ID: 1146066827

View in Genome Browser
Species Human (GRCh38)
Location 17:29642596-29642618
Sequence CTGTTTTTATAGATGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 437}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146066827 Original CRISPR CTGTTTTTATAGATGGGGGA TGG (reversed) Intronic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
901909033 1:12439430-12439452 CTGCAATTTTAGATGGGGGAGGG - Intronic
902398426 1:16144695-16144717 CTCATTTTACAGATGGGGGTGGG + Intronic
902844486 1:19099143-19099165 CTGTTTTACTAGTTGGGGAATGG - Intronic
903704618 1:25276518-25276540 TTTTTTTTAGAGATGGGGGGGGG - Intronic
903812186 1:26040918-26040940 ATGTTTGTAGAGATGGGGGGGGG - Intronic
903975564 1:27147634-27147656 GTTTTTTTAGAGATGGGGGATGG - Intronic
904594975 1:31638256-31638278 CCCATTTTACAGATGGGGGAGGG + Intronic
904716011 1:32468109-32468131 TTATTTTTTGAGATGGGGGATGG - Intronic
904847963 1:33435039-33435061 GTGTATATATGGATGGGGGAAGG - Intergenic
905903331 1:41596683-41596705 CCCTTTTTATAGATGGGGGCAGG + Intronic
906542817 1:46601238-46601260 TTCATTTTATAGATGGGGAAAGG - Intronic
906924059 1:50095332-50095354 CTGTTCTCCTAGTTGGGGGAAGG - Intronic
907318498 1:53588010-53588032 CCCATTTTATAGATGGGGAAAGG - Intronic
907411116 1:54283989-54284011 CTTTTTTTAAAAATGGGGTAAGG + Intronic
907653041 1:56314335-56314357 CTGGTGTTGTAGATGGAGGAAGG + Intergenic
908410221 1:63856830-63856852 CAGTTTTTAAACATTGGGGATGG - Intronic
909022641 1:70449283-70449305 CTGGCTTTAAACATGGGGGAAGG - Intergenic
909107113 1:71425422-71425444 TTGTTTTTATAGTTGGGGAAAGG - Intronic
909355267 1:74701226-74701248 TTGTTTTTTTTGGTGGGGGAGGG - Intergenic
909684136 1:78326992-78327014 CTGATTTTACAAATGGGGAAAGG - Intronic
910861776 1:91749123-91749145 CTGTTTTAATGGATTGGGGCAGG + Intronic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911885903 1:103299284-103299306 CTATCCTTATAGCTGGGGGAGGG - Intergenic
913320149 1:117582319-117582341 CTGTTGTTATGGGTGGGGGTGGG + Intergenic
914692325 1:150041809-150041831 CTCTTTTAAAAGTTGGGGGATGG - Intergenic
915400246 1:155616735-155616757 CTAGATTTAGAGATGGGGGAAGG + Intergenic
916012873 1:160722515-160722537 CAGTTTTTATAGTTTGTGGAAGG + Intergenic
916179106 1:162069383-162069405 TTGTTTTTGGAGAGGGGGGAGGG - Intergenic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916887944 1:169088274-169088296 CTGATTTTACAAATGGGAGAAGG - Intergenic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
919795095 1:201316762-201316784 CCGCTTTTAGAGATGGGTGAGGG + Intronic
920425433 1:205871487-205871509 CTCTTTTTATAGATGGGTTTTGG + Intergenic
921261692 1:213389925-213389947 CTGTGTTTATGGATGAGGCATGG + Intergenic
921927721 1:220726297-220726319 CTGGTTTTGTAGACGGGAGAGGG - Intergenic
921986184 1:221315521-221315543 CTGTGTCCATAGCTGGGGGAAGG + Intergenic
922565592 1:226599516-226599538 CTGTTTTTATAGCAAGGGGCTGG - Intronic
924233835 1:241984240-241984262 GTATTTTTAGAGATGGGGGCTGG - Intergenic
924354379 1:243154786-243154808 CTGTTTTTTTATTTGGGGGTAGG + Intronic
1063756097 10:9010450-9010472 CTGATTTCAAAGGTGGGGGATGG - Intergenic
1064416311 10:15153250-15153272 ATTTTTTTAGAGATGGCGGAGGG - Intronic
1064760991 10:18620495-18620517 TTGTTTTCAGAGTTGGGGGATGG - Intronic
1065356851 10:24850632-24850654 GTGTCTTTAAAGAGGGGGGAGGG + Intronic
1065502163 10:26392781-26392803 CTTTTTTTAGAGATGGGGTCTGG + Intergenic
1066214611 10:33274066-33274088 CTGTTACTATAGAATGGGGAAGG - Intronic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1066540574 10:36442305-36442327 CTGTTTTTATAGACGTGGCGTGG + Intergenic
1066694676 10:38067174-38067196 GTGTATTCATTGATGGGGGAAGG - Intergenic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1067934776 10:50600488-50600510 CTGCTATTCTATATGGGGGAAGG + Intronic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1068657413 10:59589900-59589922 CTGTTTTTCTAGCGGGGGAAGGG - Intergenic
1068698581 10:59995701-59995723 CAATTTTTATAGTTGTGGGATGG + Intergenic
1071927603 10:90428572-90428594 CTGGTTTTAAAGATGGGCAAAGG - Intergenic
