ID: 1146070524

View in Genome Browser
Species Human (GRCh38)
Location 17:29676827-29676849
Sequence ATTCAAACCTGTATCTGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146070524_1146070526 19 Left 1146070524 17:29676827-29676849 CCTGCACAGATACAGGTTTGAAT 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1146070526 17:29676869-29676891 TCGATACACTGAACCCACTAAGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146070524 Original CRISPR ATTCAAACCTGTATCTGTGC AGG (reversed) Exonic
903546469 1:24126872-24126894 ATTCAAAACTATATCTAGGCTGG + Intronic
907118114 1:51987438-51987460 ATTAAAACCTGTATATGGGAGGG + Intronic
907814242 1:57902611-57902633 ACTCAAAACTGTATGTGTCCTGG - Intronic
908289925 1:62655337-62655359 ACTGAAACCTGCCTCTGTGCAGG + Intronic
910463885 1:87476040-87476062 GTTCAACCCTGAATGTGTGCTGG + Intergenic
914358608 1:146910506-146910528 GTTCAACCCTGAATGTGTGCTGG + Intergenic
918715555 1:187782011-187782033 ATTAAAATCTGAATCTGTGTGGG - Intergenic
1063657163 10:8002716-8002738 ATTCAAACCTATATCTTTGCTGG + Intronic
1064025632 10:11846664-11846686 GTTCAAAGCTGTTTCAGTGCTGG - Intronic
1064976226 10:21119379-21119401 ACACAAACGTGTATATGTGCAGG + Intronic
1066447993 10:35501329-35501351 ATTCAGATCTGCATTTGTGCAGG + Intronic
1073323685 10:102630425-102630447 CCTCAAACCAGAATCTGTGCAGG - Exonic
1078544500 11:12237161-12237183 ATTCAACCCATTATCTGTGATGG + Intronic
1090098154 11:123764464-123764486 GTTCAAACATGAATCTGGGCAGG + Intergenic
1091214163 11:133890301-133890323 ATTAAAACCTGTATCACTGGTGG + Intergenic
1091304095 11:134525863-134525885 ACTCAATCCTGAATCTATGCAGG - Intergenic
1094063325 12:26338315-26338337 ATTTAAAACTGTATCTGTAAGGG - Exonic
1095384692 12:41637014-41637036 CTTCAAAGCTGTGTCTTTGCTGG + Intergenic
1095594296 12:43941017-43941039 ACACAAACCTGTATATGTGAAGG - Intronic
1097884644 12:64716806-64716828 GGTCAAACCTGTATCTGGGGAGG + Exonic
1101903642 12:108809700-108809722 ATTTAAGCCTGTGTCTGTCCAGG - Exonic
1102568598 12:113813577-113813599 ATACAAACCTGTATTTGTTTAGG - Intergenic
1107205621 13:37782930-37782952 ATTAAAAACTGTATTTTTGCAGG + Intronic
1108192437 13:47955849-47955871 TTTCAACCCTGTATCTTTTCAGG - Intronic
1109718732 13:66250154-66250176 ATTAAAACCTGTATATGTTATGG - Intergenic
1114542098 14:23468586-23468608 AATAACACCTGTATCTGGGCAGG - Intergenic
1114994257 14:28328233-28328255 ATTCAAAGGAGTGTCTGTGCTGG + Intergenic
1115110447 14:29814720-29814742 ATACAAAGCTGTATTTGTGTCGG - Intronic
1120141268 14:80932434-80932456 CTTCAAACCTCTATATGTTCTGG + Intronic
1123584558 15:21745393-21745415 ATTCAAAACTTTATCTGCCCAGG - Intergenic
