ID: 1146069136

View in Genome Browser
Species Human (GRCh38)
Location 17:29663257-29663279
Sequence TTGCCTCTCTTTACTCAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146069134_1146069136 -1 Left 1146069134 17:29663235-29663257 CCAAAGGGAAGGAGAAATCCTGT 0: 1
1: 0
2: 0
3: 30
4: 263
Right 1146069136 17:29663257-29663279 TTGCCTCTCTTTACTCAATCTGG 0: 1
1: 0
2: 2
3: 8
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146069136 Original CRISPR TTGCCTCTCTTTACTCAATC TGG Intronic
906456441 1:46001281-46001303 ATGCCTCTATTTCCTCTATCTGG - Intronic
907841868 1:58166065-58166087 TTGCCTCTCTGTACTTAAAGAGG + Intronic
908381011 1:63596598-63596620 TTCACTCTCTCTACTCACTCGGG + Intronic
910035941 1:82788937-82788959 TTGCCTCTCTTTTCTCTCCCTGG + Intergenic
912625375 1:111201611-111201633 TTCCCTGTATTTACTCATTCAGG - Intronic
914256336 1:145963016-145963038 TTGCCTCTCTTTGCACAGTATGG - Intronic
915862519 1:159461288-159461310 TTTCTACTCTTTACTCAAACTGG - Intergenic
916456382 1:164974989-164975011 TTCCTTCTGTTTATTCAATCGGG + Intergenic
924190326 1:241544975-241544997 TTGTCTCTTTTTACTAAATAGGG + Intronic
924440785 1:244083464-244083486 TTCCCTCTCCTTCCTGAATCTGG - Intergenic
1066748627 10:38629649-38629671 TTGCCTCCCTTTCATTAATCAGG - Intergenic
1066968045 10:42288128-42288150 TTGCCTCCCTTTCATTAATCAGG + Intergenic
1068288764 10:54973947-54973969 GTGCCTTTATTTACTAAATCAGG + Intronic
1073068363 10:100777921-100777943 TTGCCTGTCTCCACTCATTCTGG + Intronic
1075758520 10:124836709-124836731 TTGCCTCAGTGTACTCATTCTGG + Intergenic
1077967831 11:7154854-7154876 TTGCCTCTCTTAACTTCATGGGG + Intergenic
1081796051 11:45820684-45820706 TTGCCTTTCCTTACTCACGCTGG - Intergenic
1085425482 11:76400817-76400839 TTATCTCTCTTTACTCCATTTGG + Intronic
1085707322 11:78798483-78798505 TTGGCTCTCTCAACTCAATCTGG - Intronic
1086718007 11:90086656-90086678 TTGCATCTCTTTACTTGACCAGG - Intergenic
1089859391 11:121575362-121575384 TTCCCTCTCATGCCTCAATCTGG - Intronic
1090592425 11:128286727-128286749 TTGCCTCTATCTAGTCATTCAGG + Intergenic
1092246423 12:6866850-6866872 TTCCCTCTCTTTATTCACACAGG + Intergenic
1095196351 12:39323168-39323190 TTGCCTCAGTTTCCTCAATTTGG - Intronic
1095223750 12:39653467-39653489 TTACCTCTCTCTTTTCAATCTGG + Intronic
1095993087 12:48051953-48051975 TTGCCTCTATTTGCTCACTGTGG + Intronic
1100914692 12:99406769-99406791 TTATCTCTCTTTTCTTAATCTGG - Intronic
1101110323 12:101480284-101480306 TTGCTTCTCCTTAGTCCATCTGG + Intronic
1105606917 13:21933548-21933570 TTGACACTCTTTGCTGAATCAGG + Intergenic
1105655544 13:22433529-22433551 TTGTCTCTCTTGAGTCAATGAGG - Intergenic
1106579385 13:31004387-31004409 TTGCCTCTGTTTCCTCAAGACGG + Intergenic
1107282002 13:38747119-38747141 TCGCCTCCCTTTTCTCAATATGG - Intronic
1110901498 13:80831115-80831137 TTGCTCCTCTTTTCTCAAGCAGG - Intergenic
1113852006 13:113423210-113423232 TTGCCTCTCTGCACTCCAGCCGG + Intronic