1072551517 10:96481124-96481146 CTGTTTTTTTTGTTGGGGGATGG + Intronic
1072622295 10:97088124-97088146 CTGATTTTATTGATCAGGGAGGG + Intronic
1072628645 10:97130823-97130845 CTATTGTTTTTGATGGGGGAGGG + Intronic
1073106582 10:101035834-101035856 GTGTTTGTATAAATGGGGGTGGG + Intronic
1076582159 10:131518930-131518952 CTGTTTCTGTAGATGGGGCTGGG + Intergenic
1076926629 10:133493702-133493724 CTGTTTTCATGCATGGTGGAGGG + Intergenic
1078673039 11:13381961-13381983 CTGTTTTAGGAGATGGGGAAAGG - Intronic
1078826785 11:14937546-14937568 CTGACTGTAGAGATGGGGGAGGG - Intronic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1080387560 11:31818890-31818912 CTGTTTTGAGGGATGAGGGACGG - Intronic
1080442681 11:32309859-32309881 CTATTTTTCTATACGGGGGAAGG - Intergenic
1081175720 11:39924200-39924222 CTTTTTTTTTGGGTGGGGGAGGG - Intergenic
1081415281 11:42807507-42807529 ATCTTTTTATAAATGGGGGGAGG + Intergenic
1081492836 11:43580801-43580823 CTTTTTTTTCAGAAGGGGGAGGG - Intronic
1081774220 11:45666300-45666322 CTGCTTTTATGGATGAGGGATGG + Intergenic
1082310381 11:50638860-50638882 CTGTTTTTGTAGATCTGTGAAGG + Intergenic
1082984977 11:59160744-59160766 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1083129731 11:60613924-60613946 CTTTTTTTTTTTATGGGGGAAGG - Intergenic
1083667372 11:64283235-64283257 CTATTTTTAGAGATGGGGTCTGG + Intronic
1085222507 11:74887040-74887062 TTGTTTTTGTAGATGGTGTAAGG - Intronic
1085833433 11:79927744-79927766 CACATTTTATAGATGAGGGAAGG - Intergenic
1087179411 11:95127051-95127073 CTGTTTTTTAAAATGTGGGATGG + Intronic
1088474095 11:110217249-110217271 CTGTTTTTACAGGTCGGGGATGG + Intronic
1088856587 11:113760679-113760701 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
1089117427 11:116107279-116107301 CTGTCTTTATTGAGGGGCGAAGG - Intergenic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1091213792 11:133887081-133887103 ATGTTTTCATAGGTGTGGGAGGG - Intergenic
1092047046 12:5438954-5438976 CTGTTTTTATCTTTGGGGAATGG + Intronic
1094725785 12:33114354-33114376 CTGTTTTTAAAAATGGTAGATGG - Intergenic
1096021148 12:48326614-48326636 CTGATTTTAAAGATGGGAAAAGG + Intergenic
1096031659 12:48421532-48421554 TTTTTTTTTTAGATGGAGGATGG + Intergenic
1097849759 12:64400279-64400301 CTGATTTGATGGATGAGGGAAGG - Intergenic
1098380958 12:69869114-69869136 CCATTTTTATAGTTGGAGGATGG + Intronic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1099131468 12:78838211-78838233 TTGTTTTTATTGATGTGAGATGG + Intergenic
1099259301 12:80357098-80357120 TAGTTTTTGTTGATGGGGGAAGG - Intronic
1100306756 12:93357122-93357144 CTTTTTTTTTTGTTGGGGGAGGG + Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1101033080 12:100678904-100678926 ATGTTTCTAAAGATGAGGGAAGG - Intergenic
1101943018 12:109114438-109114460 CTGATTTAATTGGTGGGGGAAGG + Intergenic
1102388943 12:112534342-112534364 TTGTTTGTAGAGATGGGGGGTGG + Intergenic
1102597347 12:114002953-114002975 TTGTATTTGGAGATGGGGGAGGG - Intergenic
1102859548 12:116323489-116323511 TTTTTTTTTGAGATGGGGGATGG - Intergenic
1103801407 12:123540169-123540191 CTGTTTTTTTGGCTGGGGTAGGG + Intergenic
1104335163 12:127887650-127887672 CATTCTTTATAGATGAGGGAGGG + Intergenic
1105343830 13:19555169-19555191 CTCATTTTATAGGTGGGGAAAGG + Intergenic
1105536212 13:21266445-21266467 CTCATTTTATAGGTGGGGAAAGG - Intergenic
1106034123 13:26028499-26028521 CAGTTTTAAAAGTTGGGGGAAGG - Intergenic
1106717752 13:32408638-32408660 CAGTTTTTACAGATGCGGAAAGG - Intronic
1106775234 13:33002401-33002423 CTGTTTGTAAAGATGGGAGGTGG - Intergenic
1107052893 13:36070939-36070961 CTCTTTATAAAGATGGGGGCCGG - Intronic
1107356012 13:39567731-39567753 CTCTTTTTATAGAGCAGGGATGG + Intronic
1108019604 13:46113568-46113590 TTGTTTATATTGATGTGGGAAGG + Intergenic
1109126167 13:58520270-58520292 TTCTTTTTAGAGATGGGGGAGGG + Intergenic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1110162111 13:72390867-72390889 TTGTTTTTAGAATTGGGGGAGGG - Intergenic
1111311128 13:86487626-86487648 CTGGCTTTAAAGATGGGGTATGG - Intergenic
