ID: 1146078922

View in Genome Browser
Species Human (GRCh38)
Location 17:29759623-29759645
Sequence TGAATTTGACTTCTATAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 253}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146078914_1146078922 26 Left 1146078914 17:29759574-29759596 CCCCTTCTCCTTCAACCCCTAGC 0: 1
1: 0
2: 0
3: 43
4: 504
Right 1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG 0: 1
1: 0
2: 2
3: 21
4: 253
1146078919_1146078922 10 Left 1146078919 17:29759590-29759612 CCCTAGCAACTACCATTCTACTT 0: 5
1: 81
2: 555
3: 1629
4: 3245
Right 1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG 0: 1
1: 0
2: 2
3: 21
4: 253
1146078921_1146078922 -2 Left 1146078921 17:29759602-29759624 CCATTCTACTTTACTTCTCTCTG 0: 1
1: 2
2: 10
3: 146
4: 1476
Right 1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG 0: 1
1: 0
2: 2
3: 21
4: 253
1146078916_1146078922 24 Left 1146078916 17:29759576-29759598 CCTTCTCCTTCAACCCCTAGCAA 0: 1
1: 1
2: 6
3: 68
4: 513
Right 1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG 0: 1
1: 0
2: 2
3: 21
4: 253
1146078920_1146078922 9 Left 1146078920 17:29759591-29759613 CCTAGCAACTACCATTCTACTTT 0: 6
1: 95
2: 619
3: 1838
4: 3361
Right 1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG 0: 1
1: 0
2: 2
3: 21
4: 253
1146078917_1146078922 18 Left 1146078917 17:29759582-29759604 CCTTCAACCCCTAGCAACTACCA 0: 1
1: 3
2: 26
3: 237
4: 1057
Right 1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG 0: 1
1: 0
2: 2
3: 21
4: 253
1146078913_1146078922 30 Left 1146078913 17:29759570-29759592 CCTACCCCTTCTCCTTCAACCCC 0: 1
1: 1
2: 12
3: 215
4: 1055
Right 1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG 0: 1
1: 0
2: 2
3: 21
4: 253
1146078918_1146078922 11 Left 1146078918 17:29759589-29759611 CCCCTAGCAACTACCATTCTACT 0: 7
1: 102
2: 720
3: 2225
4: 4533
Right 1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG 0: 1
1: 0
2: 2
3: 21
4: 253
1146078915_1146078922 25 Left 1146078915 17:29759575-29759597 CCCTTCTCCTTCAACCCCTAGCA 0: 1
1: 0
2: 3
3: 53
4: 391
Right 1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG 0: 1
1: 0
2: 2
3: 21
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146078922 Original CRISPR TGAATTTGACTTCTATAGAT AGG Intronic
900209494 1:1446986-1447008 CGAAATTTACTTCTATAGAAGGG + Intergenic
900219311 1:1498848-1498870 CGAAATTTACTTCTATAGAAGGG + Intergenic
900323852 1:2097814-2097836 GCAATTTTACTTCTATAGAAGGG + Intronic
902723746 1:18321966-18321988 TGAAATTGAGTTTTACAGATGGG + Intronic
904571778 1:31471421-31471443 TAATTTTTACTTCTATAGAAGGG + Intergenic
908343170 1:63203700-63203722 TAATTTTTATTTCTATAGATGGG + Intergenic
911470688 1:98314463-98314485 TCAATTTGGCTTCTAAAGCTAGG - Intergenic
