ID: 1146082302

View in Genome Browser
Species Human (GRCh38)
Location 17:29791411-29791433
Sequence TCTTCTTTGTTACCTGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146082298_1146082302 11 Left 1146082298 17:29791377-29791399 CCCCTGGCAAAAATAACAGATTA 0: 1
1: 0
2: 0
3: 26
4: 266
Right 1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG 0: 1
1: 0
2: 2
3: 18
4: 221
1146082299_1146082302 10 Left 1146082299 17:29791378-29791400 CCCTGGCAAAAATAACAGATTAT 0: 1
1: 0
2: 1
3: 31
4: 347
Right 1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG 0: 1
1: 0
2: 2
3: 18
4: 221
1146082297_1146082302 17 Left 1146082297 17:29791371-29791393 CCACTGCCCCTGGCAAAAATAAC 0: 1
1: 0
2: 8
3: 110
4: 1021
Right 1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG 0: 1
1: 0
2: 2
3: 18
4: 221
1146082300_1146082302 9 Left 1146082300 17:29791379-29791401 CCTGGCAAAAATAACAGATTATT 0: 1
1: 0
2: 2
3: 36
4: 456
Right 1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG 0: 1
1: 0
2: 2
3: 18
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146082302 Original CRISPR TCTTCTTTGTTACCTGGAAC TGG Intronic
901352083 1:8606214-8606236 TGTTCTTTGTCACCTGTATCTGG - Intronic
904397844 1:30234643-30234665 TCTTCTTTGATAACTTGACCAGG + Intergenic
904670769 1:32163304-32163326 TCCTCTTTCTTACCTGGGTCTGG - Exonic
906866440 1:49425841-49425863 TAGTCTTTGTCACATGGAACTGG + Intronic
907178817 1:52552755-52552777 ACTTCTTTCTTTCCTGGAACGGG - Intronic
908520098 1:64933240-64933262 TCTTTTTTCTTCCCTGGAAAGGG - Intronic
910712872 1:90199886-90199908 TGTTCTTTGTTACCTGTTAGAGG + Intergenic
911669230 1:100589503-100589525 CCATCTTTGTGACCTTGAACAGG + Intergenic
913118960 1:115722058-115722080 TCATCTTTGTTTCCTTGAAAGGG - Intronic
915040832 1:152967103-152967125 TCTTCTTTCATTCCTGGAAATGG + Intergenic
915117242 1:153608647-153608669 TCTGCTTTGTTGCCTGGGGCTGG - Intronic
919046923 1:192464083-192464105 TCTTCTTTTCTAGCTGGTACAGG - Intergenic
919590052 1:199490381-199490403 TTTTCTTTGCTACCTGGTAATGG - Intergenic
921619003 1:217306027-217306049 TCTTCTCTCTTTCCTGGAGCTGG + Intergenic
922135194 1:222818330-222818352 ACTCCTTTGTTACCTGGAGAGGG + Intergenic
923508363 1:234626593-234626615 TCTTCTTTGTTACATGTAGTAGG + Intergenic
923980614 1:239318251-239318273 TCTTCTTTATTTCCTTGAACAGG + Intergenic
1062800932 10:379806-379828 TCTGCTTTGATACCAGGAGCAGG + Intronic
1063980588 10:11448682-11448704 TATTCTGTGTAACCTGAAACTGG + Intergenic
1064263812 10:13808514-13808536 TCTTCTTTCCTACCAGGAAAAGG + Intronic
1064651068 10:17510330-17510352 TCTTTTTTGCTACCTGTAAAAGG - Intergenic
1065294318 10:24259886-24259908 TCTTCTTTATTCTGTGGAACTGG + Intronic
1069044172 10:63724635-63724657 ACAGCTTTGTGACCTGGAACTGG + Intergenic
1071742926 10:88381766-88381788 TATACTTAGTTACCTAGAACAGG + Intronic
1072572853 10:96673635-96673657 TCTTCTTGGTTTCCTGGTTCAGG + Intronic
