
1106359689 13:29019205-29019227 CACACAGTGGCTGCAGGGACTGG + Intronic
1108478804 13:50846043-50846065 CCCACAGTGCATGCATGGTCAGG + Intergenic
1112050571 13:95641552-95641574 CCCACACTGCCAGTCGGGGGTGG - Exonic
1113879670 13:113617134-113617156 CCTACTGTGCCTGACGTGGCTGG - Intronic
1113880135 13:113620255-113620277 CCCACACTCCCTGATGGGGCAGG + Intronic
1113995034 14:16057767-16057789 CACACAGGGCCTGCGGGGGGAGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118385743 14:65254404-65254426 GCCACTGTGCCTGGCGAGGCAGG - Intergenic
1118781685 14:69012880-69012902 TCCACAGTGCCAGCCGTGCCAGG + Intergenic
1119730361 14:76947371-76947393 CTCGCAGCGCCTCCCGGGGCCGG + Intergenic
1120789083 14:88562977-88562999 CGCGCAGTGCCGGCCGGGGCGGG + Exonic
1122152211 14:99731350-99731372 CCCCCAGTGACTGCCGGGGAGGG - Intergenic
1122922559 14:104886033-104886055 TCCACAGGGCCTCCCGGTGCCGG + Exonic
1122960930 14:105093379-105093401 CCCTCACCGCCTGCCGGGGCGGG + Intergenic
1124347730 15:28933776-28933798 CCCTCAGTCCCTGCTGGGCCTGG - Intronic
1124680606 15:31727339-31727361 CCCACAGTACCAGCCCAGGCAGG + Intronic
1124707225 15:31976107-31976129 CCCAGAGTGTCTGCCCGGCCTGG + Intergenic
1124841459 15:33245699-33245721 CCCAAAGGACCTGCAGGGGCGGG + Intergenic
1125606412 15:40942075-40942097 CCCAGAGAGCCTCCCGGGGTCGG - Intergenic
1128463358 15:67888238-67888260 CCCACAGTTCCTCCCATGGCTGG - Intergenic
1129680483 15:77655998-77656020 CCCAGAGTCCCAGCAGGGGCAGG - Intronic
1129767690 15:78180745-78180767 CCCTCTGTACCTGCCGGGGCAGG + Exonic
1130051740 15:80489759-80489781 CCCACATTGCTTGCTAGGGCTGG + Intronic
1132727321 16:1344606-1344628 ACCACAGCGCCTGCCTGGGCTGG + Exonic
1132773343 16:1577592-1577614 CCCAAAGTGCCGGCCCGGCCAGG - Intronic
1132824373 16:1896027-1896049 TCCACAATGCCTTCCGGGTCGGG - Intergenic
1133038069 16:3045889-3045911 GCCACAGCGCCTGCCAGTGCCGG - Intergenic
1133125088 16:3641426-3641448 CCCAGAGGGCCTGCCTGTGCTGG - Intronic
1133255036 16:4511553-4511575 CCCAGTGTGCCTGCAGGAGCAGG + Exonic
1135303342 16:21349453-21349475 GGCACAGTGCCTGCAGGGACAGG - Intergenic
1135526291 16:23215847-23215869 CCCACACTGCCAGCCTGGGTTGG + Exonic
1136115475 16:28091710-28091732 CTCACAGAGCCTGCCTGGGGAGG - Intergenic
1136300087 16:29328647-29328669 GGCACAGTGCCTGCAGGGACAGG - Intergenic
1136414507 16:30095425-30095447 AGCCCAGTGCCTGCCGGGGAGGG + Exonic
1136737568 16:32477440-32477462 TCCACAGTGTCTGTCGGGCCGGG - Intergenic
1136913806 16:34163260-34163282 CACACAGGGCCTGCGGGGGGAGG - Intergenic
1138519596 16:57563499-57563521 CCCACAGCGCCTCCCGCAGCGGG - Intronic
1138559960 16:57795415-57795437 CCCACAGTGGCTTTTGGGGCAGG + Intronic
1138647936 16:58438800-58438822 CCCAGAGTGCCTGCAGGGACTGG - Intergenic
1138680040 16:58677739-58677761 CCCACAGCCCCTGCCCGGGCTGG - Intronic
1139045664 16:63056181-63056203 CCCACAGTGCCTACAGAGGGAGG - Intergenic
1139287626 16:65829771-65829793 CCCACAGTGTCTGGCCAGGCTGG - Intergenic
