ID: 1146072461

View in Genome Browser
Species Human (GRCh38)
Location 17:29695846-29695868
Sequence AGCACCCACTGGCTGTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146072461 Original CRISPR AGCACCCACTGGCTGTTTTT GGG Intronic
902554459 1:17238814-17238836 AACACCCACTCTCTGTTTCTTGG + Intronic
904705646 1:32388525-32388547 AGCACCCACTGGGTGTCATAAGG - Intronic
907332247 1:53678956-53678978 AGCAGCCAGGGGCTGGTTTTAGG - Intronic
907352923 1:53848278-53848300 AGTACCTATTGGCTGTTTTGGGG + Intergenic
908755788 1:67467883-67467905 TGCTCCCTGTGGCTGTTTTTAGG + Intergenic
908925662 1:69251373-69251395 ACCACGCACTGGCTATTTCTAGG + Intergenic
909164530 1:72202329-72202351 AACACTCAGAGGCTGTTTTTGGG - Intronic
909923824 1:81414736-81414758 AGCAGACTCTGGCTGTATTTTGG + Intronic
911805624 1:102204388-102204410 TGCACACACTGCCTGTTTTCAGG + Intergenic
915837669 1:159190688-159190710 AGCACCCATTGGCTATTTCTTGG + Intronic
917667067 1:177235511-177235533 GGCACCCACAGGCTGCTTCTAGG - Intronic
917836449 1:178945292-178945314 AGCACCCAGTAGCTGTTTGCAGG + Intergenic
918848993 1:189658841-189658863 AGCATCCATTGGCGGTTTCTTGG + Intergenic
921822522 1:219633983-219634005 AACCCCCACTGTTTGTTTTTTGG - Intergenic
922372246 1:224923242-224923264 AGCTCCCAGGGCCTGTTTTTTGG + Intronic
1066026614 10:31364411-31364433 AGCACCCAGTGGCCCTGTTTTGG + Intronic
1068487179 10:57674753-57674775 AGCCCAAACTGACTGTTTTTTGG - Intergenic
1069479172 10:68765340-68765362 AATACCTACTGGCTGTTTTTTGG + Intronic
1071289574 10:84179139-84179161 ACCACCCACTGGCTGTGCCTTGG + Intronic
1071674971 10:87646980-87647002 AGTACACACTGGCTGGGTTTTGG + Intergenic
1073484848 10:103810265-103810287 AGCACTCACTGGATATTTGTTGG - Intronic
1076377407 10:130000963-130000985 ACTCCCCACTGGCTGTTTCTGGG + Intergenic
1078456085 11:11476653-11476675 AGCCCCCACTGTCTCTTTTCAGG + Intronic
1078663219 11:13303854-13303876 AGAACCCACTTCCTTTTTTTAGG - Intronic
1081124103 11:39301673-39301695 AGCTTCCACTTTCTGTTTTTTGG + Intergenic
1081510743 11:43770371-43770393 AGCACCTACTTGCTTTTATTAGG + Intronic
1082092217 11:48099242-48099264 TGCAGCCACTGCTTGTTTTTGGG + Intronic
1088643727 11:111898637-111898659 AGCTCCCACTTTCTGTCTTTTGG + Intergenic
1089223459 11:116895248-116895270 AGCACCCCCTGGCTGTTGAGGGG - Intronic
1089556018 11:119316396-119316418 AGCGCCCGCTGGCTTATTTTGGG - Intronic
1091874918 12:3925721-3925743 AGCAGCCATTGGCTGTTTGAAGG - Intergenic
1091957364 12:4658050-4658072 ACCACCTACTGGCTTTTTATGGG - Intronic
1094103817 12:26787745-26787767 AGCACCTAATGGCTATTTTGGGG + Intronic
1095907338 12:47391675-47391697 AGCACCCACTGCCAGTGTGTGGG - Intergenic
1098293816 12:68984187-68984209 AGCACCAATTGGCTGACTTTGGG + Intergenic
1100397221 12:94195688-94195710 AGCCCCTGGTGGCTGTTTTTAGG + Intronic