1073383894 10:103106335-103106357 TCTCCTTTTTTACCTGTAAGTGG + Intronic
1073993054 10:109285824-109285846 TATTCTATCTTACCTGGAAATGG + Intergenic
1080809573 11:35689942-35689964 TGTTCATTGTTTCCTGTAACTGG + Intronic
1082066155 11:47902235-47902257 TCATCTCTGTTACCTGAAACTGG + Intergenic
1082705012 11:56483383-56483405 TCATATTTGTTTCCTGGGACAGG - Intergenic
1083832605 11:65242314-65242336 TCTCCTTTGGTCCCTGGGACTGG - Intergenic
1084066486 11:66707369-66707391 TTTACTTTGTTCCCTGCAACTGG + Intronic
1086582900 11:88420046-88420068 TTTTTTTTTTTACCTGAAACTGG - Intergenic
1088400044 11:109413556-109413578 TTTTTTTTTTTTCCTGGAACAGG - Intergenic
1091443018 12:526392-526414 TCTTCTTTCTGGCCTGGGACAGG - Intronic
1092446057 12:8558645-8558667 TCTTGTGTCTGACCTGGAACAGG + Intergenic
1094185059 12:27633163-27633185 TCTTCTTTATTAACTGATACAGG + Intronic
1094310465 12:29075066-29075088 TCTTCAGTGAGACCTGGAACAGG + Intergenic
1094585390 12:31772931-31772953 TCTTTTTTCCTGCCTGGAACCGG - Intergenic
1094795844 12:33971646-33971668 TCTGTTTTGGTACCTGGACCGGG + Intergenic
1095772092 12:45971335-45971357 TATTCCATCTTACCTGGAACTGG - Intronic
1097026883 12:56063305-56063327 TCTTCTTTTTCACCTGGAACAGG - Intergenic
1097288870 12:57897449-57897471 TCTTCTGTTTAGCCTGGAACAGG - Intergenic
1097564221 12:61248400-61248422 TCTTCTTCGTCATCTGGCACTGG - Intergenic
1100687795 12:97005471-97005493 TCTTTTCTGTTGCCTGCAACTGG - Intergenic
1106151709 13:27110116-27110138 TTTTTTTTTTTACCTGGAAAAGG - Intronic
1106169365 13:27275692-27275714 TATTCTCTGGTCCCTGGAACTGG + Intergenic
1106460077 13:29960791-29960813 TCTGCTCTGTGACCTGGAGCAGG - Intergenic
1107883305 13:44852439-44852461 TCTTCTTTGACACCTGGGAATGG - Intergenic
1108695536 13:52899467-52899489 GCATCTTTGTTTCGTGGAACTGG - Intergenic
1108715285 13:53072589-53072611 TCTGCTTTGTCACATGGAACTGG + Intergenic
1109064824 13:57673493-57673515 TGTTCTTGGTTACGTGGAAGTGG - Intronic
1109167002 13:59047856-59047878 GCTTCTCTTTTACCTGCAACTGG + Intergenic
1109310871 13:60691651-60691673 TCTGCTTTGTTCCATGGAAGAGG + Intergenic
1109402828 13:61857624-61857646 TCTTCTTTTTTACCTCAACCTGG + Intergenic
1110456765 13:75697634-75697656 TTTTCTTTGTTATCTTGAAAGGG + Intronic
1110664304 13:78098439-78098461 TTTCCTTTGTGAACTGGAACAGG + Intergenic
1111464532 13:88592037-88592059 CCAGCTTTGTTACCTGGAACTGG + Intergenic
1111687648 13:91521087-91521109 TATCCTTTGTTATGTGGAACAGG + Intronic
1112216522 13:97435507-97435529 TCTGTTTTGTTTCCAGGAACTGG - Intronic
1114261710 14:21041766-21041788 CCTTGGTTGGTACCTGGAACTGG + Intronic
1114733704 14:25021450-25021472 TCTTCTATTTTTCCTGTAACGGG - Intronic
1115361495 14:32508451-32508473 TCTTCTGTCTTTCCTGCAACCGG - Intronic
1116747961 14:48845895-48845917 TCTGCTTTGGTACTTGGTACTGG - Intergenic
1118399927 14:65369987-65370009 TCATCTTTGTTACCGGAAAGGGG - Intergenic