911765147 1:101665162-101665184 GCAATTTTACTTCTATAGAAGGG - Intergenic
916241377 1:162643368-162643390 TGAAGTTTACCTGTATAGATAGG - Intronic
916411672 1:164552520-164552542 GCAATTTTACTTCTATAGAAGGG + Intergenic
917206406 1:172576405-172576427 TTAAATTGACTTCTATAAATAGG + Intronic
918456748 1:184727889-184727911 TCAATTTTAGTTCTGTAGATAGG - Intronic
918960836 1:191275383-191275405 TGAGCTTGACTTGTATAAATTGG + Intergenic
918971252 1:191422427-191422449 TGAATTTGACTTATCTTAATGGG + Intergenic
919360541 1:196588249-196588271 TGAATGTGAATTAAATAGATGGG + Intronic
920286976 1:204887205-204887227 TGAATTTGACCTCTCTAGGTAGG + Intronic
920492637 1:206429132-206429154 TCAATTTGCCTTCTACAGACTGG - Intronic
922078025 1:222267099-222267121 TTCATTTGACTTCTTTTGATGGG - Intergenic
923737133 1:236620856-236620878 TTATTTTGAGTTTTATAGATTGG - Intergenic
924853015 1:247849590-247849612 TTAATTAGACTTCTATACACTGG - Intergenic
1062790334 10:300430-300452 TGAATTTGACTACTCTAGGTAGG - Intronic
1062881139 10:979341-979363 GGAAGTTGACTTCTACAGACTGG + Intergenic
1064633448 10:17340608-17340630 GCAATTTTACTTCTATAGAAGGG - Intronic
1066144963 10:32548100-32548122 GTAATTTTACTTCTATAGAAGGG + Intronic
1069150004 10:64948302-64948324 TGAATTTTGCTGCTATAAATAGG + Intergenic
1069162314 10:65107107-65107129 TTAATTTAACATCTATAGAAAGG + Intergenic
1070445673 10:76498724-76498746 TGAATCTAACTTTTATAGATTGG - Intronic
1070573967 10:77662964-77662986 TGATTTTCAGTACTATAGATGGG - Intergenic
1070712479 10:78692934-78692956 GGTATTTGACTTCTACAGAGAGG + Intergenic
1071652189 10:87402144-87402166 TGAATTTGATTCATTTAGATGGG - Intergenic
1073945872 10:108749908-108749930 TGAGTTTGAATTATCTAGATTGG - Intergenic
1078211269 11:9271518-9271540 TTAATCTGTCTTCTATAGCTAGG - Intergenic
1078717311 11:13852427-13852449 TGAACTTGACCACTTTAGATTGG - Intergenic
1080837792 11:35956313-35956335 TGAATTTTATTTTTAGAGATGGG - Intronic
1081139250 11:39477074-39477096 AGAATGTAACTTCTATAGAATGG + Intergenic
1083232339 11:61331154-61331176 TGAAGTTGACTTCTTTAGAAGGG - Intronic
1084152468 11:67296284-67296306 TTAATTTGTCTTCAAAAGATTGG + Intronic
1086319528 11:85630036-85630058 TGAACTGGCCTTCTATAGTTAGG + Intronic
1086986871 11:93260807-93260829 GCAATTTTACTTCTATAGAAGGG - Intergenic
1087676452 11:101167780-101167802 TGATTTTGATTTCTATGGGTGGG + Intergenic
1088121625 11:106377003-106377025 TAACTTTGATTTCTATAAATAGG + Intergenic
1090155204 11:124430145-124430167 TGAATTTCACTTCTTTAGGGAGG - Intergenic
1090165083 11:124537962-124537984 TGAATTTCACTTCTTCAGAGAGG - Intergenic
1090987504 11:131783147-131783169 TAAACTTGATTTCTATATATTGG - Intronic
1091118091 11:133033477-133033499 TGATTTTGATTTCTATGGATAGG - Intronic