1101757898 12:107635619-107635641 AGCCCCCACTGTCTGTGTCTAGG - Intronic
1102293012 12:111716215-111716237 AGCACACCCAGGCTTTTTTTTGG - Intronic
1106194077 13:27478358-27478380 AGAACCCACTCGATGTTGTTAGG + Intergenic
1107869843 13:44736332-44736354 AGCCCCCACCTGCAGTTTTTTGG + Intergenic
1111392201 13:87611132-87611154 TGTACCCACTGTCTGTATTTGGG + Intergenic
1111689160 13:91539575-91539597 AACTCTCACTGGCTGTTTTTGGG + Intronic
1112576876 13:100644054-100644076 AGAACGCACTGGCTGTTTTCAGG - Intronic
1114334755 14:21676773-21676795 AGCACCAATTGGCTGACTTTGGG + Intergenic
1114403091 14:22428025-22428047 AGAATCCACTGGGTCTTTTTGGG + Intergenic
1118501310 14:66365043-66365065 AGCTCTCACTGGCTCTCTTTTGG + Intergenic
1122328857 14:100899536-100899558 AGGAGCCACTGGCAGTGTTTGGG + Intergenic
1124040243 15:26095139-26095161 AGCACCAACTGGCTGACTCTGGG - Intergenic
1127196215 15:56588819-56588841 ATCACTCACTGACTGATTTTTGG + Intergenic
1128329448 15:66746054-66746076 AGCACCCTCTGGCTGATGCTTGG - Intronic
1129096382 15:73213164-73213186 AGCAACCACTGGAGGTTTTCAGG + Intronic
1129907658 15:79200497-79200519 AGCACACAGGAGCTGTTTTTAGG - Intergenic
1130755343 15:86756886-86756908 AGCTCCCTCTGGCTGTAGTTTGG + Intronic
1135632465 16:24046846-24046868 TGCCCCCACTGGGTGGTTTTGGG - Intronic
1137504726 16:49044098-49044120 AGTACCCACTGGTGGTTCTTTGG - Intergenic
1137622333 16:49884086-49884108 AGGTCCCTCTGGCTGTTTTGTGG - Intergenic
1140130643 16:72157715-72157737 AGGTCACACTGGCTGTTTATTGG + Intronic
1141619696 16:85230501-85230523 AGGACTCACTGGCTGTCTCTAGG + Intergenic
1143153035 17:4818810-4818832 AGCACTCACTGGCTGCTTTAAGG - Exonic
1146072461 17:29695846-29695868 AGCACCCACTGGCTGTTTTTGGG + Intronic
1148102854 17:45103248-45103270 AGCACCAACTCCCTGTTTTTAGG - Intronic
1148440870 17:47711059-47711081 AGCACCCACAGGCTGCCTTTGGG + Exonic
1151034871 17:70787028-70787050 AGCAGGCACTGGTTGTTTTCTGG + Intergenic
1151439298 17:74117888-74117910 ACTAACCACTGGCTTTTTTTGGG - Intergenic
1151557819 17:74855390-74855412 AGAACCCACTGGCTGAGTTTTGG - Intronic
1153158057 18:2171515-2171537 AGCACCCACAGGCTTTTGTGTGG + Intergenic
1157939975 18:51917864-51917886 AGCAGCCTCGGCCTGTTTTTAGG + Intergenic
1160070699 18:75625375-75625397 AGCAGCCATTGTCTGCTTTTTGG + Intergenic
1161460073 19:4391330-4391352 CGCACTCACAGGCTGTTATTAGG + Intronic
1164000105 19:21090565-21090587 TGCACCAACTGGCTGACTTTGGG - Intronic
1167313026 19:48748191-48748213 AGGAGCCCCTTGCTGTTTTTTGG - Exonic
926086530 2:10023511-10023533 GACACCAACTGGCTGGTTTTGGG + Intergenic
928267265 2:29822291-29822313 AGCACCTGCTGGCAGTTTATAGG + Intronic
931639005 2:64364788-64364810 AGCTCCCACTGGCTGTGTTCAGG + Intergenic
931942469 2:67267651-67267673 AGCCCCCACTTGCTTTTTTGGGG - Intergenic
933614489 2:84470072-84470094 TGCACCGACTGGCTGACTTTGGG - Intergenic