1118884092 14:69852140-69852162 TCCTCTATGTTCCCTAGAACGGG - Intergenic
1119741770 14:77018284-77018306 TGTTCTTTGTTTTTTGGAACAGG - Intergenic
1120542696 14:85769873-85769895 CCTTCTTTTTTATCTGGAAATGG + Intergenic
1121229835 14:92349069-92349091 TTTTTTTTTTTACCTGGAAGAGG - Intronic
1121440079 14:93943118-93943140 TGTGCTTTGTAACCTGGACCTGG - Intronic
1124047290 15:26162019-26162041 TCTGTTTTCTTACATGGAACTGG + Intergenic
1124255886 15:28142360-28142382 TCTTGCTTGTGACCTGGAGCTGG - Exonic
1124568359 15:30836766-30836788 TCTTGCTTGTGACCTGGAGCTGG + Intergenic
1130083204 15:80753334-80753356 TCTTGTTTGGATCCTGGAACAGG + Intronic
1130889051 15:88117882-88117904 TCTGCTTCCTTCCCTGGAACAGG + Intronic
1130972966 15:88749011-88749033 TCATCTCTGTGACCTGGGACAGG - Intergenic
1131918587 15:97298259-97298281 CCTTCTTTGTTTCCTGTAACAGG + Intergenic
1133564674 16:6982264-6982286 CAATCTTTGTTACCTGGAAAAGG - Intronic
1134055297 16:11166262-11166284 CCTGCTCTGTTCCCTGGAACAGG - Intronic
1134137068 16:11684164-11684186 TCTTGTTTTTTCCCTGCAACAGG - Exonic
1137712550 16:50576340-50576362 TCTTCTTTGCTATCTGGAGGAGG - Intronic
1137968884 16:52964063-52964085 GCTTCTTTGTTTGCTGGAATGGG + Intergenic
1138638177 16:58361154-58361176 TCTTCTTAGCCACCTGGAGCTGG + Intronic
1140783644 16:78318953-78318975 TATGCTTTGTTACATGGAAGAGG + Intronic
1141084126 16:81079264-81079286 TCCTCTTTCTTCCCTGCAACAGG - Intergenic
1142220176 16:88850406-88850428 TGTTATTTGTGGCCTGGAACAGG - Intronic
1143365870 17:6408147-6408169 TTTTCTTTGATACCTGGACAGGG - Intronic
1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG + Intronic
1146083567 17:29805813-29805835 TCTCCTTGGTTACCTAGCACAGG - Intronic
1146431315 17:32797979-32798001 ATTTCTTTCTTACCTGTAACTGG - Intronic
1153111812 18:1599381-1599403 TCTCCTTTCTGTCCTGGAACAGG + Intergenic
1153146509 18:2039012-2039034 CCTTCTATCTTACCTGGCACTGG - Intergenic
1153528663 18:6021526-6021548 TCCCCTTTGTAACCTGCAACAGG + Intronic
1154355967 18:13623468-13623490 TTTTCTGAGTAACCTGGAACTGG + Intronic
1155077171 18:22369200-22369222 TCTCCTAGGTTACCTGGGACTGG + Intergenic
1156373366 18:36490832-36490854 GCTTCTTTGTTACCTTCAGCAGG - Intronic
1156683888 18:39621190-39621212 TTTTCTTAGTTACCTGAAAAAGG - Intergenic
1157091308 18:44640238-44640260 TCTTCTTTCTTACCTGCAGTGGG - Intergenic
1157726890 18:49971287-49971309 ATTTCTTGGTTACCTGGAAGTGG - Intronic
1157789545 18:50519381-50519403 TCAGCCTTGTTCCCTGGAACAGG - Intergenic
1158725280 18:59965849-59965871 TCTTGTTTGTTAATTGGAAAAGG + Intergenic
1158886344 18:61830443-61830465 TCTTATGAGGTACCTGGAACAGG - Intronic
1159995225 18:74957939-74957961 GCTTCCTTGTTACCTGGCAGAGG + Intronic
1161439627 19:4283311-4283333 TCTACTTTGTAAACTGAAACAGG - Intronic
1161801366 19:6418252-6418274 TCTGCTTTTTTATCTGGAAACGG - Intronic
1161856040 19:6766208-6766230 TCCTGTTTGTCACCTGGACCAGG + Intronic