1091768140 12:3135255-3135277 TAAATTTGATTTGTAAAGATGGG + Intronic
1092082718 12:5731065-5731087 TGAATTTTAATTCCATAGACGGG - Intronic
1092513691 12:9185542-9185564 TGAATTTGGCCTCTCTAGCTAGG - Intronic
1094026661 12:25966800-25966822 TAAATTTGTTTTTTATAGATTGG + Intronic
1097519689 12:60651891-60651913 TAATTTTTACTTCTATAGAAGGG + Intergenic
1097756695 12:63415366-63415388 GCAATTTTACTTCTATAGAAGGG - Intergenic
1099203388 12:79701107-79701129 AGAATTTGGCTTTTTTAGATTGG - Intergenic
1099383141 12:81980247-81980269 GGAATTTTACTTCTATGAATGGG + Intergenic
1099710601 12:86219746-86219768 TGAATCTGACTTCCATTAATTGG - Intronic
1101319090 12:103657189-103657211 TGAATGTGAGTTCTAAAGAGAGG - Intronic
1103429489 12:120870767-120870789 TGAATTTGACTGCTCTAGCTAGG - Intronic
1104120678 12:125796391-125796413 TGAATTTCATTTCTATAGTGAGG - Intergenic
1104224695 12:126820014-126820036 GCAATTTTACTTCTATAGAAGGG - Intergenic
1107577112 13:41737460-41737482 TGAATTTGTCTTTTATAGATAGG - Intronic
1107817548 13:44257424-44257446 TCAAATTGAGTTCTAGAGATGGG - Intergenic
1110036434 13:70691434-70691456 TGCATTTTACGTCTTTAGATTGG + Intergenic
1110182609 13:72635515-72635537 TGAGTTAGACTTCTATAACTTGG + Intergenic
1114912644 14:27219926-27219948 GCAATTTTACTTCTATAGAATGG - Intergenic
1115375975 14:32675944-32675966 TGAAGTTGACTTCTCTCGTTAGG + Intronic
1115410721 14:33071463-33071485 TGAATATTATTTCTATAGCTCGG - Intronic
1115459851 14:33648535-33648557 TGACTTGGAATTCTATAAATTGG - Intronic
1116726204 14:48563892-48563914 GCAATTTTACTTCTATAGAAGGG - Intergenic
1117025216 14:51612537-51612559 TCAATTTCACTTCTATAAAATGG + Intronic
1117207857 14:53463225-53463247 AGAGTTTGCCTTCTAGAGATGGG + Intergenic
1119899330 14:78246428-78246450 TGTGTTTGCCTTCTACAGATAGG - Intronic
1122383108 14:101324033-101324055 GCAATTTTACTTCTATAGAAGGG - Intergenic
1123568623 15:21578760-21578782 GGAGTTTGACTTCTATAGGGAGG + Intergenic
1123604732 15:22014082-22014104 GGAGTTTGACTTCTATAGGGAGG + Intergenic
1123951758 15:25285433-25285455 TGAATATAAATCCTATAGATTGG - Intergenic
1125129894 15:36271856-36271878 TGATTTTTACTTATATAGAAGGG + Intergenic
1126940278 15:53759233-53759255 GGAATTGGACTTCTATGGAACGG - Intronic
1129956208 15:79638891-79638913 TGAATTTGAAATCTGTAGCTGGG - Intergenic
1202976978 15_KI270727v1_random:305847-305869 GGAGTTTGACTTCTATAGGGAGG + Intergenic
1133961209 16:10495126-10495148 GCAATTTTACTTCTATAGAAGGG - Intergenic
1134003936 16:10804789-10804811 TGAATTTCACTTCACTAAATTGG - Intronic
1134256119 16:12613037-12613059 GCAATTTTACTTCTATAGAAGGG - Intergenic
1135921774 16:26656774-26656796 AGAAATTGACTTCAATACATAGG - Intergenic
1136179106 16:28538811-28538833 TGAATCTGACCTCTATAGCCTGG - Exonic