1112047926 13:95616348-95616370 TTGTTTTCATAGATGGAGAAAGG - Intronic
1113013863 13:105805146-105805168 CTGTCCCTCTAGATGGGGGAAGG + Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1114239208 14:20850641-20850663 CTGATTTTTTAGTGGGGGGATGG - Intergenic
1114933139 14:27500776-27500798 CTATTTTTATAGATGAGAAATGG + Intergenic
1115749818 14:36477868-36477890 TTTATTTTATAGATGGAGGAGGG - Intronic
1117169203 14:53074411-53074433 TTGCTTTTAAATATGGGGGAGGG - Intronic
1117232325 14:53733279-53733301 CAGTTTTTAAAGATGGGCAAAGG + Intergenic
1117331239 14:54713932-54713954 CTCATTTTATAGATGAGGAAAGG - Intronic
1117380384 14:55156288-55156310 CTGTTTTTGGTGATGGGGGTGGG - Intronic
1117823546 14:59676718-59676740 CTGATTTGATTGATTGGGGATGG - Intronic
1117903929 14:60565091-60565113 TTTTTTTTAGAGATGGGGGTTGG - Intergenic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118071229 14:62248673-62248695 CTGATTTTATAGGTTTGGGAAGG + Intergenic
1118213302 14:63785926-63785948 TTGGTTGTATAGATGGGGTATGG - Intergenic
1118270933 14:64341439-64341461 CTAGTTTTAAAGATGGAGGAAGG + Intergenic
1118373306 14:65156174-65156196 ATCTTTTTATAGATGAGGAAAGG + Intergenic
1118720036 14:68587410-68587432 CTCCATTTATAGCTGGGGGAGGG - Intronic
1119206255 14:72796200-72796222 CTCCTTTTATAGATGGGGAAAGG - Intronic
1119312473 14:73660507-73660529 CTGTTTCTATAAATTTGGGATGG - Intronic
1119368774 14:74119798-74119820 CAGTTTTTAAAGATGGGCAATGG - Intronic
1119373444 14:74167706-74167728 TTTTTTATAGAGATGGGGGAGGG + Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119906160 14:78304010-78304032 CTGATTTTAGATATGGGGGGAGG + Intronic
1119941752 14:78648802-78648824 CTGTTTTTCTACATGTGGAATGG + Intronic
1120352395 14:83379462-83379484 GTGTTTTTTTAGAGAGGGGAGGG + Intergenic
1120619765 14:86749529-86749551 CTGTCTTTCTAGATTGGGGAAGG + Intergenic
1121403362 14:93702348-93702370 CTGTGTTTATAAATGGAGTATGG - Intronic
1122040513 14:98984542-98984564 TCCATTTTATAGATGGGGGAAGG + Intergenic
1122349967 14:101083437-101083459 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1202873593 14_GL000225v1_random:188230-188252 ATTTTTTTAGAGATGGGGGCAGG + Intergenic
1123680455 15:22759084-22759106 CTGTTTTTGTAGATCGTGCAGGG + Intergenic
1124889918 15:33723262-33723284 CTGTTTTTACAAATGAGGTATGG - Intronic
1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG + Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127397143 15:58552058-58552080 CTGTTTTTAAGGGAGGGGGAGGG + Intronic
1128047855 15:64634883-64634905 CTGTTGTTTTTGGTGGGGGAGGG - Intronic
1128723894 15:69973775-69973797 CTGATTTCACAGATGGGGGCAGG - Intergenic
1129643829 15:77411780-77411802 CTTTTTGTAAAGATGGGGGTTGG + Intronic
1130604407 15:85302308-85302330 CTGTTTTTAGAGCTGTGGAAAGG - Intergenic
1130971425 15:88736592-88736614 CTTTCTTTATAGGTGTGGGAAGG - Intergenic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1132497057 16:268915-268937 CTGGTTTTAGAGATGGGGATGGG + Exonic
1132609368 16:807592-807614 CTGCATTTAGAGAAGGGGGATGG + Exonic
1132828424 16:1916329-1916351 CTCATTTTTTAGAAGGGGGAGGG - Intronic
1132879657 16:2156409-2156431 CTGTCTGTCTAGATGGGGGATGG - Intronic
1133265387 16:4580311-4580333 CTGTTTATATGGGTGGGGGGGGG - Intronic
1133503020 16:6383465-6383487 CTGTTTTTCTAGAAGGGGCTTGG - Intronic
1133625798 16:7569395-7569417 CTGATTTTGAAGATGGGGAAAGG - Intronic
1134445158 16:14325481-14325503 TTGTTTTTTTTGGTGGGGGAGGG - Intergenic
1134534775 16:15017244-15017266 CAGTTTTTATGAATGGAGGAGGG + Intronic
1135109649 16:19680912-19680934 CTGTTTTTTTAGGGGGGGGGCGG - Intronic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135691546 16:24541045-24541067 CTGTTTTTTAAAATGAGGGAGGG + Intronic
1135763576 16:25157374-25157396 TTATTTGTATAGATGGGGGGTGG - Intronic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1136099673 16:27984619-27984641 TTTTTTTTCTAGATAGGGGAAGG + Intronic
1136138717 16:28275151-28275173 TTTTTTGTAGAGATGGGGGAGGG - Intergenic
1136363573 16:29797526-29797548 CTGTTTTTCTAGGCGGGGGCTGG + Intronic