1114443669 14:22771250-22771272 TTGCTTCTCTTTACACAGGCTGG + Exonic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1119163508 14:72472850-72472872 CTTCCTCTCTTTACTCTTTCAGG + Exonic
1120022558 14:79547134-79547156 TTCCCCCTCTACACTCAATCTGG + Intronic
1127203386 15:56684078-56684100 CTGCTTCTCTGTACTGAATCAGG - Intronic
1131238783 15:90720066-90720088 TTGCCTGTTTTTCCTTAATCTGG + Intronic
1134769075 16:16789683-16789705 TTTCCTCTCATTAATCAGTCTGG + Intergenic
1134789202 16:16973232-16973254 TTGCCTCTCTCTACTGAGTGGGG + Intergenic
1136734126 16:32447650-32447672 TTGCCTCCCTTTCATTAATCAGG + Intergenic
1138974772 16:62190983-62191005 TTGTCTTTCTTTTTTCAATCTGG - Intergenic
1140908452 16:79429928-79429950 TTTCCTCTCTTTGCTCCACCCGG - Intergenic
1203018951 16_KI270728v1_random:381945-381967 TTGCCTCCCTTTCATTAATCAGG - Intergenic
1203037286 16_KI270728v1_random:655103-655125 TTGCCTCCCTTTCATTAATCAGG - Intergenic
1146069136 17:29663257-29663279 TTGCCTCTCTTTACTCAATCTGG + Intronic
1152275227 17:79352693-79352715 TTGCCTTTCTTCACTCACTGTGG - Intronic
1153761282 18:8334653-8334675 TTGCCTCTCATTAATCAATACGG + Intronic
1155076569 18:22362325-22362347 TTGGGTCTCTTTAGTCTATCAGG - Intergenic
1155126625 18:22883857-22883879 TTACCTCTCTTTTCCCAGTCAGG - Intronic
1156037697 18:32784106-32784128 TTGCCTCTCATCACTCAACTGGG - Intergenic
1156575745 18:38313217-38313239 TTGCTTCTCTTCACTGCATCTGG - Intergenic
1156763856 18:40627429-40627451 TTGCATCTGCTTACTCAATAGGG + Intergenic
1157712161 18:49857637-49857659 TTACCACTTTTTACTCAATTTGG + Intronic
1159795589 18:72839211-72839233 TTGCTTCTTTTTACTCATACTGG - Intronic
1165172715 19:33905581-33905603 ACGCCTTTCTTTCCTCAATCCGG - Intergenic
926627867 2:15108455-15108477 TTTCCTCTATTGACTCAAGCAGG + Intergenic
926650197 2:15335395-15335417 TTGGCACTATTTACTAAATCTGG - Intronic
926856645 2:17263739-17263761 TTGCCTCTTCTTAATCACTCAGG - Intergenic
929570071 2:43017171-43017193 TTGCCTCTCTCCACTCAAAGTGG + Intergenic
930380891 2:50626631-50626653 TTGCCTCTCTAAATTAAATCGGG - Intronic
933592150 2:84244942-84244964 TTGCCTCTTTCTAATTAATCTGG - Intergenic
934311605 2:91871776-91871798 TTGCCTCCCTTTCATTAATCAGG - Intergenic
939742028 2:145919865-145919887 TTGCTTCTGTTTACACATTCAGG - Intergenic
940560343 2:155287757-155287779 TTACCTCTGTTTTCTCAAGCAGG - Intergenic
946541142 2:220685882-220685904 CTGCCTCTCTTGACTTAATGCGG + Intergenic
946614486 2:221495029-221495051 TTGCCTCTCTTGACTGATACAGG + Intronic
947182199 2:227421252-227421274 TTTCCTCTGTTTATTCATTCAGG + Intergenic
948647209 2:239413040-239413062 TTGCCTCTCTTTGCTCGAGCAGG + Intergenic
1171568708 20:26223498-26223520 CTTCCTCTCTTTTCTCCATCTGG - Intergenic
1172909949 20:38401138-38401160 TTTCCTTTTTTTCCTCAATCTGG + Intergenic
1178002265 21:28175726-28175748 TAGTCTCTCTTTATCCAATCTGG - Intergenic
1180282215 22:10712151-10712173 CTTCCTCTCTTTTCTCCATCTGG + Intergenic
1180538357 22:16417588-16417610 TTGCCTCCCTTTCATTAATCAGG - Intergenic
1183564998 22:38608020-38608042 TTGCCTCTCTATAACAAATCGGG - Intronic