1136866563 16:33762475-33762497 TAAATTTGCCTACTGTAGATAGG - Intergenic
1137377462 16:47965284-47965306 TGAATTGGATTTCCATAAATGGG + Intergenic
1203105597 16_KI270728v1_random:1353728-1353750 TAAATTTGCCTACTGTAGATAGG + Intergenic
1203127917 16_KI270728v1_random:1608640-1608662 TAAATTTGCCTACTGTAGATAGG - Intergenic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144465868 17:15496794-15496816 TGGATTTTTATTCTATAGATGGG + Intronic
1145072896 17:19826287-19826309 AGAATTTAACTTCTTTATATAGG + Intronic
1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG + Intronic
1148951720 17:51319132-51319154 GCAATTTTACTTCTATAGAAGGG + Intergenic
1150194643 17:63283790-63283812 TCAATTGTACTTCTATATATTGG - Intronic
1203193756 17_KI270729v1_random:212914-212936 TGAAATGGACTTAAATAGATTGG + Intergenic
1203203120 17_KI270730v1_random:12344-12366 TGAAATGGACTTAAATAGATTGG + Intergenic
1155279992 18:24229662-24229684 TGAAAATAACTTCTATGGATAGG - Intronic
1156212453 18:34959963-34959985 TGAATTTGATTTACACAGATGGG - Intergenic
1156212458 18:34960027-34960049 TGAATTTGATTTACATAAATGGG + Intergenic
1156294721 18:35778996-35779018 TGGATTTGAGTTCTCTGGATTGG + Intergenic
1156536551 18:37870129-37870151 TTTATTTGACTTCAATAAATTGG - Intergenic
1156611172 18:38726436-38726458 TGAAGTAGTTTTCTATAGATGGG + Intergenic
1156847587 18:41685924-41685946 TCAATTGTACTTCTATACATTGG + Intergenic
1157980361 18:52372801-52372823 TGAATTTGATTTGTATACCTCGG + Intronic
1158242243 18:55390015-55390037 TGAATTTGAATTCCATTGATTGG - Intronic
1158594951 18:58807885-58807907 TGACTTGGAGTTCTATACATTGG + Intergenic
1159072997 18:63646847-63646869 TGAAATTCTCTTCCATAGATTGG - Intronic
1159997821 18:74983582-74983604 AGAATATGACTTCTATACAGAGG + Intronic
1161172083 19:2817314-2817336 GCAATTTTACTTCTATAGAAGGG + Intergenic
1162719456 19:12653617-12653639 TAAATTTGTTTTCTAGAGATGGG + Intronic
1168235261 19:55059013-55059035 AGAATGTGGCTTCTATAGACAGG - Intronic
927382205 2:22492013-22492035 TGACTTTGAATACTCTAGATTGG - Intergenic
927950581 2:27165700-27165722 AAAATTTTACTTCTATAGAAGGG - Intergenic
928218421 2:29381882-29381904 TGAATTTGTCTTCTATGGGAAGG + Intronic
928510290 2:31996582-31996604 TGAAATTTCCATCTATAGATGGG - Intronic
930928147 2:56846607-56846629 GCAATTTTACTTCTATAGAAGGG - Intergenic
931023100 2:58073599-58073621 TGTATTAGGCTTCTATAGAGGGG + Intronic
932438762 2:71718610-71718632 TGAAATTGACTTTTATATCTTGG + Intergenic
932638236 2:73412343-73412365 TGAATTTGACTTCTTTCACTTGG + Intronic
932783039 2:74574898-74574920 TAAATGTCACTTCTATAGACAGG + Intronic
933073149 2:77888026-77888048 TGAATTTGGATTCTAGATATGGG + Intergenic
933132644 2:78691531-78691553 TGAATTTGAATTTTAAAGAGGGG + Intergenic
933242758 2:79941530-79941552 TGAGTTAGATTTCTATAGGTGGG + Intronic
