ID: 1146077395

View in Genome Browser
Species Human (GRCh38)
Location 17:29744092-29744114
Sequence CAGGGACGCCAAAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146077389_1146077395 16 Left 1146077389 17:29744053-29744075 CCGTATTCACAGGGTTAAAAATA 0: 1
1: 3
2: 3
3: 43
4: 408
Right 1146077395 17:29744092-29744114 CAGGGACGCCAAAGGGCAGTGGG 0: 1
1: 0
2: 4
3: 23
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146077395 Original CRISPR CAGGGACGCCAAAGGGCAGT GGG Intronic
901325093 1:8360881-8360903 GAGGGAGGCCAAAGGGCTGTGGG + Exonic
902059953 1:13633838-13633860 CAGAGGCGTGAAAGGGCAGTAGG + Intergenic
902169977 1:14602073-14602095 CAGGGATGACAACGGGCAGTAGG + Intronic
903588776 1:24438459-24438481 CAGGGACGGGAGAGGGCAGGAGG - Intronic
904114362 1:28150698-28150720 CAGGAAGGCCACAGAGCAGTAGG + Exonic
906543288 1:46604339-46604361 CAGGGCCGCCTGAGGGCAGGGGG + Intronic
910452170 1:87358462-87358484 CATGGAGGCCTCAGGGCAGTTGG - Intergenic
911707045 1:101025934-101025956 CAGGGCGGCGAAAGGTCAGTCGG + Intronic
916548077 1:165825704-165825726 AAGGAATGCCAAAGGCCAGTGGG - Intronic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
923245499 1:232127357-232127379 CATGGAGGCCACAAGGCAGTGGG - Intergenic
1062955627 10:1538585-1538607 CATGGAGGCCACAGGGCACTTGG + Intronic
1065756528 10:28935881-28935903 AGGGGAGGCCAAGGGGCAGTGGG + Intergenic
1065960532 10:30730941-30730963 CAGGGAAGCCAGAGGGGTGTGGG + Intergenic
1066022733 10:31319396-31319418 CAGGGACGGCAAAGTGGAGTGGG + Intronic
1067663411 10:48253435-48253457 CATGGAGACCAAAAGGCAGTTGG + Intronic
1067810096 10:49419342-49419364 CAAGGTCGCCCAAGGTCAGTGGG + Intergenic
1067841671 10:49685661-49685683 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1070750572 10:78961813-78961835 CAGGGACACCAAGGCACAGTGGG + Intergenic
1072161218 10:92768743-92768765 CATGGACGCCAGAAGGCGGTGGG + Intergenic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1073816450 10:107213128-107213150 CAGGGACACCAATGAGCTGTAGG + Intergenic
1075436910 10:122451315-122451337 CAGGGACTCCAATGAGCAGCAGG - Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076670316 10:132117424-132117446 CAAGGGCGCCAAAAGGCAGGTGG + Exonic
1076839098 10:133036830-133036852 CCCGGACGCCAAAGGGGAGGGGG - Intergenic
1077365715 11:2160757-2160779 CAGGGGCAGCAATGGGCAGTTGG + Intronic
1077430809 11:2515181-2515203 CTGGGACTCCAAAGGGGAGGTGG - Intronic
1079088086 11:17461503-17461525 GAGGGACCTCAAAGGGCATTAGG - Intronic
1080177405 11:29381917-29381939 CATGGATGCCAGAAGGCAGTGGG + Intergenic
1081407918 11:42719339-42719361 CAGAGGCTCGAAAGGGCAGTGGG + Intergenic
1083661575 11:64253926-64253948 AAGGGATGCAGAAGGGCAGTGGG + Intronic
1083949450 11:65945968-65945990 CAGGGAGGCCTAAGGGCCTTGGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085353030 11:75812849-75812871 GAGGGAAGCCCAAAGGCAGTGGG - Intergenic
1085520475 11:77136215-77136237 CACGGCGGCCAGAGGGCAGTAGG - Intronic
1087163388 11:94973435-94973457 ATGGGACGGGAAAGGGCAGTTGG - Intronic