949508909 3:4751612-4751634 TTGCCTCTGATTATTCAAACAGG - Intronic
950564395 3:13758427-13758449 TTGCCTTGCATAACTCAATCTGG + Intergenic
950616775 3:14166243-14166265 CTGCCTCTCTCTCCTCACTCAGG + Intronic
953330549 3:42049575-42049597 GTCCCTCTGTTTTCTCAATCTGG + Intronic
953491044 3:43351381-43351403 TTGCTTCCCTTTATTCAATTAGG - Intronic
954933745 3:54307610-54307632 CAGCGTCTCTTTACTCAATTTGG + Intronic
955553122 3:60106299-60106321 TGACTTCTCTTTACTAAATCAGG - Intronic
956951556 3:74289351-74289373 TTGCTACTCTTTACACAAACAGG + Intronic
958116948 3:89232665-89232687 TTGCCTTTCATTATTTAATCTGG - Intronic
958471887 3:94531600-94531622 TTTCCTCTTTTTATTCTATCTGG + Intergenic
960627786 3:119698375-119698397 TTGGCTGTCTTTGCTCATTCTGG - Intergenic
964298632 3:155262367-155262389 TTTCCTCTTTTTGCTCTATCTGG + Intergenic
965057633 3:163742942-163742964 TTGCATCCCTATTCTCAATCAGG + Intergenic
965359748 3:167724126-167724148 CTGCCTTACTTTACTCCATCTGG + Intronic
965557577 3:170033848-170033870 TTGCCTCCCTGTACAAAATCTGG + Intergenic
966113244 3:176429258-176429280 ATGTTTCTCTTTACTCAAACTGG + Intergenic
966395022 3:179493616-179493638 TTTCCTCTCTCTTCTCATTCTGG - Intergenic
970974807 4:22031568-22031590 TTGCCTCTTTTCCCTGAATCAGG - Intergenic
971724842 4:30297006-30297028 TTGTCTCACCTTAATCAATCTGG - Intergenic
972779103 4:42270545-42270567 TTGCATTTCTTTGCTCAACCTGG - Intergenic
972919995 4:43927129-43927151 TTACCTCTCTCTTTTCAATCTGG - Intergenic
976113803 4:81705138-81705160 TTGACTATCCTTACTAAATCAGG - Intronic
977607521 4:98996804-98996826 GTGCCTCTCTTCACTAAACCTGG - Intronic
977634976 4:99286773-99286795 TTGCCTCTGTTTCCTCATTCAGG + Intronic
978763732 4:112382677-112382699 TTCCCTCACATTAGTCAATCTGG - Intronic
979037669 4:115746120-115746142 TTGCCTCATTTTACTAAATTGGG - Intergenic
979425363 4:120557872-120557894 TTTCCTGTCTTTTCTCAATCTGG - Intergenic
979800263 4:124899456-124899478 TTGCCTCAATTCTCTCAATCCGG + Intergenic
981424476 4:144587485-144587507 TTGTCTCTCTTTGCTAACTCTGG - Intergenic
985789662 5:1918740-1918762 CTGCCTCCCTGCACTCAATCTGG - Intergenic
988420342 5:30998361-30998383 TTGCCTCTCTTTATTCAACCCGG + Intergenic
988599595 5:32627345-32627367 TTGCCTCTCTTCAATCCCTCAGG - Intergenic
988603601 5:32661788-32661810 TTGCCTCTCTCCAGTCAAGCTGG + Intergenic
992307715 5:75460577-75460599 TTGACTCTCTCTACTGTATCTGG - Intronic
994596909 5:101850332-101850354 TTGCCTCTTTTTTCTTAGTCTGG + Intergenic
995697800 5:114899626-114899648 TTCCCTCTCTTTCCTCAAGCAGG + Intergenic
996746039 5:126846751-126846773 TTGCCTCATTTTCATCAATCTGG - Intergenic
997726251 5:136122305-136122327 TTGCCTGTTTTTACTCTATAGGG + Intergenic
998663357 5:144266241-144266263 CTGCCTAACTTTTCTCAATCTGG + Intronic
1000843663 5:166252601-166252623 TTGCCTCTCTGTATTTCATCTGG + Intergenic
1001010566 5:168094188-168094210 TTTCCTCACTTTCCTCAATCTGG - Intronic
1001171064 5:169419452-169419474 TTGTCTCTCTTTACTCCTTTAGG - Intergenic
1007913872 6:45542205-45542227 TAGCCTCTCTTTACCCAACTAGG - Intronic