933883476 2:86695491-86695513 GCAATTTTACTTCTATAGAAGGG - Intronic
934635253 2:95981059-95981081 TAAATTTGCCTACTGTAGATAGG - Intronic
934798375 2:97124160-97124182 TAAATTTGCCTACTGTAGATAGG + Intronic
934835053 2:97579316-97579338 TAAATTTGCCTACTGTAGATAGG - Intronic
939160128 2:138577839-138577861 TGGATTTGCCTTCTATATTTGGG + Intergenic
940041533 2:149366726-149366748 TTATTCTGACTTCTATAAATAGG - Intronic
940062334 2:149586595-149586617 TACATATGAATTCTATAGATAGG + Intronic
940631118 2:156240591-156240613 AGAATTTGACTTCCATAGTGTGG + Intergenic
940751394 2:157629781-157629803 TGAATTTAATTTCTATAAATTGG - Intergenic
941421960 2:165293664-165293686 TAAATTTGAATTCTTTATATGGG + Intronic
941424305 2:165322796-165322818 TGAAATTAACTTCTAAAGAAGGG + Intronic
941449990 2:165648918-165648940 TGAATTTGACTTCATTGGTTTGG - Intronic
941919524 2:170835435-170835457 TGAATTTCAATTCTCTATATTGG - Intronic
942779135 2:179620283-179620305 TGCATTAGACTTTTATAGATAGG - Intronic
943056516 2:182988427-182988449 TCAATTTGGCTTTTATATATTGG + Intronic
946295029 2:218777226-218777248 GCAATTTTACTTCTATAGAAGGG + Intergenic
946613837 2:221487936-221487958 TGCATTTGACTTCTATTTCTGGG - Intronic
946848845 2:223885548-223885570 TCAATTTGTAATCTATAGATAGG + Intronic
1168822440 20:784307-784329 GCAATTTTACTTCTATAGAAGGG + Intergenic
1168990387 20:2090210-2090232 TTCAGATGACTTCTATAGATTGG - Intergenic
1169512206 20:6276502-6276524 TAAACTTGACTTCTAGAGAAGGG - Intergenic
1170340598 20:15322711-15322733 TGAATTTGTCTTCTATTTAGTGG + Intronic
1170576591 20:17667357-17667379 TGAATATTAATTTTATAGATTGG - Intronic
1170608096 20:17888799-17888821 TGAAAGTGATTTCGATAGATTGG - Intergenic
1171921053 20:31099064-31099086 TGAACTTGACTGCAATAGAATGG + Intergenic
1171929560 20:31217234-31217256 TGAACTTGACTGCAATAGAATGG + Intergenic
1172006767 20:31823369-31823391 TGAACTTAACTTCCCTAGATGGG + Intronic
1175058708 20:56221635-56221657 GCAATTTTACTTCTATAGAAGGG - Intergenic
1176979598 21:15365938-15365960 GCAATTTTACTTCTATAGAAGGG + Intergenic
1177328530 21:19626628-19626650 TGAATTTTACTTCCATAGACGGG + Intergenic
1183209198 22:36440125-36440147 TGAATTTGACCTCCATTTATTGG + Intergenic
1183239431 22:36645869-36645891 TGCATTTGACTTTTAAAGTTTGG - Intronic
949609616 3:5691067-5691089 GCAATTTTACTTCTATAGAAGGG + Intergenic
950529061 3:13542326-13542348 GCAATTTTACTTCTATAGAAGGG + Intergenic
954550817 3:51480152-51480174 TGACTTTGACTTTCATAGGTAGG - Intronic
955151681 3:56373894-56373916 TGAATTTGACTTTTTTAAATGGG - Intronic
956020997 3:64933145-64933167 GCAATTTTACTTCTATAGAAGGG - Intergenic
956488837 3:69750188-69750210 TGAAATTGACTTTTTTAGAAAGG - Intronic
956527807 3:70184261-70184283 TGAATTTAACATATATAGACAGG + Intergenic