1088771302 11:113038267-113038289 CAAGGAGGCCAGAGAGCAGTGGG - Intronic
1088771716 11:113042385-113042407 GAAGGAGGCCAAAGGGCAGAGGG - Intronic
1090584220 11:128192862-128192884 CAGGGCCTACAAAGAGCAGTAGG + Intergenic
1090996116 11:131867243-131867265 CAGGGATGCCTAAACGCAGTGGG + Intronic
1092211744 12:6650925-6650947 CATGGAGGCAAAAGGACAGTGGG + Exonic
1092447143 12:8568160-8568182 CAGGGACCAAAAATGGCAGTGGG - Intergenic
1093251800 12:16814291-16814313 CATGGAAGCCAGAAGGCAGTGGG + Intergenic
1094720035 12:33053217-33053239 CAGGGAGGCCAAAGGGGAGTGGG - Intergenic
1095725059 12:45442789-45442811 CATGCAAGCCAAAAGGCAGTAGG + Intergenic
1096841218 12:54380051-54380073 GAGGGACGTCCAAGGGCAGAGGG + Intronic
1097101955 12:56596242-56596264 GAGGGAAGCAAAAGGGCAGGGGG + Exonic
1098294048 12:68986008-68986030 TAGGGATGGCAAATGGCAGTTGG + Intergenic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1103456755 12:121073864-121073886 CATGGAGGCCAAAAGGCAGTGGG + Intergenic
1103911689 12:124355545-124355567 CATGGAGGCCCAGGGGCAGTGGG + Exonic
1105917424 13:24929448-24929470 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1107104353 13:36627199-36627221 CAGAGAAGCCAAAGGGCAGCAGG + Intergenic
1107657180 13:42603625-42603647 CAGAGAAGCCAGAGGACAGTGGG - Intronic
1108858046 13:54820100-54820122 CAGGGACCCCAAGGGCCAGCTGG - Intergenic
1110076415 13:71250018-71250040 CAGGGAAGCCACAGGGAAGGTGG - Intergenic
1111262505 13:85760485-85760507 CATGGACGCCAAGGGGAATTTGG - Intergenic
1111824496 13:93250769-93250791 CTGGGAAGCCAAAGGGAAGCAGG - Intronic
1112361092 13:98719261-98719283 CAGGAACCCCAAAGGCCAGTGGG + Exonic
1114353844 14:21885404-21885426 CATGGAAGCCAGAAGGCAGTAGG + Intergenic
1115663464 14:35520968-35520990 CAGGAATACCAAAGGGAAGTAGG + Intergenic
1115874365 14:37844170-37844192 CAGAGAAGCCCCAGGGCAGTCGG - Intronic
1117628220 14:57662539-57662561 CAAAGAAGCCAAAGGGAAGTTGG - Intronic
1120001149 14:79304361-79304383 CAGGGATCCCAAAAGGCAATGGG - Intronic
1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG + Intronic
1122153776 14:99738411-99738433 CAGGCAGAGCAAAGGGCAGTGGG - Intronic
1123711339 15:22989978-22990000 CAGGGAAGCCCCAGGGCAGGAGG - Intronic
1124095069 15:26641703-26641725 CAGGGAAGCCAAGGGGCATCTGG - Intronic
1124245204 15:28064117-28064139 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1124406944 15:29401504-29401526 CAGTGATGGCAAAGGGCAGAGGG + Intronic
1128078787 15:64844001-64844023 TAGGGATGCCAAAGGGGAGTAGG - Intronic
1129889943 15:79065394-79065416 CAGGGATGCCAGTGGGCAGGTGG + Intronic
1130576925 15:85101316-85101338 CAGGAATGAGAAAGGGCAGTGGG + Intronic
1131509943 15:93044382-93044404 CAGGGAGGCCACAGGCCAGAAGG + Intronic
1131650116 15:94389082-94389104 CAGGAACGAGAAAGGGCAGTGGG + Intronic
1132551197 16:554452-554474 CAGGGAGGCCAAAGGGGAGTGGG - Exonic
1132746404 16:1438157-1438179 TAGGGACGCCAAGGGGCGCTTGG - Exonic
1132917247 16:2357043-2357065 CAGGGAGGCAAAAAAGCAGTGGG - Intergenic
1134176465 16:12010821-12010843 CAGGAACAACAAAGGGCAGCTGG - Intronic