1136705710 16:32186819-32186841 CTGTTTTTGTAGATCGTGCACGG - Intergenic
1136739857 16:32508426-32508448 CTGTTTTTATAGAATTGCGAAGG - Intergenic
1136762203 16:32742590-32742612 CTGTTTTTGTAGATCGTGCACGG + Intergenic
1136805896 16:33127796-33127818 CTGTTTTTGTAGATCGTGCACGG - Intergenic
1137320384 16:47374753-47374775 TTGTTTTTTTAAATGGGGCAAGG - Intronic
1137819887 16:51434126-51434148 CTGTTTTTATTGGAGGGGGAGGG + Intergenic
1138390667 16:56668085-56668107 CTGTTTTTATAGTCAGGAGACGG + Intronic
1138505494 16:57476342-57476364 CCCATTTTATAGATGGGGAAAGG + Intronic
1138657819 16:58500976-58500998 CTTATTTTGTAGGTGGGGGAAGG + Intronic
1139114811 16:63936984-63937006 TTGTATTTATAGTTGGTGGAGGG - Intergenic
1139861265 16:70023532-70023554 CAGTTTTTATGAATGGAGGAGGG - Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1141189956 16:81817267-81817289 CCCATTTTATACATGGGGGATGG - Intronic
1203013054 16_KI270728v1_random:318911-318933 CTGTTTTTATAGAATTGCGAAGG + Intergenic
1203031389 16_KI270728v1_random:592070-592092 CTGTTTTTATAGAATTGCGAAGG + Intergenic
1203040332 16_KI270728v1_random:742361-742383 CTGTTTTTATAGAATTGCGAAGG - Intergenic
1203064360 16_KI270728v1_random:1002907-1002929 CTGTTTTTGTAGATCGTGCACGG + Intergenic
1143994133 17:10992062-10992084 CTGTTTCTATAGGTCTGGGATGG - Intergenic
1145005985 17:19338107-19338129 TTGTTGTTATTGTTGGGGGAAGG - Intronic
1145193769 17:20869177-20869199 GTGTTTTGATAGATGGAGGGGGG + Intronic
1145201380 17:20948302-20948324 TTATTTTTAGAGATGGGGGGGGG + Intergenic
1145298258 17:21611962-21611984 GTGTTTTGATAGATGGAGGGGGG - Intergenic
1145351992 17:22091404-22091426 GTGTTTTGATAGATGGAGGGGGG + Intergenic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1146066827 17:29642596-29642618 CTGTTTTTATAGATGGGGGATGG - Intronic
1146510424 17:33443379-33443401 CTTTTTTTATGTATGGTGGAGGG + Intronic
1146736795 17:35244869-35244891 CTTTTTTTATGGTGGGGGGAGGG - Intronic
1146938621 17:36828040-36828062 TTGTTTTTTTGGAGGGGGGAGGG + Intergenic
1147343327 17:39768935-39768957 CTGTTTTTAACAAAGGGGGAAGG - Intronic
1147357166 17:39907162-39907184 CTGTTTTTGAGGATGTGGGAAGG - Intronic
1147666064 17:42149010-42149032 CTGTTCTTATACATAGAGGATGG + Intronic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1151144864 17:72031125-72031147 CTGTTTTTATACATCAGGAAGGG + Intergenic
1151973059 17:77468947-77468969 CTGTTCACTTAGATGGGGGATGG + Intronic
1153320161 18:3765043-3765065 CTGTTTATGTAGGTGGTGGATGG + Intronic
1154503979 18:15015907-15015929 CTATTTTTATAGATGAGAAATGG + Intergenic
1155653147 18:28164847-28164869 CTGTCTTTATAATTAGGGGAAGG - Intronic
1156121539 18:33848603-33848625 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1156708455 18:39912522-39912544 CAGCTTTTCTAGATAGGGGATGG - Intergenic
1157682180 18:49615820-49615842 CTGTTTTAATCAATGGGGGTTGG + Intergenic
1157802224 18:50630063-50630085 CTGTGTTGGGAGATGGGGGAGGG + Intronic
1158495535 18:57951979-57952001 CTGGTTTTATACATGGAAGAGGG - Intergenic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1160522991 18:79519509-79519531 TTGTTTGTAGAGATGGGGGGTGG + Intronic
1161204461 19:3033838-3033860 CTTTTTGTAGAGATGGGGGGTGG - Intronic
1161423611 19:4189798-4189820 TTCATTTTATAGATGAGGGAGGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1162697310 19:12486254-12486276 ATTTTCTTAGAGATGGGGGAGGG - Intronic
1163529297 19:17840454-17840476 CTGATTTTATAAATGGGGGGAGG - Intronic
1164505236 19:28854754-28854776 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1164604502 19:29587742-29587764 CTGTTTTCATAGCTGGTGGCAGG + Intergenic
1164720212 19:30426419-30426441 GTGTGTTTTTATATGGGGGAAGG + Intronic
1165488932 19:36112199-36112221 TTGTTTTTTTTGAGGGGGGATGG - Intronic
1165584242 19:36899265-36899287 CTGTTTATAGAGATCGGGGGGGG - Intronic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1167459545 19:49617329-49617351 CTCATTTTAAAGATGGGGGCTGG + Intronic
1168441554 19:56372017-56372039 CTGTTGTTACAGATGGTGCAAGG + Intergenic