1123621203 15:22188004-22188026 ATTCAAAACTTTATCTGCCCAGG - Intergenic
1129338390 15:74868239-74868261 ATTCACAGCTCTTTCTGTGCAGG + Intronic
1129746922 15:78028690-78028712 AGTCAACCCTGAATCTGGGCAGG + Intronic
1131405497 15:92160937-92160959 AATCAAACCTGTATCTCAGGGGG - Intronic
1132614606 16:833989-834011 ATTCAAACACGAATCTGTGCTGG + Intergenic
1132720412 16:1312884-1312906 ATTCAAACCTAAGTGTGTGCTGG - Intronic
1133325905 16:4942194-4942216 ATTCAAACCGAGATCTGGGCCGG - Intronic
1139739001 16:69018625-69018647 ATTTAAATCTGTATGTTTGCCGG + Intronic
1142626779 17:1197324-1197346 TTTCAAACCTCTGTCTCTGCGGG + Intronic
1144886864 17:18469051-18469073 ATTTAATCCTGCATCTGTGAAGG - Intergenic
1145145351 17:20475245-20475267 ATTTAATCCTGCATCTGTGAAGG + Intergenic
1146070524 17:29676827-29676849 ATTCAAACCTGTATCTGTGCAGG - Exonic
1146353598 17:32116140-32116162 ATTTAATCCTGCATCTGTGAAGG - Intergenic
1146937240 17:36819554-36819576 ATACATACCTGTATGTGTGCAGG + Intergenic
1147344608 17:39781139-39781161 ATTTAAACCTATCCCTGTGCTGG - Intronic
1150099591 17:62410842-62410864 ATTGAAACCAGTATCTGTAAGGG + Intronic
1150387398 17:64773047-64773069 ATTCAGAGCTGGATCTGTGCCGG - Intergenic
1150897953 17:69235886-69235908 ATTCAGAGTTGTAACTGTGCTGG - Intronic
1152197796 17:78927669-78927691 ATTCCAGCCTGTTTGTGTGCTGG - Intergenic
1154046331 18:10908844-10908866 AGGCAAACCTGGAACTGTGCGGG + Intronic
1156567752 18:38214872-38214894 ATTTAAACCTATGTCTGGGCCGG - Intergenic
1158440312 18:57469282-57469304 TTTCAAACCTGTATCCTTGGAGG + Intronic
1158696108 18:59705420-59705442 ATAAAAACCTGTTTCTGGGCCGG - Intergenic
1162241729 19:9360613-9360635 ATTCAAACATGTCTCTGCTCTGG + Intronic
1163885304 19:19959969-19959991 ATTTAAACCTTTGACTGTGCGGG + Intergenic
1163889071 19:19994874-19994896 ATTTAAACCTTTGACTGTGCGGG - Intergenic
1163896847 19:20066863-20066885 ATTTAAACCTTTGACTGTGCGGG + Intergenic
1163938363 19:20471092-20471114 ATTTAAACCTTTGACTGTGCGGG - Intergenic
1164515452 19:28931587-28931609 ATTCAAACATGTATCTATAGAGG - Intergenic
1166216503 19:41339105-41339127 AATCAAACCTGAATCTGATCAGG - Intronic
927065019 2:19462638-19462660 TTTGAAACCTGGCTCTGTGCAGG - Intergenic
928361924 2:30670549-30670571 ATTAAAATCAGTAGCTGTGCTGG + Intergenic
930468435 2:51782646-51782668 ATTCAAACCAATTTATGTGCAGG + Intergenic
935920337 2:108006040-108006062 ATTCCACCCAGCATCTGTGCGGG - Exonic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
937471106 2:122174641-122174663 ATTGAAAGCTCTCTCTGTGCTGG - Intergenic
939326646 2:140699126-140699148 ATCCAAGCCTGTATGTGTGGTGG - Intronic
940282523 2:152002384-152002406 AATCAAAGATGTATCTGTGTGGG + Intronic