1134189648 16:12111360-12111382 CATGGAAGGCAAAGGGCAGCAGG - Intronic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1135114089 16:19711244-19711266 CAGGGACTCCAGAGGCCACTGGG - Intronic
1138424309 16:56920477-56920499 CAGGGCAGCCGAAGGGCACTCGG + Intergenic
1138481986 16:57309603-57309625 CAGGGATGCCAAAGAGGAGGAGG + Intergenic
1139320067 16:66107121-66107143 CAGGGACTCCAACAGGCAGAGGG - Intergenic
1140589248 16:76332031-76332053 CAGGGCGGCCAAAAGGCAGTGGG - Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1145013524 17:19382841-19382863 CAGGCACACCAAAGGGCAGTGGG + Exonic
1146077395 17:29744092-29744114 CAGGGACGCCAAAGGGCAGTGGG + Intronic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1147904495 17:43814017-43814039 CAGCGACGCCAAAGTGCTGTGGG + Exonic
1147988961 17:44321870-44321892 CAGGGAGGCCTGAGGGCTGTGGG - Intronic
1149633418 17:58145200-58145222 CATGGAGGCCAAAATGCAGTGGG + Intergenic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1150224708 17:63517860-63517882 TAGGGAAACCAAAGGTCAGTGGG - Intronic
1150928098 17:69555211-69555233 CATGGAAGCCAAAAGACAGTTGG - Intergenic
1151163026 17:72181813-72181835 CAGGAAAGGCAAAGGGCAGAAGG - Intergenic
1151630756 17:75309330-75309352 CAGGGACGCCACAGGGCTCCAGG - Intergenic
1152784506 17:82240885-82240907 GAGGGAAGCCATGGGGCAGTGGG + Intronic
1156074522 18:33257500-33257522 CAGGGAAGCCAAATATCAGTTGG + Intronic
1156428407 18:37042565-37042587 CAATGAAGCCAAAAGGCAGTGGG - Intronic
1157814623 18:50721830-50721852 GAGGGACAACACAGGGCAGTGGG - Intronic
1159900997 18:74045494-74045516 CAGAGAGGCCAATGGGCAGCTGG - Intergenic
1160783901 19:891027-891049 CAGGGGCACCGATGGGCAGTGGG + Exonic
1161048480 19:2149991-2150013 CAAGGAGGCCGAAGGGAAGTGGG + Intronic
1161571538 19:5033303-5033325 CAGTGAAGCCCAGGGGCAGTGGG + Intronic
1163019124 19:14473302-14473324 CTGGGACGACAAAGGGCGGGAGG + Intronic
1163274782 19:16276744-16276766 CAGGGACCCCAATGTGCAGGAGG + Intergenic
1164188743 19:22896355-22896377 CAGGGACTCCAAAAGGGAGGAGG - Intergenic
1165119997 19:33552790-33552812 CAGCGACCCCAAAGCGCCGTAGG + Intergenic
1167694107 19:51003896-51003918 CAGGGAGGACTCAGGGCAGTGGG - Intronic
1168403497 19:56099153-56099175 CTGGGAAGCCACTGGGCAGTGGG - Intronic
925154486 2:1639170-1639192 CAGGGACGTCCCAGGGCACTGGG - Intronic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
927484226 2:23477859-23477881 CAGAGACACCCCAGGGCAGTGGG + Intronic
929177637 2:38997635-38997657 CATGGAGGCCAGAAGGCAGTGGG + Intronic
931501714 2:62875997-62876019 CAGGGATGCCAATGAGTAGTAGG - Intronic
934519500 2:95010972-95010994 CAGGGCTGCCAATGGGCTGTAGG - Intergenic
935257574 2:101325608-101325630 CATGGAGGCCAAAAGGCAGTGGG - Intergenic
935736701 2:106112017-106112039 AAGGGAGGCCAGAGGGCTGTGGG + Intronic
936044395 2:109175005-109175027 CAAGGAAGCCAAAAGACAGTTGG - Intronic
936107839 2:109640672-109640694 CCGGGACTCCTAAGAGCAGTTGG - Intergenic
936828809 2:116614888-116614910 CACAGAGGCCAAAGGGGAGTGGG + Intergenic