1139824452 16:69746100-69746122 GCCACAGTGGCTGGCGGGGCGGG + Intronic
1140354817 16:74296755-74296777 CCCAGAGTGCCTCGCGCGGCGGG - Exonic
1141648642 16:85380546-85380568 CCAACACTGCCCGCCGGGGGAGG + Intergenic
1141739947 16:85884456-85884478 CCCACAGTGCCTGCCCGGTTTGG + Intergenic
1142134514 16:88445495-88445517 CCCCCAGGGCCTGGCGCGGCTGG + Intergenic
1203015503 16_KI270728v1_random:352137-352159 TCCACAGTGTCTGTCGGGCCGGG + Intergenic
1203033838 16_KI270728v1_random:625295-625317 TCCACAGTGTCTGTCGGGCCGGG + Intergenic
1143498203 17:7324304-7324326 GGCAGAGTTCCTGCCGGGGCTGG + Intronic
1144515907 17:15917554-15917576 CCTCCAGTGCCTGCGGGGGCAGG - Intergenic
1144670702 17:17131130-17131152 CCCACAGTCCCTGCAGAGGGAGG - Intronic
1146057827 17:29589793-29589815 GCCACGCTGCCCGCCGGGGCCGG - Intronic
1146061697 17:29611268-29611290 CCCACAGTGCCTGCCGGGGCAGG + Intronic
1146185118 17:30719703-30719725 GCCACAGGACCTGACGGGGCTGG + Intergenic
1146377107 17:32302223-32302245 CCCACACTTCCTGCCCGGGGAGG + Intronic
1150338021 17:64344124-64344146 CCCACAGTGGGGGCTGGGGCAGG + Intronic
1151453741 17:74214228-74214250 CCCACCCTGCAGGCCGGGGCTGG - Intronic
1152044123 17:77924727-77924749 CCCAAGGTGGCTGCTGGGGCAGG + Intergenic
1152185867 17:78855998-78856020 CCCACGGTTCCTGCAGGGGCAGG + Intronic
1152231934 17:79118096-79118118 CCCCCAGTGCCGGCCGGCCCTGG + Intronic
1152523626 17:80875058-80875080 ACCACCGTGCCTGACGGGGAAGG - Intronic
1152633108 17:81419540-81419562 CCCACAGGGCCCGCCCAGGCGGG - Intronic
1152729427 17:81962190-81962212 CCCCCAGTGGCGGCTGGGGCAGG - Intergenic
1153757969 18:8302419-8302441 CCTACAGAGCCTTCTGGGGCAGG + Intronic
1153900574 18:9614392-9614414 CCCTGAGTGGCTGCCGGGCCGGG - Intronic
1154164723 18:12006246-12006268 GCCACAATGGCAGCCGGGGCAGG - Intronic
1154269526 18:12907170-12907192 CCCAAAGTGCTGGCCAGGGCTGG - Intronic
1154325356 18:13387196-13387218 CCCACAGGGGCTGCCAGGGTGGG - Intronic
1155633736 18:27925709-27925731 CCACCAGGGCCTGCCGGGGGTGG - Intergenic
1156388171 18:36625554-36625576 CCCCCAGTGGGTGCCGGGACCGG + Exonic
1159704997 18:71675218-71675240 TCCACAGAGCCAGCAGGGGCTGG - Intergenic
1160614650 18:80115756-80115778 ACAACAGTGGCTGCCAGGGCTGG - Intronic
1160708193 19:539603-539625 CCCACAGTGCCCGCATGGGAGGG - Intronic
1160732997 19:649639-649661 CCCAGAGTGCCTGCTGGGGGAGG - Intronic
1161063679 19:2227481-2227503 CCCGCAGTGCCTGCCCAGACAGG + Intronic
1161087209 19:2340695-2340717 CCCCCAGCGCCTGCCCGGGTCGG + Intronic
1161516543 19:4699736-4699758 CCCACAGTAGCTGACGGGTCCGG + Intronic
1161538980 19:4838143-4838165 CCCAAAGTGCCTGGCCAGGCTGG - Intergenic
1161571034 19:5031019-5031041 CCCTCAGTGCCGGCCTGAGCTGG - Intronic
1161600284 19:5178104-5178126 TCCACTGTTCTTGCCGGGGCGGG + Intronic
1161673023 19:5624581-5624603 GCCCCACTGCCTGCAGGGGCTGG - Intronic
1161756072 19:6135291-6135313 CCCAGACTCCCTGCCTGGGCGGG + Intronic
1161900695 19:7117037-7117059 CTAACAGTGCCTACCGTGGCGGG - Exonic