1008059442 6:46981950-46981972 TGGCCTCTCTCTGCTCATTCAGG + Intergenic
1012544001 6:100395757-100395779 TTGCCTCTTTTTACTGAAATGGG - Intronic
1013142405 6:107350349-107350371 TTGCCTCTCTTGATCCAATATGG + Intronic
1016377698 6:143440480-143440502 GGGCCTCTCTTTTCTCCATCTGG + Intronic
1020228063 7:6295817-6295839 TTCCCTCTCTTTCCATAATCTGG - Intergenic
1020509612 7:9037207-9037229 ATGCCTCTTTTTCCTCAATGTGG + Intergenic
1021471307 7:21004899-21004921 TTGCCTATCTTTTCTCCTTCTGG - Intergenic
1022590944 7:31662154-31662176 TTGCCTCTGTTTATTCACCCTGG + Intergenic
1023578260 7:41653217-41653239 TGTCCTCTCTCTACTCAACCAGG + Intergenic
1023612939 7:41989659-41989681 TTAACTCTCTTTTCTGAATCTGG - Intronic
1023959235 7:44912926-44912948 GTGCCTCTATTTGCTGAATCTGG - Intergenic
1024802291 7:53094293-53094315 CTGCCTCTGTTTACTATATCTGG - Intergenic
1025971118 7:66326389-66326411 TTTCCCCTCTTTTCTCAAACTGG - Intronic
1034532504 7:151705327-151705349 TTTTTTCTCTTTTCTCAATCGGG + Intronic
1034756669 7:153628254-153628276 TGGCCTGTCTTTCCTCAATTTGG + Intergenic
1035386660 7:158477612-158477634 TTGCCTCTCTTGACCCACTTCGG - Intronic
1037509288 8:19565281-19565303 TTACCTTTACTTACTCAATCTGG - Intronic
1037509484 8:19567160-19567182 TTGCCATTTTTTACTCCATCAGG - Intronic
1041409682 8:57539781-57539803 TTGCATTTCTTTACTGAATTTGG - Intergenic
1042047003 8:64664518-64664540 TTGTCTCTCATTACTCAGTAGGG + Intronic
1042311607 8:67384348-67384370 TTGCCTCACTTTATTGAATTAGG + Intergenic
1042614505 8:70633599-70633621 TTTCCTCTATTCTCTCAATCTGG + Intronic
1042715396 8:71766455-71766477 TTTCTTCTCACTACTCAATCAGG + Intergenic
1043174390 8:77006009-77006031 TTGCATCTCTCTAATCATTCTGG + Intergenic
1043772382 8:84221528-84221550 TTACTTCTCTTTTCTAAATCTGG + Intronic
1044918063 8:97137245-97137267 TTGCCTCTCTTTTTTAAATATGG + Intronic
1045060772 8:98409046-98409068 TTGCCTCTCTCTTCTCACACAGG + Intronic
1045905257 8:107337538-107337560 TTCCCTCTCTTTACTCCTTAAGG + Intronic
1046376129 8:113383479-113383501 TTGCCTCTTTCCACTCAACCAGG - Intronic
1046400218 8:113695661-113695683 TTGCCTCACTCAACTCACTCTGG - Intergenic
1046425190 8:114038112-114038134 TTGCCTATCTTTTCTCCTTCTGG - Intergenic
1048326902 8:133446898-133446920 TTTCCTCTCTTTCCTTACTCGGG - Intergenic
1054736581 9:68757967-68757989 TTACCTCTCTTTTGTCAATTTGG - Intronic
1056297733 9:85209358-85209380 TTACTTCTCTTAACTCCATCTGG + Intergenic
1059957327 9:119531822-119531844 TTTCCTCTCTTTTCCCAATGGGG - Intergenic
1188520972 X:31037324-31037346 TTGCCTCTATTTTCTGAATCTGG - Intergenic
1189576856 X:42363137-42363159 TTGACTCTCTTCTCTCCATCTGG + Intergenic
1189929201 X:45989938-45989960 TTGCCCTTCTTTACTCAGTGGGG - Intergenic
1190568835 X:51761393-51761415 TTGCCTCTCTTTACCCAATTTGG - Intergenic
1193441048 X:81539407-81539429 TTTCCTCTTTTTTCTCAAGCAGG - Intergenic
1197535649 X:127685827-127685849 TTCTCTCTTTTTACTTAATCTGG + Intergenic
1201620527 Y:15952112-15952134 TTGCCACTGTTTACTCACACAGG - Intergenic