956796683 3:72724352-72724374 TGAAATTGACTTCTGTAGTCTGG - Intergenic
956925518 3:73983276-73983298 TGAATTTGATTTTTACACATGGG - Intergenic
957258320 3:77867495-77867517 TAAATTAGAGCTCTATAGATAGG - Intergenic
957605478 3:82393072-82393094 TGAATTTGACTACTCTAGTGAGG + Intergenic
960359586 3:116695506-116695528 TGAATTTGATTTTTATAGAATGG - Intronic
960665347 3:120103715-120103737 TGTATTTGACTTGCATATATGGG - Intergenic
963095247 3:141530958-141530980 TGAATTTCATTTCTATAAAGTGG + Intronic
963369539 3:144381061-144381083 TGAATTTTATTTGTTTAGATTGG - Intergenic
963525848 3:146412637-146412659 GCAATTTTACTTCTATAGAAGGG + Intronic
963837678 3:150073592-150073614 TGAGTTTGACTTCTTGAGACAGG + Intergenic
964521693 3:157576230-157576252 TGACTTTGACTTCCATATTTTGG - Intronic
964710074 3:159662327-159662349 GCAATTTTACTTCTATAGAAGGG - Intronic
965047248 3:163595132-163595154 TGAATCTGACTTGGAAAGATTGG + Intergenic
965274502 3:166663612-166663634 TAATTTTTACTTCTATAGAAGGG - Intergenic
966648864 3:182276485-182276507 TGAATTTGACTTATTTATAATGG - Intergenic
966764116 3:183443925-183443947 GCAATTTTACTTCTATAGAAGGG - Intergenic
967757502 3:193186378-193186400 TGAATTTGACATATTTTGATAGG - Intergenic
969291762 4:6244673-6244695 GCAATTTTACTTCTATAGAAGGG + Intergenic
969332364 4:6483211-6483233 TCAATATGACTTCTAAACATAGG - Intronic
970437118 4:16046413-16046435 AAAATTTGTCTTCTTTAGATAGG + Intronic
970493554 4:16602012-16602034 TTAATTTTACTTTTATAAATTGG + Intronic
970979215 4:22077248-22077270 TGGTTTTGACTTCTATGGTTGGG - Intergenic
973329859 4:48902099-48902121 TGAGTGTGACTTCTATAGTAAGG - Intronic
973934772 4:55832773-55832795 TTAATTTGCCTTCTTTGGATTGG + Intergenic
974369544 4:60997863-60997885 ATAATTTGATTTCTATATATAGG - Intergenic
974507490 4:62795369-62795391 TAAATCTGACTTCTAGAAATCGG + Intergenic
976521885 4:86037565-86037587 TGAATATTACTTATATATATGGG - Intronic
977149536 4:93492697-93492719 TTAAAATGACTTCTATTGATTGG - Intronic
979194580 4:117904880-117904902 TAAATTTGACCTTTAAAGATAGG - Intergenic
979736421 4:124091475-124091497 TCCATTAGACTTATATAGATAGG + Intergenic
980579845 4:134735033-134735055 TGAAGTTCACTTCTCTAGAAAGG + Intergenic
984076752 4:175191377-175191399 TGAGTTTGACTATTTTAGATAGG - Intergenic
984205467 4:176782563-176782585 TTAATTTGAATTCTATAATTGGG + Intronic
984207839 4:176808180-176808202 GCAATTTTACTTCTATAGAAGGG + Intergenic
984380301 4:178984573-178984595 TTAATTTGAATTCCATATATTGG - Intergenic
986526819 5:8687993-8688015 TAAATTTGACTTCATTAAATTGG - Intergenic
986972727 5:13355754-13355776 TGAATTTTACTTCTACAATTAGG + Intergenic
987065134 5:14282420-14282442 TGAATTTGAATACTATATAGTGG + Intronic
990573034 5:57097931-57097953 GCAATTTTACTTCTATAGAGGGG - Intergenic