1168495347 19:56843220-56843242 CTGTTTATAGAAATGGGGAAAGG - Intergenic
925170758 2:1749058-1749080 CTGTATTTAAGGATGGGGTAGGG - Intergenic
926499019 2:13629318-13629340 CTATATTTGTATATGGGGGATGG + Intergenic
927223188 2:20734572-20734594 ACGATTTTATAAATGGGGGAGGG - Intronic
927790347 2:26004677-26004699 CTGTTTCTTAACATGGGGGATGG - Intergenic
928742827 2:34375774-34375796 TTGTTTTTTTGGGTGGGGGAGGG + Intergenic
929187831 2:39113500-39113522 CAGATTTTAGAGTTGGGGGAGGG + Intronic
929403580 2:41613895-41613917 CTGTTTGTATACATGGTGGCTGG - Intergenic
929434611 2:41918944-41918966 TTGTTGGTATAGATGGAGGATGG + Intergenic
929455372 2:42061289-42061311 CTGTTGTCATGGATGGGGGGTGG - Intergenic
930685538 2:54303353-54303375 CTTTTTTTTTGGAGGGGGGAGGG - Intronic
931271518 2:60707967-60707989 TTGTTTTTAAAGAAGTGGGATGG - Intergenic
931895962 2:66729927-66729949 TTTTCTTTATAGATGGAGGAGGG + Intergenic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
932823047 2:74917488-74917510 ATGTTTTTAGAGACAGGGGAAGG - Intergenic
933018131 2:77157242-77157264 CAGTTTTTATAAATGGGGAAGGG + Intronic
933406621 2:81868151-81868173 TTGATTTTATTGATGGGAGAAGG + Intergenic
934161454 2:89253383-89253405 CAGTTTTCATAGAAGGGGTAAGG - Intergenic
936711002 2:115131175-115131197 CTATTTTCATAGATGTTGGAAGG - Intronic
937945166 2:127327699-127327721 TTGTTTTTATAAAAGGGAGATGG - Intronic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938503164 2:131846092-131846114 CTATTTTTATAGATGAGAAATGG + Intergenic
940296718 2:152133396-152133418 CTGTTTATATAGATGAGGTAGGG - Exonic
941225569 2:162842714-162842736 CTTTTTCTATAGATGGGGTCTGG + Intergenic
941655368 2:168138013-168138035 CTTTGTTTGTAGATGGGGAAAGG - Intronic
944021329 2:195108027-195108049 CTCATTTTCTAGATGGGGCATGG - Intergenic
944227588 2:197363711-197363733 TTTTTATTAGAGATGGGGGAAGG - Intergenic
945635739 2:212347976-212347998 CTATTTTTATATATGTTGGATGG + Intronic
946029491 2:216693420-216693442 CTGGTTTAAGAGATTGGGGAGGG + Intronic
948715859 2:239862787-239862809 CTGGTTTCGAAGATGGGGGAAGG + Intergenic
1168762786 20:360718-360740 ATATTCATATAGATGGGGGAGGG + Intergenic
1169510516 20:6259082-6259104 TTACTTTTATAGATGGGGAAAGG + Intergenic
1170129583 20:13004562-13004584 CTGACTTTGAAGATGGGGGAAGG + Intergenic
1170974196 20:21146720-21146742 TTGTTTTTATAGTAGGAGGAAGG + Intronic
1172006506 20:31822104-31822126 CCCTTTTGATAGATGGGGAAAGG + Intronic
1172706576 20:36886611-36886633 TTTTTTTTAGAGATAGGGGAGGG + Intronic
1173729733 20:45319873-45319895 TTTTTTGTAGAGATGGGGGAGGG - Intergenic
1174236439 20:49097087-49097109 CTTTTTTTTTATATGGGGGAAGG + Intergenic
1174346178 20:49931856-49931878 TTTTTTGTAGAGATGGGGGAGGG + Intergenic
1174465674 20:50715369-50715391 CTGATTTTAAAGATGGAGGTGGG + Intergenic
1175774228 20:61642820-61642842 CTGGCTTCAGAGATGGGGGAAGG - Intronic
1175777320 20:61661535-61661557 CTTTTTTAATAGCTGGAGGAAGG + Intronic
1175831323 20:61966642-61966664 CTGTTTTCATGGTTGGGGGCAGG - Intronic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1177350442 21:19932600-19932622 GTGTATTTATAGAAGGGTGAGGG + Intergenic
1177429388 21:20971168-20971190 ATGTTTTTTAAAATGGGGGAGGG + Intergenic
1178242504 21:30918894-30918916 CTGTTGTTAGAAATGTGGGAGGG - Intergenic
1179034143 21:37745430-37745452 CTGGTTTTGAAGATGTGGGAAGG + Intronic
1179046763 21:37851543-37851565 CTGTTTGGATAGAGGAGGGAAGG + Intronic
1182017051 22:27049467-27049489 CTGGTCTGATAGATGGGGAACGG - Intergenic
1182032742 22:27172706-27172728 TTGTTATAAAAGATGGGGGAAGG - Intergenic
1182972766 22:34593332-34593354 CTGTTTTTGTGGCTGGGGGATGG - Intergenic
1183991157 22:41597837-41597859 TGGTTTATAAAGATGGGGGAAGG - Intergenic
1184068624 22:42135035-42135057 TTGTTTTTTTGGGTGGGGGATGG - Intergenic
949107676 3:220137-220159 TTGTTTTTAAAGACTGGGGAGGG + Intronic
949587957 3:5461470-5461492 ATGCTTTTAGAGATGGGGGTGGG - Intergenic
950307200 3:11925152-11925174 CAATTTTTATAGAGAGGGGAGGG - Intergenic
951305703 3:21058574-21058596 CTTTTTTTTTCGATGGGGGTTGG + Intergenic
951618883 3:24579263-24579285 CTGTTTTTCTGGTTGGTGGAGGG + Intergenic