937104049 2:119293971-119293993 CAGGGACTCCAGCGGGCAGCTGG + Intergenic
938537182 2:132256593-132256615 CAGGCCCGCCGAAGGCCAGTCGG - Intronic
942057009 2:172193447-172193469 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
946400138 2:219464286-219464308 CAGGGATGCCCACGGTCAGTGGG + Intronic
947074252 2:226324839-226324861 CAGAGAGGACAGAGGGCAGTGGG + Intergenic
947166192 2:227264426-227264448 CAGGGAAGCCCCAGGACAGTAGG + Intronic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
948802378 2:240438689-240438711 CAGGGACCAGAAAAGGCAGTGGG + Intronic
948976527 2:241466761-241466783 CAGGGAGGCCAAAGGGGAGTGGG - Intronic
949015745 2:241709340-241709362 CAGTGACGACAAAGTGCAGCTGG + Exonic
1169057030 20:2631584-2631606 CATGGAGGCCAAATGGCAGTGGG - Intronic
1169229185 20:3875740-3875762 CAAGGACACCCAAGGGCAGAGGG - Exonic
1170132811 20:13040909-13040931 AATGGAAGCCAAAAGGCAGTGGG - Intronic
1171810651 20:29742781-29742803 CGGGCCCGCCAAAGGCCAGTCGG - Intergenic
1172108136 20:32528685-32528707 CAGGGAAACCACAGGGCAGGAGG + Intronic
1173575575 20:44111188-44111210 CAGGGACCCCAAAGGGATGGAGG - Intergenic
1175322007 20:58094764-58094786 GTGGGAGGCCCAAGGGCAGTGGG + Intergenic
1176668888 21:9713517-9713539 CAGGGAAGCTAAAGGAGAGTGGG + Intergenic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1181320067 22:21997710-21997732 CAGGGATTCCTAAGGGCAGTGGG - Intergenic
1181869371 22:25885834-25885856 GAGGGACCCCCAAGGCCAGTGGG + Intronic
1181987542 22:26810958-26810980 CAAGGACCACAGAGGGCAGTGGG - Intergenic
1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG + Intronic
1184830762 22:46984907-46984929 CAGGGAGGCGACAGGGTAGTTGG + Intronic
1185341939 22:50294890-50294912 GAGGGAAGCCAAAGGCCAGATGG - Intronic
949946271 3:9192472-9192494 CCTGGACACCAAGGGGCAGTTGG + Intronic
950639467 3:14339558-14339580 TAGGGAAGCCAGGGGGCAGTGGG + Intergenic
954889081 3:53906631-53906653 CACGGAGGCCAGAAGGCAGTGGG + Intergenic
960887883 3:122415489-122415511 AAGAGACGCCAAAGCACAGTTGG - Exonic
960998022 3:123352191-123352213 CAGGGACGCCACATGGCTATGGG + Intronic
961650212 3:128413404-128413426 CAGGGACCTCAGAGGGCACTGGG + Intergenic
961742098 3:129039480-129039502 CAGGGACTGCTCAGGGCAGTGGG - Intronic
962360899 3:134741924-134741946 CAGAAACTCCAAAGGGGAGTGGG + Intronic
963856094 3:150255494-150255516 CAGGGACACCATAGGCCTGTTGG + Intergenic
968962486 4:3752671-3752693 AAGGGACCCCATAGGGAAGTCGG + Intergenic
969694121 4:8725291-8725313 CCGGGCCGCCACAGGGCAGCTGG + Intergenic
974770438 4:66404709-66404731 CATGGATGCCCAAGGGCAGGAGG - Intergenic
976658695 4:87516666-87516688 CATGGAAGCCAAAGGGCACCCGG + Intronic
976739458 4:88343557-88343579 CAGAGATGCCAAAGAGCAGCTGG + Intergenic
976855896 4:89605167-89605189 CACTGAAGCCAAAGGACAGTGGG + Intergenic
984091283 4:175378504-175378526 CAGGGATGGGAAAGGGGAGTTGG - Intergenic
984369564 4:178845215-178845237 CATGGAGGCCAGAAGGCAGTGGG + Intergenic
985405896 4:189637996-189638018 CAGGGAAGCCAAATGAGAGTGGG - Intergenic
985767210 5:1786304-1786326 AAGGGACCCCAAGGGGGAGTTGG + Intergenic