940955876 2:159726555-159726577 ATTAAAACCTGTATCTGGCCGGG - Intronic
942508338 2:176668215-176668237 ATTCTGTGCTGTATCTGTGCTGG + Intergenic
942960920 2:181829156-181829178 TTTGAAAGCTGTATCTGTGAAGG + Intergenic
943442885 2:187947817-187947839 ATTGAAAGCTGCTTCTGTGCTGG - Intergenic
944437409 2:199705007-199705029 AGGCAAACATGTATCTGAGCAGG - Intergenic
945778220 2:214133693-214133715 CTTCAACCCTCTATCTTTGCAGG - Intronic
948424041 2:237876690-237876712 AGTCAATCCTGATTCTGTGCGGG + Intronic
1169901872 20:10561856-10561878 ATTCCATCGTGTATGTGTGCCGG + Intronic
1174940430 20:54920544-54920566 ATGCAAGCCTGTGTCTGTGTAGG - Intergenic
1175583639 20:60120255-60120277 CTTGAAACATGTATATGTGCCGG + Intergenic
1176073688 20:63239087-63239109 CTGCAGACCTGTATCTGGGCCGG + Intronic
1176191181 20:63810797-63810819 ATCCTACCCTGCATCTGTGCTGG - Intronic
1177385133 21:20398729-20398751 GTTCAATCCAGAATCTGTGCAGG + Intergenic
1178160285 21:29904655-29904677 ATTGAAACATGTACTTGTGCAGG + Intronic
1179327972 21:40368444-40368466 ATTCTGACTTGTATTTGTGCTGG + Intronic
954716752 3:52530788-52530810 ATTTAATCCTGCATATGTGCAGG - Intronic
955042102 3:55327726-55327748 TTTCAAACCTCTATTTTTGCTGG - Intergenic
955215506 3:56982064-56982086 ATGCAAACTTGGAGCTGTGCAGG + Intronic
960469190 3:118040086-118040108 ATACAAATCTGTATATGTACGGG + Intergenic
963130287 3:141851627-141851649 ATTCTACCCTGGACCTGTGCCGG - Intergenic
972271649 4:37516316-37516338 ATTCAAACCTGAATGGGTTCAGG - Intronic
974440872 4:61915520-61915542 ATTCAAACATGAATCTCTGGTGG + Intronic
975931908 4:79534710-79534732 ATTACTACTTGTATCTGTGCTGG + Intergenic
977064488 4:92296442-92296464 ATTCAGACTTGTATCTCTGAAGG + Intergenic
977378061 4:96234584-96234606 TTTTAAACCTGTATCCCTGCAGG - Intergenic
979311280 4:119206585-119206607 ATTTAAATCTGTTTCTGTCCAGG + Intronic
980231749 4:130054199-130054221 TTTCAAGGCTGTATTTGTGCAGG + Intergenic
981786892 4:148489578-148489600 ATCTAAACCTGGATCTGTTCTGG - Intergenic
982546200 4:156736346-156736368 ATCCAAATCTGTATTTGTGTTGG + Intergenic
984305862 4:177989662-177989684 TTTCTATCCTGTTTCTGTGCTGG - Intronic
984321700 4:178205516-178205538 ATTCCACCCTGTAACTATGCTGG - Intergenic
986591811 5:9378500-9378522 ATCCAAACCTGGATCTCAGCAGG + Intronic
988196108 5:28008209-28008231 ATTCATACCTTTATTTCTGCAGG + Intergenic
988800475 5:34691931-34691953 ACTCAAACCTCTGTCTGAGCAGG - Intronic
993371221 5:87094731-87094753 TTTCAAATCTGTATTTGTGATGG - Intergenic
994810105 5:104505816-104505838 ATTCAAACCAGTAGCTTTACAGG + Intergenic
1000347593 5:160327815-160327837 ATCCAAACCTGTTTCAGTGTCGG + Intronic
1001839150 5:174858839-174858861 ATTCAAAGGTGTATTTGAGCCGG - Intergenic