951712220 3:25594826-25594848 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
951921619 3:27860793-27860815 CCAATTTTATAGAAGGGGGAGGG + Intergenic
952674955 3:36017575-36017597 CTGTTTTTTTAAATGGGCAAAGG - Intergenic
952742444 3:36747860-36747882 CTGTTTTTGTAAATTGGGGGTGG - Intergenic
952917056 3:38254598-38254620 CTTTTTTTGTGGAGGGGGGACGG + Exonic
952923138 3:38300988-38301010 GTTTTTTTAGAGATGGGGGTTGG + Intronic
953082058 3:39630052-39630074 CTGCTTTTATGGCTGTGGGATGG - Intergenic
953817964 3:46177287-46177309 CTGCCTTGCTAGATGGGGGAAGG + Intronic
955234112 3:57124507-57124529 CTGGTTTTGTGGATGGAGGAAGG + Intronic
955671861 3:61410763-61410785 ATGTTTTTAGAGACGGGGGGGGG - Intergenic
955720581 3:61876265-61876287 AACTTTTTATAGATTGGGGAGGG + Intronic
956283349 3:67582860-67582882 GTGTTTTTTTTGGTGGGGGAGGG - Intronic
956696961 3:71926703-71926725 CTGTTTCTAAAGATGTGGGCAGG + Intergenic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957297503 3:78352016-78352038 CTCTTTTTACAGTTGGGGGTGGG - Intergenic
957336358 3:78834178-78834200 CAGTTTTTATAGATAATGGAAGG + Intronic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
960394328 3:117117790-117117812 CATTTTTTATTGCTGGGGGAGGG - Intronic
961658261 3:128454946-128454968 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
962377044 3:134867058-134867080 ATGTTTGTATAGATGGGAGGGGG + Intronic
965221003 3:165925348-165925370 CTGATTTTGAAGATGGGGAAAGG + Intergenic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
965596200 3:170413818-170413840 TTTTTTATAGAGATGGGGGAGGG - Intergenic
966148429 3:176838930-176838952 CTTTTCTCATAGGTGGGGGACGG + Intergenic
966423709 3:179758892-179758914 CAGTGGTTATAGATGGGTGATGG - Intronic
966995942 3:185280707-185280729 CTGTTTTAATAGAAGGGGCAGGG + Intronic
969065305 4:4474706-4474728 CTGGTTTTGAAGATGGGGAAAGG + Intronic
969219523 4:5750821-5750843 ATGTTTGTATAGAAGAGGGATGG + Intronic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
974637381 4:64582644-64582666 CTGTTTTCCCACATGGGGGAAGG + Intergenic
974776504 4:66490004-66490026 ATGTTTTTATAGTTGGGGAAGGG + Intergenic
975282697 4:72579992-72580014 TTGTTTTTATTTATGGGGAATGG - Intergenic
976997544 4:91454348-91454370 CTGGCTTTAAAGATGGGGGAAGG - Intronic
977092033 4:92689666-92689688 ATGTTTCTAAAGATGGGGGTGGG - Intronic
977277067 4:94990918-94990940 CTGTTTTCATAGAAGGTGGGAGG - Intronic
977715248 4:100174922-100174944 CTGATTTCATGGATGTGGGAGGG + Intergenic
977784779 4:101020053-101020075 CTGTGTTTATAGAGAAGGGAAGG - Intergenic
977922730 4:102663281-102663303 CTAATTTTATAGATGGGAAAAGG + Intronic
978727749 4:111989943-111989965 CTTTTATTGTAGTTGGGGGATGG - Intergenic
981254493 4:142645568-142645590 CTGTTTTTCTAAAAGTGGGAAGG - Intronic
982846027 4:160253386-160253408 CTAATTTTAAAGATGAGGGAGGG - Intergenic
983040859 4:162924043-162924065 ATGTTTCCATAGATGGGGGTGGG - Intergenic
983365283 4:166778834-166778856 CTGTTTTTTAAGTTGGGGGTAGG + Intronic
983884805 4:172968505-172968527 CTTTTTTTGTAGAGGGAGGAGGG - Intronic
986084303 5:4428333-4428355 CTGTGTTAATAGATCAGGGAAGG - Intergenic
986391452 5:7291057-7291079 CTGTTTTTGTAGATCGTGCAGGG + Intergenic
986408014 5:7446638-7446660 TTGTTTTTATAGGTGAGAGAGGG + Intronic
987414499 5:17648862-17648884 CTGTATTTTTGTATGGGGGAGGG + Intergenic
988798406 5:34673859-34673881 GGGTTTTTAGAGTTGGGGGAGGG - Intronic
988949102 5:36240626-36240648 CTGTTTTTAAAGTTGGTGGGGGG + Intronic
989115832 5:37951565-37951587 TTTTTTTTTGAGATGGGGGAGGG + Intergenic
989518053 5:42366219-42366241 CTGTTTTCATAGGTGTGGGAGGG + Intergenic
989840684 5:46063773-46063795 CTGTTTTTATAGAATCTGGAAGG + Intergenic
989967219 5:50478598-50478620 CAGGTTTTATAGAAGGGGGAAGG + Intergenic
991611201 5:68451139-68451161 CTCTTTTTTTGGAGGGGGGAGGG - Intergenic
992408266 5:76480093-76480115 CTGTTTGTGTAGGTGGGGGCTGG + Intronic
993342511 5:86741750-86741772 CTGTCTTTAAAGATAGTGGAAGG + Intergenic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