935059145 2:99593096-99593118 AGCACCCATAGGCTGCTGTTTGG - Intronic
937611022 2:123861394-123861416 AACACACACTGGGTCTTTTTTGG + Intergenic
938672283 2:133597794-133597816 TGCATCCACTGGCTGTGCTTAGG - Intergenic
939204581 2:139084027-139084049 AGCCCCCTCTGGCAGTTTTGTGG + Intergenic
939248995 2:139662280-139662302 TGCTCCCACTGGCTGCTGTTGGG + Intergenic
940603834 2:155894919-155894941 AGCACTCACTGATTTTTTTTTGG + Intergenic
943352070 2:186806950-186806972 AGCACACACTAGCTGCTTCTAGG + Intergenic
945035537 2:205700837-205700859 GGCACCCACAGGCTGTTTGGGGG + Intronic
945741008 2:213661035-213661057 AGCCCCCACTGCCTGGTGTTGGG + Intronic
947891605 2:233626979-233627001 AACACCCACTGACAGTTTTTTGG - Intronic
948911535 2:241006951-241006973 GGCTCCCACTGGCAGTGTTTGGG + Intronic
1171059467 20:21942376-21942398 TGCCCCCAGTGGCTGGTTTTGGG + Intergenic
1173475974 20:43360020-43360042 ACCACTCACTGGCTGGTTTAAGG + Intergenic
1175831198 20:61966197-61966219 AGCACCCACTTGCTGCGTTTGGG - Intronic
1178291754 21:31374247-31374269 AGCACCCAGTATCTGTTTTATGG - Intronic
1181161317 22:20961641-20961663 AGCACCCACTGGATTCTTTGGGG - Intergenic
1181495497 22:23285256-23285278 AGCACCCACTGGCCGTGTGCGGG - Intronic
1182984355 22:34702357-34702379 AGCTCCCACTGCCAGTCTTTGGG - Intergenic
1183076457 22:35430481-35430503 AGTCCCCACTGGCTGGTTTTGGG - Intergenic
1184417893 22:44362843-44362865 GGCACCCACTGGCTGTGTGCTGG + Intergenic
951849994 3:27128727-27128749 GGCTCCCACTGGCTATTTATGGG - Intronic
957949919 3:87111320-87111342 AGCACCCACTGATTCTTTGTGGG + Intergenic
961079800 3:124016603-124016625 GGCTCCCTCTGGCTGTTGTTAGG - Intergenic
961118413 3:124351451-124351473 AGCACCCATTCTCTGTATTTAGG + Intronic
961839976 3:129701457-129701479 TCCACCCACTGGCTGGTTATGGG - Intronic
961904782 3:130251487-130251509 AGTACCCACTGGCTAATCTTGGG + Intergenic
964855352 3:161140428-161140450 AGCACCAATTGGCTGATGTTGGG + Intronic
965694527 3:171393527-171393549 AGAACCTACTGGCTGCTTGTAGG - Intronic
966931909 3:184680909-184680931 AGGACCCAGGGGCTGTTTTACGG - Intronic
968297262 3:197586214-197586236 CCCAGCCACTGGCAGTTTTTGGG + Intergenic
969781122 4:9405013-9405035 AGCACTCAGTGGCTGTTGTAGGG - Intergenic
969951906 4:10845583-10845605 AGAAACCACTGGTTGCTTTTAGG - Intergenic
970348037 4:15172869-15172891 GGCACCCCCTGGGTGTGTTTAGG + Intergenic
972820167 4:42692415-42692437 ATCCACCACTGTCTGTTTTTTGG - Intergenic
976621718 4:87135016-87135038 AGGAGCCACTGGCTGTTCCTAGG + Intronic
977486184 4:97649411-97649433 AGCTGTCACAGGCTGTTTTTAGG + Intronic
979082762 4:116363183-116363205 AGCAGCCACTGGATGTCTTTTGG - Intergenic
983667731 4:170200837-170200859 AACACACACTGGGTTTTTTTCGG + Intergenic
988636873 5:32994461-32994483 AGCTCCCATTGGCTGATCTTAGG - Intergenic