1005028636 6:21488652-21488674 ATTCAAACCTGAATCTTTCTGGG - Intergenic
1006095739 6:31655662-31655684 CTTTGAACCTGTATCTGAGCTGG - Exonic
1009432664 6:63583714-63583736 ATTCAGACCTGTGTTTGAGCTGG + Intergenic
1011889992 6:92146314-92146336 ATTCTAACCTGTAGCTTAGCTGG - Intergenic
1012561953 6:100593089-100593111 ATTCAACCCTGCTTGTGTGCAGG - Intronic
1023393062 7:39728985-39729007 ATTCAAACCTTTGTCTCTGCTGG - Intergenic
1026301634 7:69102898-69102920 ACTCACACCTGTCTCTGTCCAGG + Intergenic
1026816934 7:73521154-73521176 TTTCAAACCTGTGTCTGCCCAGG + Intronic
1027401785 7:77816417-77816439 AATGAAACATGTATCTGTCCTGG - Intronic
1039682614 8:39757673-39757695 AAGCAAACCTGTCTCTGAGCAGG - Intronic
1046266324 8:111835908-111835930 ATTCTACCCTGAATCTGGGCTGG + Intergenic
1051879583 9:21826483-21826505 ATTCAAACCTGGTTCTGATCAGG - Intronic
1054970382 9:71079430-71079452 AATCAAAACTGTATCTCTGGAGG + Intronic
1055262160 9:74449788-74449810 TTTCAAACATTTATCTGTGTTGG + Intergenic
1055302454 9:74896548-74896570 ATTCAAAGCTGAATATGGGCTGG - Intergenic
1057615040 9:96581848-96581870 ATTTAACCTTATATCTGTGCTGG - Intronic
1057802412 9:98198362-98198384 AGCAAAACCTGTGTCTGTGCTGG - Intergenic
1058235082 9:102479770-102479792 ATTCAAATCTGAATCTCTTCTGG + Intergenic
1058783989 9:108367717-108367739 ATTCAAAACTGTATCTGCGTGGG - Intergenic
1059745322 9:117194533-117194555 ATTCACACGTGAATATGTGCAGG + Intronic
1060261480 9:122078765-122078787 TTTCAAACCCCTATCTGTGTAGG + Intronic
1203691734 Un_GL000214v1:48493-48515 CTTCCACCCTGTAGCTGTGCTGG - Intergenic
1203644561 Un_KI270751v1:55698-55720 CTTCCACCCTGTAGCTGTGCTGG + Intergenic
1187739738 X:22342442-22342464 ATTCATTACTGTATTTGTGCAGG - Intergenic
1188224505 X:27580482-27580504 ATTCAAACATAATTCTGTGCTGG + Intergenic
1190936917 X:55006029-55006051 ATTCAGACCTGGATCCTTGCAGG + Intronic
1193593298 X:83416906-83416928 ATTATAACCTGTAACTGTCCAGG - Intergenic
1194828538 X:98593251-98593273 ATTCCAACATGTGGCTGTGCTGG - Intergenic
1194916681 X:99717124-99717146 ATTCCAACCTGACTCTGGGCTGG - Intergenic
1196654186 X:118199660-118199682 GTTCAAACCCAGATCTGTGCTGG - Intergenic
1196978433 X:121185304-121185326 ATTCAAACATGTTTTGGTGCAGG + Intergenic
1197165312 X:123370621-123370643 ATTCCCACCTGAATCTCTGCAGG + Intronic
1200863898 Y:8022137-8022159 TTTCAATGCTGTATGTGTGCAGG + Intergenic
1201793752 Y:17871908-17871930 ATTCAAGCTTCTATCTCTGCTGG + Intergenic
1201807802 Y:18034078-18034100 ATTCAAGCTTCTATCTCTGCTGG - Intergenic
1202355137 Y:24039726-24039748 ATTCAAGCTTCTATCTCTGCTGG + Intergenic
1202515641 Y:25630383-25630405 ATTCAAGCTTCTATCTCTGCTGG - Intergenic