993462360 5:88199420-88199442 CAGTTTTTATCCATGGAGGAGGG - Intronic
993686220 5:90941586-90941608 CTGTATTTTTGGTTGGGGGATGG - Intronic
994214577 5:97123270-97123292 CTTTTTTTTTGGATAGGGGAGGG + Intronic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
995167051 5:109055897-109055919 CTGTTTTTAAAAATGGGCAAAGG + Intronic
995704867 5:114977844-114977866 CTGATTTTATAAATGGGCAAAGG + Intergenic
995711258 5:115038139-115038161 CTGTTTTAATAGAAGATGGAAGG + Intergenic
995740882 5:115354626-115354648 CGGTTTTTATGGATGCAGGACGG + Intergenic
996092096 5:119361436-119361458 ATGGTTTTGAAGATGGGGGAGGG + Intronic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996774991 5:127123018-127123040 CTACTTTTATACGTGGGGGAGGG + Intergenic
996776211 5:127135465-127135487 GTGTGTTTATATATGGGGGAGGG - Intergenic
998463365 5:142325149-142325171 CTTTTTTTATGAATGGGGGGCGG + Intronic
998765974 5:145487716-145487738 CATTTTTTAGAGATGGAGGAAGG + Intronic
999032473 5:148309023-148309045 GTGATTTTATAGATAGGGAATGG - Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1002247835 5:177899777-177899799 GGGTTTTTATGGATAGGGGATGG - Intergenic
1002684800 5:181001487-181001509 ATATTTTTATAGATGGGGGGGGG + Intronic
1004676337 6:17846317-17846339 CTCTTTTTAAAGATGAGGAAAGG - Intronic
1005459815 6:26057126-26057148 CTCTTTTCATAGATGGGGGTGGG + Intergenic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006468831 6:34214082-34214104 TTTTTTGTAGAGATGGGGGAAGG - Intergenic
1007756837 6:44104936-44104958 CTATTTTAATAGCTGAGGGAAGG + Intergenic
1009251676 6:61308902-61308924 CTGTTTTTGTAGATCTGTGAAGG + Intergenic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1010025337 6:71209029-71209051 TTATTTTTAGAGATGGGTGAGGG - Intergenic
1010123977 6:72411713-72411735 TTTTTTTTAGAGATGGGGGTCGG + Intergenic
1013991363 6:116257887-116257909 CTAATTTTATGGATGGGGGCAGG - Intronic
1014291461 6:119563312-119563334 CTGTCTTTAAAGATGGTGCATGG - Intergenic
1014376576 6:120682531-120682553 ATGTTTTTATAAATGGTGTAAGG - Intergenic
1014734716 6:125078877-125078899 CTATTTGTGGAGATGGGGGAGGG - Intronic
1015379342 6:132548930-132548952 CTGGTTTTATGAATGGAGGAAGG + Intergenic
1015630911 6:135231007-135231029 TTGTTTTTGTAGATGGGGTGGGG - Intergenic
1015727529 6:136314730-136314752 CTTTTTTTTTTGGTGGGGGAGGG - Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016509035 6:144819299-144819321 ATGTTTTGATAGAAGGGGAATGG + Intronic
1016601525 6:145866886-145866908 CTGTGCTGATTGATGGGGGAAGG + Intronic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1019713498 7:2528014-2528036 CTGTTTTTTTTGAAAGGGGATGG + Exonic
1020016993 7:4836932-4836954 CTGTTTTTTTTGGCGGGGGATGG - Intronic
1020743789 7:12055523-12055545 CTGTCTTTAGAGAGTGGGGATGG - Intergenic
1020772556 7:12413392-12413414 CTGGTTTTAAAGATGAAGGAAGG - Intergenic
1023569808 7:41560295-41560317 TTGTGTTTCTAGAAGGGGGAGGG + Intergenic
1024402383 7:48939835-48939857 CTGGTTTAATAGATCAGGGATGG + Intergenic
1026550310 7:71362895-71362917 CTGTATTTAGAGTTGGGGAAAGG - Intronic
1026823220 7:73563887-73563909 TTTTTTTTAGAGATGGGGGGGGG + Intergenic
1027554271 7:79643625-79643647 CTATTTTTATATATGGTGAAAGG + Intergenic
1027990082 7:85347390-85347412 CTCTATTTATCGATGGTGGATGG + Intergenic
1028593088 7:92519234-92519256 CTGTTTTGAGAGATGGGGCCTGG + Intronic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029061968 7:97807531-97807553 CTTTTTTTTTTGGTGGGGGAGGG - Intergenic
1030052427 7:105550452-105550474 CTGTTTTCAGAGATGGTTGACGG + Exonic
1031470304 7:122160484-122160506 CTTTTATTAAAGATGGTGGATGG - Intergenic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1035675503 8:1452869-1452891 CTGTTTTTGTAAAAGGGGGGTGG + Intergenic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037354320 8:18000612-18000634 CTGTTTTTTTTGAGGGGGGTGGG + Intronic
1037643016 8:20765463-20765485 CTGCTTCTATAGATTGGGAAGGG + Intergenic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1042164470 8:65932286-65932308 ATGTTTTTAAAAATGGGGGGAGG + Intergenic
1042559311 8:70061080-70061102 CTGTTTTTATCAATGGAGGAGGG + Intronic