1161982563 19:7637464-7637486 CCTAGGGTGCCTGCCGGGGGAGG + Intronic
1162367527 19:10258457-10258479 CCCACAGTACCTGACAGAGCTGG + Exonic
1162545268 19:11325344-11325366 ATCACAGTCCCTGCCGAGGCAGG + Exonic
1162725433 19:12687669-12687691 GCCACAGGGCCTCCTGGGGCAGG + Intergenic
1162742706 19:12782712-12782734 CCCAAGGTCCCGGCCGGGGCGGG - Intronic
1162964559 19:14149777-14149799 TCCCCAGTCCCCGCCGGGGCGGG - Exonic
1162973662 19:14195986-14196008 GCCACAGGACCTGACGGGGCTGG - Intronic
1163786050 19:19275483-19275505 CCCCTGGTGCCTGCAGGGGCTGG + Intergenic
1164023482 19:21329454-21329476 CCCTCAGGGCCTGAAGGGGCGGG - Intergenic
1165074652 19:33273966-33273988 CCCTCAGAGCCTGGCTGGGCTGG - Intergenic
1165742292 19:38211375-38211397 CGCCCCGTGCCTGCCGTGGCTGG - Intronic
1165751688 19:38264363-38264385 CCAACAGAACCTGGCGGGGCGGG - Intronic
1165789550 19:38483343-38483365 CCCGCAGTGCCCACCGCGGCTGG + Exonic
1165900798 19:39168384-39168406 CCCACAGTGCCTGTGGGAGGAGG - Intronic
1166218888 19:41353107-41353129 CCCCCAGCCCCTGCAGGGGCGGG - Exonic
1166738827 19:45102063-45102085 CCCACAGCCCATGCAGGGGCAGG - Intronic
1167263078 19:48469815-48469837 AGCCCAGCGCCTGCCGGGGCCGG + Intronic
1167293684 19:48637523-48637545 CCCATAGAGGCTGGCGGGGCTGG - Intergenic
1167647545 19:50713855-50713877 CCCACATTGACTTCCGGGCCCGG - Exonic
1168153719 19:54462152-54462174 GCCAGAGTGTCTGCAGGGGCTGG + Exonic
1168573231 19:57487812-57487834 GCCACCGTGCCTTCCGGCGCTGG - Exonic
926311599 2:11679720-11679742 CGCACAGAGACTGCCGGGGCAGG - Intronic
928410328 2:31049477-31049499 GCCACTGTGCCTGCTGGGCCGGG + Intronic
929168913 2:38911722-38911744 GCCACAGTGCCTGGCGGGGAAGG - Intronic
930003543 2:46878859-46878881 CACACAGTGTCCGCCTGGGCTGG + Intergenic
930852941 2:55980999-55981021 CCCTCAGTGCCTGGCCTGGCTGG - Intergenic
930946782 2:57084869-57084891 TCCACAGAGCCTGCAGGAGCCGG - Intergenic
934188695 2:89766553-89766575 TCCACAGTGTCTGTCGGGCCGGG - Intergenic
934307899 2:91841400-91841422 TCCACAGTGGCTGTCGGGCCAGG + Intergenic
935068728 2:99675413-99675435 ACCTCTGTGCCTGTCGGGGCTGG - Intronic
935953845 2:108354946-108354968 ACCCCAATGCCTGCAGGGGCAGG - Intergenic
936896691 2:117435667-117435689 ACCACAGTGCCTGGCATGGCTGG - Intergenic
937913484 2:127087590-127087612 CTCACAGTGGCCGGCGGGGCTGG + Intronic
937955579 2:127420188-127420210 CACACAGGGGCTGCCAGGGCAGG + Intronic
937984419 2:127632179-127632201 CCCAAGGTGCCTGCCTGGCCAGG + Intronic
938124504 2:128662333-128662355 CCCACACTGCCAGCCGGCCCTGG + Intergenic
938472686 2:131579995-131580017 ACCACAGTGCTTGCCAGGGTTGG - Intergenic
938619013 2:133030300-133030322 CACTCAGTGCCTGCAAGGGCTGG + Intronic
938669513 2:133573565-133573587 CTCACTGTGCCTCCCTGGGCTGG - Intergenic
939376578 2:141375951-141375973 CCCACACTGCTTGCCTGGGAAGG - Intronic
940270998 2:151889839-151889861 CCTACAGTGCCTGGCATGGCAGG + Intronic
940640841 2:156342694-156342716 CCCGCAGGGCGGGCCGGGGCGGG - Intergenic