1164486077 19:28656891-28656913 GCAGCTTTGTGACCTGGAACTGG + Intergenic
1165523396 19:36331815-36331837 TCTTCTGTGTTGCCTGGAAACGG - Intergenic
1165573852 19:36797421-36797443 CCTTCTGTGTTGCCTGGAAACGG + Intergenic
1166592228 19:44009592-44009614 TGTTATTTGTTACCAGCAACAGG - Intronic
1167049946 19:47072107-47072129 TCTTCTAGGTTCCCTGGACCCGG - Exonic
927321884 2:21756620-21756642 TCTTTTGTGTTACCTGGAAATGG + Intergenic
928471996 2:31584037-31584059 ACTTTTCTGTTACCTGGACCTGG + Intergenic
930386510 2:50702252-50702274 TCATCTATGTTATCTGGAAAAGG - Intronic
930416889 2:51100268-51100290 CCTTCTTATATACCTGGAACTGG + Intergenic
931433245 2:62226471-62226493 TCTTGTTTCTTGCCTAGAACAGG + Intergenic
931836365 2:66102835-66102857 TTTTCTGTGTTCCCTGGGACAGG + Intergenic
931920372 2:67008841-67008863 TCTTCTTTATGACCTTTAACTGG - Intergenic
938140919 2:128794085-128794107 TTTGATTTGTCACCTGGAACTGG - Intergenic
939403348 2:141724050-141724072 TTTTCTTTCTTATCTGGTACAGG - Intronic
942585571 2:177472631-177472653 TCCTATTTGTTACTTGGAAAGGG + Intronic
943864448 2:192911152-192911174 TCTGCTTTGACATCTGGAACAGG - Intergenic
944861591 2:203820240-203820262 TCTTCTCTTTTACCTGGCACTGG + Intergenic
945435573 2:209813558-209813580 TCTTCTTTCTGCCATGGAACAGG + Exonic
945720990 2:213418334-213418356 CCTTCTCTGTTACCAGGATCTGG + Intronic
1169494657 20:6103168-6103190 TCTACCTTGTTCCCTGGAAATGG + Intronic
1169892906 20:10472802-10472824 CCTTCTTTGTTACCTGATACAGG + Intronic
1172238463 20:33394974-33394996 TTTCCTTTGTTTCCTGGACCTGG - Intronic
1174520469 20:51126214-51126236 TCTTTCTTGTTTCATGGAACTGG + Intergenic
1176522570 21:7835727-7835749 TCTTCTATGTTATCAGGAATTGG - Intergenic
1177259765 21:18714025-18714047 TATTCTTTGTTTCCTGAACCAGG + Intergenic
1178656590 21:34465739-34465761 TCTTCTATGTTATCAGGAATTGG - Intergenic
1182527736 22:30931998-30932020 TCTTCACTGTTGCCTGGGACAGG + Intronic
1182584202 22:31334420-31334442 TGTTCTTGGTGTCCTGGAACTGG - Intronic
1183413413 22:37668723-37668745 TCTGCTCTGCTACCTGCAACAGG - Intergenic
950287372 3:11755404-11755426 TCTTCTTTCTCTCCTGCAACAGG - Intergenic
950730982 3:14957295-14957317 TGTTCATTGTTATCTGAAACTGG + Intronic
951076122 3:18394829-18394851 TCGGCTGTGTTCCCTGGAACTGG + Exonic
952667377 3:35922828-35922850 CCATCTTGGTGACCTGGAACTGG - Intergenic
953883591 3:46703697-46703719 TCCTCTGGGTTACCTGGGACAGG + Intronic
954585704 3:51734473-51734495 TCTTCTTCCTTAGGTGGAACAGG + Intergenic
955710031 3:61769011-61769033 TCTTCTTTATTTCTTGGAAATGG + Intronic
955784159 3:62518668-62518690 GCTTCTTCCTTACCTGGGACAGG + Intronic
957147149 3:76439408-76439430 TCTTCTTTGTAACCTTCAGCAGG - Intronic
958503122 3:94939698-94939720 TTCTCTTTGTTGCCTGTAACTGG - Intergenic
959215964 3:103450070-103450092 TCTGCTATGCCACCTGGAACTGG - Intergenic
959256120 3:104016879-104016901 TCTACTTTTTTTCCTGGAAATGG - Intergenic