986277232 5:6287199-6287221 CAGGGAATCCAAAGGGGAGCAGG + Intergenic
987034167 5:14003800-14003822 CAGGGTGGCCTCAGGGCAGTGGG - Intergenic
991299087 5:65111310-65111332 CAGTGAAGCTAAAGGGTAGTGGG - Intergenic
991402548 5:66268835-66268857 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
992094334 5:73347240-73347262 CATGGAGGCCAGAAGGCAGTAGG + Intergenic
995735075 5:115291820-115291842 CATGGACACCAAAAGGCAGAGGG - Intronic
997526916 5:134559592-134559614 CAGAAAACCCAAAGGGCAGTAGG - Intronic
998309312 5:141111317-141111339 AATGGAGGCCAAAGGGGAGTGGG + Intronic
999258975 5:150226242-150226264 CAGGGAAGGGAAAGGGCACTGGG + Intronic
999271077 5:150296718-150296740 CAGGGACCCCCAAGCGCTGTGGG - Exonic
999343013 5:150789664-150789686 CAGGCATGCCAAAGGACAGCTGG + Intronic
1001067834 5:168553258-168553280 AAGGTACCCCAAAGGGGAGTAGG + Exonic
1002308744 5:178300448-178300470 CATGAAAGCCAAACGGCAGTAGG - Intronic
1002689015 5:181037464-181037486 CAGGGACCATAAATGGCAGTGGG + Intergenic
1003498915 6:6687811-6687833 CAGGGACCCCAAAAGGAAGGAGG - Intergenic
1006024089 6:31136457-31136479 CAGAGCCGCCAAAGGTCAATAGG - Intronic
1006163455 6:32050849-32050871 CAGGGAAGCCAATAGGCAGTTGG - Intronic
1006164075 6:32054238-32054260 CAGGGAGGCCAGTAGGCAGTTGG - Intronic
1006437321 6:34032828-34032850 CAGGGACCCCACTGGGGAGTGGG + Intronic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007518390 6:42431513-42431535 CAGGGCAGCCACAGGGCAGTAGG - Intronic
1010376455 6:75176237-75176259 GAGGGAGGGCAATGGGCAGTGGG + Intronic
1011565193 6:88665818-88665840 CTGGGACGCCCCATGGCAGTCGG + Intronic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1013787299 6:113796101-113796123 CAGAGACTCCAAACAGCAGTTGG + Intergenic
1014841307 6:126223782-126223804 CAGGGACTCCAAAGAGTTGTAGG + Intergenic
1014856860 6:126412376-126412398 CAAGGAGGCCAGAAGGCAGTGGG - Intergenic
1016862601 6:148735902-148735924 AAGGGAGTCCAAATGGCAGTAGG + Intergenic
1018028224 6:159822101-159822123 CAGGCACGACACAGGGCTGTGGG - Intergenic
1019411351 7:908137-908159 CAGGGACGCGAGGGGGCTGTGGG + Intronic
1022963859 7:35455064-35455086 GAGGGACGCAGAAGCGCAGTGGG - Intergenic
1024570340 7:50717995-50718017 CAGGGAGTCCAAAGGGCCCTGGG + Intronic
1025194832 7:56924740-56924762 CAGAGACGCCAAATGACAGCTGG - Intergenic
1026065638 7:67070053-67070075 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1026313908 7:69211593-69211615 CACGGACGCCAAGGGGGATTCGG + Intergenic
1026711237 7:72741807-72741829 CATGGAGGCCAGAAGGCAGTGGG + Intronic
1026901071 7:74037838-74037860 CAAGGAAGCCAACGGGCAGGAGG + Intronic
1031750349 7:125563838-125563860 CAGGGACGCCAAGGGGAATTCGG + Intergenic
1031873015 7:127108112-127108134 CAGAGAAGGCAAAGGGCAGGAGG - Intronic
1034497764 7:151432436-151432458 CATGGACCCCACAGGGCACTGGG - Intronic
1035281711 7:157782623-157782645 CAGGGACCCCTGGGGGCAGTTGG - Intronic
1035317790 7:158007489-158007511 CAGGGACTACGGAGGGCAGTGGG + Intronic
1037831973 8:22195119-22195141 CAGGGAGGAAAAAAGGCAGTTGG + Intronic