941124742 2:161571367-161571389 ACCACACTGCCTGCCTGGGAGGG - Intronic
943767575 2:191678735-191678757 CCCGCTGTGCCTCCCGGGGCGGG + Intronic
944285402 2:197943921-197943943 AGCACAGTGCATGCTGGGGCAGG - Intronic
948836123 2:240626814-240626836 CCCAGAGTGCCTGGCTGGCCTGG - Intronic
1171908717 20:30921833-30921855 CACACAGGGCCTGCGGGGGGAGG - Intergenic
1173169601 20:40713377-40713399 CCCACTCTGCCTGGAGGGGCTGG - Intergenic
1174231234 20:49046862-49046884 CCCGCAGTCCCCGCCCGGGCAGG - Intronic
1175220070 20:57411743-57411765 CCCAGAGTGACTGCCGAGGGTGG - Intergenic
1175222761 20:57426796-57426818 CCCACAGTGGCTTCTGAGGCTGG - Intergenic
1175737887 20:61399845-61399867 CCCTCAGACCCTGCCGGGGAAGG - Intronic
1175766822 20:61598098-61598120 CCCACAGTGCCCGGCGTGTCTGG - Intronic
1175907994 20:62391219-62391241 CCTGCAGTGCCTGCCGAGCCGGG + Intronic
1176169292 20:63689743-63689765 CCCACAGTTCCTCTCTGGGCAGG + Exonic
1176286114 21:5020482-5020504 CCCCCAGTGCCGCCCGGGGGCGG - Intergenic
1179180582 21:39041601-39041623 AGCACAGTGCCTGCCCGGGGTGG + Intergenic
1179840195 21:44067566-44067588 CCCACAGTGCCTGGCAGGCAAGG - Intronic
1179871067 21:44242993-44243015 CCCCCAGTGCCGCCCGGGGGCGG + Intergenic
1180190292 21:46159655-46159677 CACACAGGGCCGCCCGGGGCGGG - Intergenic
1180312058 22:11249642-11249664 CACACAGGGCCTGCGGGGGGAGG + Intergenic
1180534981 22:16388482-16388504 TCCACAGTGTCTGTCGGGCCGGG + Intergenic
1181058957 22:20272880-20272902 TCCACACTCCCTGCAGGGGCGGG - Intronic
1181170583 22:21006812-21006834 CCCACAGTGCCTGCCAGCTAAGG + Intergenic
1181415634 22:22756787-22756809 CCCACAGTGCCTGGCATGCCAGG - Intronic
1181476065 22:23168515-23168537 CACACAGTGCCTGAAGCGGCAGG - Intergenic
1181626739 22:24127270-24127292 GCCGCGGTGCCTGTCGGGGCTGG + Intronic
1182667980 22:31972950-31972972 CCCACAGTACCGGGCAGGGCAGG - Intergenic
1182817342 22:33177140-33177162 CACACTGGGCCTGTCGGGGCTGG + Intronic
1183418553 22:37697051-37697073 CGCACAGGGGCTGCCGGGGTGGG - Exonic
1185110792 22:48899055-48899077 CCCAGAGTGCTTTCCGGGGATGG + Intergenic
1185269608 22:49922996-49923018 CACTCAGTGCCAACCGGGGCAGG - Intronic
1185286179 22:50000846-50000868 CCCAGAGCGCCTGCGGGGCCTGG - Exonic
1185315889 22:50178966-50178988 CCCACAGAGCCAGCCCGGGCAGG + Exonic
950702701 3:14761250-14761272 CCCACCGTCCCAGCCTGGGCAGG + Intronic
951574569 3:24100633-24100655 CCCAGAATCCCTGCAGGGGCTGG + Intergenic
953351632 3:42220604-42220626 CCAGCAGTGCCTGCCCTGGCAGG + Intronic
953833443 3:46322821-46322843 CCCACAAAGCCTCCCTGGGCAGG - Intergenic
954596689 3:51830975-51830997 GCCATAGTCCCTGCTGGGGCAGG - Intergenic
955488342 3:59457424-59457446 CCCACACTGCCTGCCACTGCCGG - Intergenic
956229454 3:66998025-66998047 CGCGCAGTGCCTGCCGGGAGAGG - Intergenic
962143263 3:132812808-132812830 ACCACTGTGCCTGCCCTGGCTGG + Intergenic
962527623 3:136250654-136250676 CGCACGGTGCCTGGAGGGGCCGG + Intronic
963938292 3:151076489-151076511 GCCACAGGGCCTGCTAGGGCAGG - Intergenic
