ID: 1146062760

View in Genome Browser
Species Human (GRCh38)
Location 17:29615686-29615708
Sequence CGGGGCGGGGCGCACAAGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146062760_1146062763 -9 Left 1146062760 17:29615686-29615708 CCGAGCTTGTGCGCCCCGCCCCG 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1146062763 17:29615700-29615722 CCCGCCCCGCTCCGCCTGCCTGG 0: 1
1: 1
2: 9
3: 95
4: 601
1146062760_1146062769 -1 Left 1146062760 17:29615686-29615708 CCGAGCTTGTGCGCCCCGCCCCG 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1146062769 17:29615708-29615730 GCTCCGCCTGCCTGGCGCGCGGG 0: 1
1: 0
2: 2
3: 25
4: 189
1146062760_1146062768 -2 Left 1146062760 17:29615686-29615708 CCGAGCTTGTGCGCCCCGCCCCG 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1146062768 17:29615707-29615729 CGCTCCGCCTGCCTGGCGCGCGG 0: 1
1: 0
2: 1
3: 8
4: 112
1146062760_1146062770 0 Left 1146062760 17:29615686-29615708 CCGAGCTTGTGCGCCCCGCCCCG 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1146062770 17:29615709-29615731 CTCCGCCTGCCTGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146062760 Original CRISPR CGGGGCGGGGCGCACAAGCT CGG (reversed) Exonic