991007964 5:61849717-61849739 TCAATTTCTTTTCTATAGATAGG - Intergenic
993050038 5:82915792-82915814 GCAATTTTACTTCTATAGAAGGG - Intergenic
993789408 5:92189372-92189394 TGAATTTCACTGCTACTGATAGG + Intergenic
996728926 5:126698491-126698513 TTAAATTGACATTTATAGATGGG + Intergenic
996811590 5:127521547-127521569 GCAATTTTACTTCTATAGAAGGG - Intronic
996908209 5:128626140-128626162 TGAATTTCAATTCTTTAGGTGGG + Intronic
1000190384 5:158904628-158904650 TGAATTTGACTTTTTTCGAAAGG + Intronic
1000222119 5:159224183-159224205 TGAACTTGACTTCTAGATCTGGG - Intergenic
1000440922 5:161262072-161262094 TGAGTTTTGCTTCTATAGAATGG + Intergenic
1000863985 5:166490176-166490198 TTAATTTGGATTTTATAGATGGG - Intergenic
1001043197 5:168351665-168351687 AGAATTTGACTTCCAGAGAAAGG + Intronic
1003313180 6:4986924-4986946 TGAATGTGACTGCCAGAGATGGG + Intergenic
1004786312 6:18971779-18971801 TGAATTTCACAATTATAGATGGG - Intergenic
1006729169 6:36222877-36222899 GTAATTCCACTTCTATAGATAGG - Intronic
1007365076 6:41385805-41385827 TGAATTTGACACCTTTAGGTGGG + Intergenic
1010553212 6:77248643-77248665 TGAACTTGACCTCTATACCTCGG - Intergenic
1011782417 6:90804762-90804784 TGAATTTATCTTCCAGAGATGGG + Intergenic
1012163522 6:95919251-95919273 TTAATCTGTCTTCTATAGATGGG - Intergenic
1012556338 6:100517162-100517184 TCAATTTGACTTAAATATATTGG - Intronic
1012672562 6:102073718-102073740 GCAATTTCACTTCTATAGAAGGG + Intergenic
1014326425 6:120001705-120001727 TGACTATGACTTCTATATTTTGG - Intergenic
1016563670 6:145426485-145426507 TTAATTTTACTTCCAGAGATGGG + Intergenic
1016909335 6:149181933-149181955 TGAATTTGATTTCTATAAACAGG - Intergenic
1017669883 6:156760760-156760782 TGAATTTGACTCCTGTAGTGTGG + Intergenic
1018640434 6:165899632-165899654 TGAATGTGACTTCTTTAGAAAGG - Intronic
1018827202 6:167417378-167417400 TGAGGTTTACTTCTATATATGGG + Intergenic
1018903247 6:168061608-168061630 TGGAGTGGAATTCTATAGATGGG - Intronic
1019795746 7:3046939-3046961 TGTTTCTGACTTTTATAGATGGG + Intergenic
1020463886 7:8454498-8454520 TAAATTTGACTTGTATTGATTGG + Intronic
1020542540 7:9477212-9477234 AGAAGTTGACTTCAATTGATGGG - Intergenic
1022184558 7:27954554-27954576 TGAATTTGACCTTTATATATGGG - Intronic
1024803811 7:53112098-53112120 TGAATTTCACTGCTGTAGGTAGG - Intergenic
1025235393 7:57231391-57231413 TGTATTGGACTTCTTGAGATGGG - Intergenic
1027682367 7:81237113-81237135 TAAATTTGAATTGCATAGATAGG - Intergenic
1028501513 7:91523955-91523977 TGAATTTTATTTCTATGAATTGG - Intergenic
1029139350 7:98399887-98399909 TGAACTTGGCTTTTATATATGGG - Intronic
1029968427 7:104764707-104764729 TGAATTTGAGGTCAGTAGATAGG - Intronic
1030288826 7:107852092-107852114 TGAATTTGACTACTCAAGGTAGG + Intergenic