964219175 3:154324468-154324490 CGCACAGTGGCTTCCGGGCCCGG - Exonic
968493590 4:903486-903508 CCCACAGTGCCTCCCTGGTTCGG - Intronic
968523504 4:1045126-1045148 CCCACAGTGCAGGCCAGGGGTGG + Intergenic
968702921 4:2065255-2065277 CCCACACTGCAGGCCAGGGCTGG - Exonic
968921041 4:3522499-3522521 CCCACACTCCCTGCCTGGGGAGG + Intronic
971371656 4:26024188-26024210 TCCACCGTGCCTGCTGAGGCAGG + Intergenic
972045490 4:34660646-34660668 CCCACAGTGCCTACCAGCCCTGG + Intergenic
976377812 4:84364972-84364994 GGCAAAGTGCCTGCCGAGGCAGG + Intergenic
982288780 4:153759888-153759910 GGCACAGCGCCTGCCGGGGAGGG + Exonic
983532820 4:168829400-168829422 CCCACAGTCCCTTCCATGGCCGG + Intronic
984837152 4:184032745-184032767 CTCACAGAGCCTGCAGTGGCTGG + Intergenic
985478003 5:90773-90795 CCCACAGCTCCTGCCAGAGCAGG - Intergenic
985912629 5:2895853-2895875 CCCAGAGTGCCTGCAGGTGTGGG + Intergenic
986748154 5:10761604-10761626 CCCACAGTGCGGGCCAGGGCCGG + Intergenic
988455275 5:31381888-31381910 CCCTCAGTGTCCGCTGGGGCTGG - Intergenic
996544198 5:124660398-124660420 CCCACACTGCCTGCAGGGCATGG - Intronic
997408704 5:133673370-133673392 CCCAAAGTCCCTCCCAGGGCAGG + Intergenic
997698223 5:135878216-135878238 CCCACAGCTCCTGCAGGGCCCGG + Intronic
999188297 5:149729185-149729207 CCCACAATGCATGAAGGGGCTGG - Intergenic
1002094568 5:176823416-176823438 CCCCCAGTGCCTGCCTGACCCGG - Intronic
1002108864 5:176894511-176894533 GCCACAGTGCCTGCCCAGCCAGG - Intronic
1002364241 5:178697623-178697645 CTCACTGTGCCTGCAGGGTCTGG + Intergenic
1002633674 5:180596723-180596745 CCCAGAGTGCCTGCTGGGACTGG - Intergenic
1005496178 6:26389821-26389843 ACCTCAGTGACTGCCAGGGCCGG - Intronic
1006440838 6:34052701-34052723 ACCACAGAGCATGCCTGGGCTGG + Intronic
1006635736 6:35460054-35460076 GCAACAGTGGCTGCTGGGGCTGG + Intronic
1007301599 6:40871925-40871947 CCCACAGGGCCTGCATGGGGTGG - Intergenic
1007396714 6:41582191-41582213 CCCACTGTCCCTTCCGGGTCAGG + Intronic
1008539372 6:52533631-52533653 GCCACAGTGACTGCAGGGGATGG + Intronic
1018774409 6:166999618-166999640 CCCCCAGTGCCCGCCGGCCCCGG - Intronic
1018807228 6:167270844-167270866 CCCACGGTGTCAGCCGGGCCAGG - Intergenic
1018873350 6:167799567-167799589 CCCTCAGAGCCTGGCGTGGCCGG + Intergenic
1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423894 7:964088-964110 CCCCAAGAGCCTGCCGAGGCGGG + Intronic
1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019437071 7:1027948-1027970 CTCGCAGTGCCTGCAGGGCCTGG + Intronic
1020323607 7:6957906-6957928 CCCACAGTGGCTAAGGGGGCAGG - Intergenic
1022339543 7:29455531-29455553 CCCACAGTTCCTGCAGTGGTGGG - Intronic
1023264880 7:38394102-38394124 GCCACTGTCCCTGCCGGGGAAGG - Exonic
1026744072 7:72997687-72997709 GGCACAGTGCCTGGGGGGGCGGG - Intergenic
1026804320 7:73420308-73420330 GGCACAGTGCCTGGTGGGGCGGG - Intergenic
1026994181 7:74605244-74605266 CCCAGAGTGCATGGCTGGGCAGG - Intergenic
1027030178 7:74882364-74882386 GGCACAGTGCCTGGGGGGGCGGG - Intergenic