990313847 5:54565911-54565933 AGAACCCACTGACTTTTTCTGGG + Intergenic
996802058 5:127415189-127415211 AGGCCCCACGGGCTGTATTTAGG + Intronic
997499611 5:134362628-134362650 GGCACTCACTGGCTTTTTATAGG - Intronic
999828573 5:155297807-155297829 ACCACCCATTGGCAGGTTTTGGG + Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001455769 5:171858683-171858705 GGCAACCACTGGCTGGTTTTAGG - Intergenic
1002594678 5:180314065-180314087 AACACCCGCTGGCTGTGTCTCGG - Intronic
1004128165 6:12894011-12894033 ATCACCCACTGGCTGACTGTGGG + Intronic
1004373619 6:15073650-15073672 AGCATCCCCTGGCTGGTTCTAGG - Intergenic
1005448923 6:25954291-25954313 AGCACCAACTGGCTGACTTTGGG - Intergenic
1005851524 6:29826863-29826885 CTCACGCACTGCCTGTTTTTAGG - Intergenic
1006789472 6:36690003-36690025 AGCACCCTCTGGCTATTTACCGG - Intergenic
1008323280 6:50144793-50144815 AGCTTCCCCTGGCTGTGTTTGGG - Intergenic
1009378168 6:62997246-62997268 AGCACCCATTCCCTCTTTTTTGG - Intergenic
1010719365 6:79264470-79264492 AGCACCAATTGGCTGCCTTTGGG - Intergenic
1010881011 6:81171741-81171763 AGCACCCACTGCCTCTTTTTAGG - Intergenic
1013473761 6:110488658-110488680 AGCACTGACTGACTGATTTTGGG + Intergenic
1023766648 7:43517729-43517751 AGAACCCAGGGGCTGTTGTTAGG - Intronic
1028828872 7:95305240-95305262 AGCAACGTCTTGCTGTTTTTCGG + Intronic
1029558810 7:101289165-101289187 AGCTCCCACTGTCTTCTTTTCGG + Intergenic
1032680915 7:134182366-134182388 GGTACCCAGTGGCTGTTTTGGGG + Intronic
1034594474 7:152176557-152176579 AGCACCGCCTGGCCGTGTTTTGG - Exonic
1036710510 8:11075397-11075419 AGCACCTACCGGGTGTTTCTGGG - Intronic
1036795641 8:11754519-11754541 AGCACCCACTTTTTGTTTTCAGG + Intronic
1039306534 8:36269158-36269180 ATCATCCACTGGCATTTTTTAGG - Intergenic
1039412458 8:37366229-37366251 TGCAGCCACTGGCTGCTTTGGGG + Intergenic
1042952664 8:74217938-74217960 AGCACTCAGTGTCTGTTCTTTGG + Intergenic
1043826608 8:84937168-84937190 AGCACCAATTGGCTGACTTTGGG + Intergenic
1054733616 9:68727830-68727852 AGCACCCACTGTCTGTACTGTGG - Intronic
1057226256 9:93294831-93294853 AGCATCCACTTCCTGTTCTTAGG - Intronic
1057972374 9:99570417-99570439 AGCAGCCACTGACTGGATTTAGG + Intergenic
1059372426 9:113853390-113853412 ATCACCCACTTGCTTTCTTTTGG + Intergenic
1186287778 X:8064648-8064670 AGCTCCCAGTGGCTGCTCTTGGG - Intergenic
1187062011 X:15795606-15795628 AGCACCAGCTGCCTGTCTTTTGG - Intronic
1187142015 X:16602928-16602950 GGCACCCACTGGCCTTATTTTGG - Intronic
1187367499 X:18676718-18676740 TACACCCACTGGTTGTGTTTTGG + Intronic
1190137888 X:47813800-47813822 AGCACCAACTGGCTGATTTTGGG - Intergenic
1191090472 X:56615724-56615746 AGCCCCCACTGCCTGGTGTTGGG - Intergenic
1191823365 X:65337183-65337205 AGCACCAATTGGCTGACTTTGGG - Intergenic
1199119306 X:144032094-144032116 AGCACTCACATGCTGTTTTCCGG - Intergenic