1030724326 7:112907762-112907784 TGAATTTTTCTCCGATAGATTGG - Intronic
1031103680 7:117513145-117513167 TGTATTTGACATGTATACATGGG + Intronic
1031337846 7:120558707-120558729 TGAATTTGTCCTTTATAGGTGGG + Intronic
1033441850 7:141387332-141387354 TGCATTTTTATTCTATAGATAGG + Intronic
1034421006 7:150990725-150990747 GCAATTTTACTTCTATAGAAGGG + Intergenic
1037012577 8:13862328-13862350 TGAATTTGGCTTCTTTTGACAGG + Intergenic
1037561904 8:20082926-20082948 TGTAATTGACTTGGATAGATTGG - Intergenic
1038831656 8:31068551-31068573 TGTATTTGGCTTCTAGAGTTGGG + Intronic
1040717505 8:50275085-50275107 TGAATTAGACTTCTATATTTTGG + Intronic
1040945114 8:52876112-52876134 TGTATGTGATTTCTATTGATGGG + Intergenic
1042824454 8:72965991-72966013 TTTATTTCACTTTTATAGATAGG - Intergenic
1045578714 8:103454508-103454530 TGAAACTGACTTCTATAAAGCGG + Intergenic
1046207882 8:111026563-111026585 TTAATTTGCCTTCTATGAATAGG + Intergenic
1047138126 8:122104443-122104465 TGAAATTGACATCTATTGAGGGG - Intergenic
1049718859 8:144106447-144106469 TGAATGTGACATCTACAGGTGGG + Exonic
1049978587 9:883172-883194 TGAAGTTGGCTTTTAAAGATAGG - Intronic
1051088006 9:13374306-13374328 TTAATATGACTTCTACATATAGG + Intergenic
1051915674 9:22204136-22204158 TGAATTTGACTTCTATATTTTGG + Intergenic
1052662233 9:31448886-31448908 TGAATTTTAGTTCTAAATATGGG + Intergenic
1053332882 9:37232407-37232429 GGAAATTGATTTCTACAGATAGG + Intronic
1055049883 9:71968705-71968727 GCAATTTTACTTCTATAGAAGGG + Intronic
1055742269 9:79402929-79402951 TGAAATTGCCTTCTACAAATGGG + Intergenic
1055800979 9:80035480-80035502 TGGATTTGATTTTTATATATTGG - Intergenic
1059188470 9:112300191-112300213 TATATTTGACTTTAATAGATTGG - Intronic
1059218748 9:112591878-112591900 TGCAAGTGACTTCTATAGAAGGG + Intronic
1059572565 9:115455867-115455889 TGAACTTCACTTCTATAGAATGG + Intergenic
1059814973 9:117902061-117902083 AGAATTTGGCTTCAATAAATGGG - Intergenic
1188165082 X:26852510-26852532 TTAATTACACTTCTATAGTTTGG - Intergenic
1189835183 X:45013036-45013058 AGAATTTGAATTCTATAAGTAGG - Intronic
1194247159 X:91529693-91529715 TTGATTTGATTTCTATATATGGG + Intergenic
1194621569 X:96179146-96179168 TTAATTTGACGTGTATATATAGG + Intergenic
1194644501 X:96442123-96442145 TGAATTTGACTTGTAAACATTGG - Intergenic
1196976962 X:121168944-121168966 TAAATATTATTTCTATAGATAGG + Intergenic
1199288721 X:146082585-146082607 TGCCTTTGACTTCTGTAAATTGG + Intergenic
1200135983 X:153874996-153875018 TGATTTTGACTTCCTTACATGGG - Intronic
1200383747 X:155868001-155868023 GCAATTTTACTTCTATAGAAGGG + Intergenic
1200566181 Y:4771231-4771253 TTGATTTGATTTCTATATATGGG + Intergenic
1200733822 Y:6772659-6772681 TGAATCTGACTACTCTTGATTGG + Intergenic
1202585423 Y:26420098-26420120 TAAATTTGCCTACTGTAGATAGG + Intergenic