1042853786 8:73243532-73243554 CTTTTTTTTGAGATGGAGGATGG + Intronic
1043237755 8:77890289-77890311 TTTTTTTTTTAGATTGGGGATGG - Intergenic
1043363968 8:79510161-79510183 CTGAATTTAGAGAAGGGGGAGGG - Intergenic
1043559498 8:81474443-81474465 CTGGTTTTATCCATGGGGGTTGG + Intergenic
1043872447 8:85449124-85449146 TTGTTTTTATAGCTGAAGGATGG + Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044246982 8:89959830-89959852 CTCATTTTATAGATGAGGAAAGG - Intronic
1044378771 8:91507010-91507032 CTCTTTTGAAAGATGGAGGAGGG - Intergenic
1045139401 8:99263580-99263602 CTGGCTTTAGAGATGGGGGAAGG - Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1046124298 8:109884885-109884907 CTGGTGTTAAAGATGGAGGAAGG - Intergenic
1047677256 8:127216281-127216303 TTCCTTTCATAGATGGGGGAAGG - Intergenic
1048370922 8:133775488-133775510 CTCATTTTATAGATGAGGAAAGG - Intergenic
1048675613 8:136775797-136775819 CTGGTTTTAAAGTTGAGGGAGGG + Intergenic
1048937927 8:139372373-139372395 CTGGATTTGCAGATGGGGGAAGG - Intergenic
1048974754 8:139664911-139664933 TTTTTTTTATTGCTGGGGGAGGG - Intronic
1049920187 9:355942-355964 ATTTTTTTCTAAATGGGGGAAGG - Intronic
1051484099 9:17589646-17589668 CTGTTTTTGTGCTTGGGGGAAGG + Intronic
1055884343 9:81042133-81042155 CTGTTTTTATGCAGAGGGGATGG - Intergenic
1057598772 9:96439098-96439120 CTGTTAATAATGATGGGGGAGGG + Intergenic
1057648104 9:96895895-96895917 CTGTTTTTCTAGATAGAGGCAGG - Intergenic
1057913562 9:99038497-99038519 CTGTTTTATAAGAAGGGGGAGGG + Intronic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1059949866 9:119451090-119451112 CTGGTTTTAAAGGTGGAGGAAGG - Intergenic
1060033407 9:120234783-120234805 CTGATTTTGTAGATGGGGAATGG - Intergenic
1060757426 9:126223584-126223606 CTGCTTTCACAGATGAGGGACGG - Intergenic
1060957194 9:127650612-127650634 CTGTTTTTAGAGCTTGAGGAGGG + Intronic
1061692433 9:132344387-132344409 TTTTTTGTAGAGATGGGGGAGGG + Intronic
1203730863 Un_GL000216v2:88307-88329 ATTTTTTTAGAGATGGGGGCAGG - Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186965727 X:14784415-14784437 CTGGTTTTGGAGATGGGAGAAGG - Intergenic
1187056843 X:15748727-15748749 TTTTTTTTAGAGATGGGGGTTGG - Intronic
1188669115 X:32861514-32861536 CTGTTTATAAAAATGAGGGAAGG + Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189288008 X:39865939-39865961 GTTTTTTTTTAGGTGGGGGAGGG - Intergenic
1189343139 X:40219778-40219800 TTTTTTGTAGAGATGGGGGAGGG + Intergenic
1189408008 X:40743337-40743359 CTGTTTTTATAGCATGAGGATGG + Intergenic
1189909958 X:45800707-45800729 CTGTTTTAAAAGATGGGGCAGGG + Intergenic
1190021723 X:46884564-46884586 CTTTTTTTGTAGATGGGGTGGGG + Intergenic
1190235992 X:48616243-48616265 TTTATTTTAGAGATGGGGGAGGG + Intergenic
1190738017 X:53268465-53268487 CTGTTTTTATAGATGAGGAATGG - Intronic
1190871635 X:54429743-54429765 CTGGTTATACAGATGGGAGAAGG - Intergenic
1191817442 X:65262548-65262570 TTGTTTTTATAGTAGGGAGATGG - Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1192631170 X:72778965-72778987 ATCTTTTTATATTTGGGGGAGGG - Intronic
1192650539 X:72941836-72941858 ATCTTTTTATATTTGGGGGAGGG + Intronic
1193572398 X:83160654-83160676 CTGTCTTTATTTTTGGGGGAAGG - Intergenic
1195410370 X:104563880-104563902 TTTTTTTTCTGGATGGGGGATGG - Intergenic
1195599094 X:106726259-106726281 CTGATTCTCTAGAGGGGGGAAGG - Intronic
1196015011 X:110930012-110930034 TTTTTTTTATATATGGGGTAAGG - Intergenic
1196016767 X:110947859-110947881 CTCATTTTAAAGAGGGGGGAAGG - Intronic
1196049134 X:111287004-111287026 CTGTTTTTAAAAATGTGGGCTGG - Intergenic
1196396480 X:115268024-115268046 GTGTTTATATGTATGGGGGAGGG - Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1197699715 X:129589822-129589844 CTGTTTTTAAAAATAGGGGCAGG - Intronic
1197788273 X:130222836-130222858 GTATTTTTAGAGATGGGGCAGGG + Intronic
1198775879 X:140178555-140178577 CTGTTTTCAAAGATGGGGCGGGG - Intergenic
1199923208 X:152431790-152431812 CTGACTTTGAAGATGGGGGAAGG + Intronic
1201595838 Y:15667816-15667838 CTGTCTTTCTAGGTTGGGGAAGG + Intergenic