1027099665 7:75367405-75367427 GGCACAGTGCCTGGGGGGGCGGG + Intergenic
1029655862 7:101924048-101924070 CTCACCGTGCCTGCCAGGGTCGG - Intronic
1032403030 7:131637093-131637115 ACCACAGGGCATGCCTGGGCTGG + Intergenic
1033260250 7:139838019-139838041 CCCACAGTGAGTCCTGGGGCGGG - Intronic
1034266910 7:149785477-149785499 CCCATAGCGTGTGCCGGGGCCGG + Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1035026549 7:155830324-155830346 CCCACTGTGCGTGCCAGGGGAGG + Intergenic
1035609335 8:949534-949556 GGGCCAGTGCCTGCCGGGGCAGG + Intergenic
1036817170 8:11910788-11910810 CCCACAGTGGCTGAGAGGGCAGG - Intergenic
1036910378 8:12754060-12754082 CCTGCAGGGCCTCCCGGGGCCGG + Intronic
1039957935 8:42221571-42221593 CTCACAGTGCCTCTCGGAGCTGG - Intergenic
1040550051 8:48430586-48430608 TCCTCAGTGTCTGCCCGGGCTGG + Intergenic
1042485097 8:69339242-69339264 CCCACAGTGCCTGAGGGGCTGGG - Intergenic
1046496333 8:115019201-115019223 CCCACATTGCTTGCCTGGGAGGG - Intergenic
1046503772 8:115111594-115111616 TCCACAGTGCCTGCAGTGCCAGG + Intergenic
1046900121 8:119514873-119514895 CCCTCAGTTCCTGCCAAGGCTGG - Intergenic
1048259513 8:132933937-132933959 CCCACACTGCCTGATGGGGCAGG - Intronic
1049182490 8:141230224-141230246 CCCACTGTGGCTGTCAGGGCTGG + Intronic
1049269416 8:141686365-141686387 CTCACAGTGCAGGCCGGGGGCGG - Intergenic
1049541107 8:143209416-143209438 CCCACAGTGCCAGGCTGAGCAGG - Intergenic
1049675374 8:143886703-143886725 CCCACATGCCCTGCCTGGGCGGG - Intergenic
1049709460 8:144057109-144057131 CCCACTGTGCCTGCAGGGATGGG + Exonic
1049740427 8:144238383-144238405 CCCACCGTGGCTGCCGAGGCTGG + Intronic
1049778242 8:144416076-144416098 CCCACAGTGCCTGTCTGTGGAGG - Exonic
1051344513 9:16140078-16140100 TCCACACTGACTGCTGGGGCTGG + Intergenic
1056660005 9:88536232-88536254 CCCACAGTGCAGGCCGTGGTTGG + Intronic
1057245384 9:93451166-93451188 CCCACACTGACTGCGGGGTCCGG - Intronic
1057307720 9:93921779-93921801 CCCTGAGAGGCTGCCGGGGCTGG - Intergenic
1057546445 9:96022617-96022639 CCCGCAGCGCCAGCCGGGTCCGG + Intergenic
1060411671 9:123404446-123404468 ACAACCGAGCCTGCCGGGGCAGG + Intronic
1060730394 9:126033458-126033480 CCCCAAGAGCCTGCAGGGGCAGG + Intergenic
1061383708 9:130276039-130276061 CCCAGGGTGCCTGCAGGGGGAGG + Intergenic
1061712748 9:132499040-132499062 CACACAGTCCCTGCCGGCGGCGG - Intronic
1062282294 9:135757436-135757458 CGCACAGTGTCTTCCAGGGCCGG - Intronic
1062697035 9:137880790-137880812 CCCACAGAGCAGGCCGAGGCTGG + Intronic
1187464464 X:19515183-19515205 CCCTCAGTGCCCGCCGCCGCCGG - Exonic
1189897662 X:45672862-45672884 CCCACAGTGACTCCTGGGGAAGG + Intergenic
1190108602 X:47575160-47575182 CCCGCTGTCGCTGCCGGGGCAGG + Exonic
1192204844 X:69089048-69089070 CCTACAGTGGCACCCGGGGCTGG - Intergenic
1198518157 X:137428576-137428598 CCAGCAGGGCCTGCCTGGGCCGG + Intergenic
1198674866 X:139120769-139120791 CCCACAGTGCCTGAAGGCGTAGG - Intronic
1199092207 X:143705463-143705485 TCCACAGAGCCTGCAGGAGCTGG + Intergenic