1042224080 8:66501841-66501863 AAGGGAAGCCAAGGGTCAGTTGG - Intronic
1043562620 8:81512018-81512040 AAGGGACACCAAAGGGCAGGAGG + Intergenic
1043946573 8:86260675-86260697 GAGGGAAGTCCAAGGGCAGTGGG + Intronic
1045481964 8:102600134-102600156 CAGGGAAGGCAGAGGGAAGTAGG - Intergenic
1048075127 8:131061674-131061696 CAGAGACGCCAAAGAGCTGGCGG + Intergenic
1049549295 8:143249408-143249430 GAGGGAAGCCGCAGGGCAGTTGG + Intronic
1049657385 8:143804846-143804868 CAGGGAGGCCCAAGGGCAGAAGG + Intronic
1049822824 8:144646502-144646524 CAGGGACACCAAAAGACAGGAGG + Intergenic
1049865750 8:144934398-144934420 CAGGCCTGCCAAAGGGCAGCAGG - Intronic
1050181959 9:2932867-2932889 CAGGGATGCCCCAGGGCAGGAGG - Intergenic
1050442139 9:5675988-5676010 CAGGAATGACCAAGGGCAGTTGG - Intronic
1052126459 9:24781230-24781252 CAGGGAGGCAGAAAGGCAGTTGG + Intergenic
1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG + Intronic
1053168496 9:35861437-35861459 GAGGGATGGCCAAGGGCAGTGGG - Intergenic
1054844832 9:69783305-69783327 CATGGAAGTCAGAGGGCAGTGGG - Intergenic
1056970843 9:91200998-91201020 CATGCAGGCCAAAAGGCAGTGGG + Intergenic
1060444563 9:123676132-123676154 CATGGATGTCAAAGGCCAGTTGG - Intronic
1060779423 9:126400612-126400634 CAGGGAGGGCACAGAGCAGTGGG + Intronic
1061289496 9:129642469-129642491 CAGGGGCGCCCAGGGCCAGTGGG - Intergenic
1061538710 9:131265856-131265878 TAGGGACCCCAAAGGACAGCAGG + Intronic
1061952594 9:133944663-133944685 CCGGGATGCAAAAGGGCAGCAGG + Intronic
1062136008 9:134928905-134928927 CAGAGCTGCCACAGGGCAGTTGG + Intergenic
1062608916 9:137364098-137364120 CAGTGATGCCTAAGGGAAGTAGG - Intronic
1203656978 Un_KI270753v1:7418-7440 CAGGGAAGCTAAAGGAGAGTGGG - Intergenic
1186875969 X:13818188-13818210 TAGGGACGGCGAAGGCCAGTTGG - Intronic
1186940295 X:14499685-14499707 CTGGGACTCCAAAAGGCAGGAGG + Intergenic
1189383794 X:40520559-40520581 GAGGGAGGCCCAAGGGCAGAAGG + Intergenic
1190990559 X:55545389-55545411 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1191793545 X:64997167-64997189 CATGGAGGCCAAAAGGCAGTGGG + Intronic
1193016406 X:76738758-76738780 CAGGGACCCCAAGGGCCTGTTGG - Intergenic
1193022761 X:76808926-76808948 CAGAGACTGGAAAGGGCAGTGGG + Intergenic
1195427427 X:104750287-104750309 CAATGAAGCCAAAGGGCAGTTGG + Intronic
1196579205 X:117359865-117359887 CAGGGTTGCCAAAGGTCAGATGG - Intergenic
1196818736 X:119686171-119686193 CAGGCTCCCCAGAGGGCAGTTGG - Intronic
1197807639 X:130412825-130412847 CAGTGACGCCAACGGTCACTGGG - Exonic
1197874872 X:131091875-131091897 CAGGGAAGCCAAAGAGCAAATGG - Intergenic
1197941913 X:131799381-131799403 CATGGAAGCCAAAAGGCAGTGGG - Intergenic
1199739027 X:150715150-150715172 CAGGGTCACCAAAGGAGAGTGGG - Intronic
1200127835 X:153825167-153825189 GAGGGAGGCCAAAGGACAGCTGG - Intronic
1202269708 Y:23060106-23060128 CAGGGACCTCAGAGGGCATTAGG + Intergenic
1202422702 Y:24693852-24693874 CAGGGACCTCAGAGGGCATTAGG + Intergenic
1202448087 Y:24976234-24976256 CAGGGACCTCAGAGGGCATTAGG - Intergenic