960255948 3:115511893-115511915 TCTTCTTTGCTTCCAGGAATAGG + Intergenic
961953062 3:130770762-130770784 TCATCTTTGTCACCTGAAACTGG - Intergenic
962637479 3:137345947-137345969 ACTTCTCTGTGACCTGAAACAGG - Intergenic
963020814 3:140871519-140871541 CCTTCCTTGTTATCTGGAAGTGG - Intergenic
963029911 3:140959531-140959553 TTTTTTTTTTTACCTGGAAGGGG - Exonic
967800996 3:193659826-193659848 TCTTCCTTTTTACCTCAAACAGG - Intronic
971745147 4:30569927-30569949 TATTCTTTGTTACCTCTAAAAGG + Intergenic
973147188 4:46841975-46841997 TGTTTTTTGTTTCCTGGACCTGG - Intronic
973960731 4:56107293-56107315 TTTTCTATGTGACCTTGAACAGG + Intergenic
974520987 4:62979419-62979441 TCTACTTTGTTACCTTGCAGCGG + Intergenic
975132380 4:70842197-70842219 TGTTCTTGGATACCTGGAAAGGG + Intergenic
976460149 4:85302024-85302046 TCTTTTTTTTTTCCTGGAAAAGG + Intergenic
976550771 4:86392586-86392608 TCTTTTTTGTTTGCCGGAACAGG - Intronic
978440039 4:108724411-108724433 TTTTTTTTTTTACCTTGAACTGG + Intergenic
978752274 4:112263500-112263522 ATTTCTTTTTTTCCTGGAACTGG + Intronic
978834481 4:113132526-113132548 ACTACTTTGTACCCTGGAACTGG + Intronic
980481650 4:133395418-133395440 GCTTCTATGTTGCTTGGAACAGG + Intergenic
981716258 4:147755549-147755571 TCTTCTTGATAACATGGAACTGG - Intronic
981747612 4:148066717-148066739 TCTTCTGTGTGACCTGGGACAGG + Intronic
984932106 4:184857220-184857242 TCTTCTTTGTTACCTGAGGAGGG - Intergenic
986403289 5:7399958-7399980 TCTACTTTGTTTTTTGGAACTGG + Intronic
987114662 5:14716693-14716715 TGTTTTTCTTTACCTGGAACTGG + Exonic
988522076 5:31955147-31955169 TCTTCTTTCTTTTTTGGAACAGG + Intronic
988962326 5:36382557-36382579 TATTCTTTCTTATCTGCAACCGG - Intergenic
989494292 5:42093702-42093724 AGTTTTTTGTTACCTGGAATTGG + Intergenic
992107366 5:73461011-73461033 TCCTCCTTCTTACCTGGGACTGG + Intergenic
992591748 5:78302693-78302715 TCTTTGTTGCTACGTGGAACAGG - Intergenic
993811239 5:92479187-92479209 CCTTCTTTGTTTCCTGTAACAGG - Intergenic
994296238 5:98091882-98091904 TCATCTTTTGTACCTGGAACAGG + Intergenic
995640139 5:114246959-114246981 TCTGATTTGTTACCTGGAAATGG + Intergenic
997309890 5:132870954-132870976 GCTTTTTTGCTAGCTGGAACTGG - Intergenic
1001423960 5:171611342-171611364 TCTTATTTGTCACCTGGGGCAGG + Intergenic
1003222657 6:4175169-4175191 TCTTCTTTCTAACCTTGAAAAGG + Intergenic
1003462344 6:6341700-6341722 TTTTCTTTGTAACCTGGAAGTGG - Intergenic
1003866524 6:10368330-10368352 ACTTCTTTATTGCCTAGAACTGG - Intergenic
1004158899 6:13195998-13196020 TTTTCCTTGTTCTCTGGAACTGG + Intronic
1004341619 6:14812978-14813000 TCCTCTGTGTCACCTAGAACCGG + Intergenic
1006065452 6:31458783-31458805 TTTTATTTGTCACCTGGACCTGG + Intergenic
1007102994 6:39263060-39263082 TCACCCTTGTCACCTGGAACTGG - Intergenic
1009520134 6:64671125-64671147 TCTACTTTTTTACCTGGAGGAGG + Intronic
1010112614 6:72257610-72257632 TCTTCTTTGTTAATTAAAACTGG + Intronic
1012910059 6:105108177-105108199 TCTTCTTTGTGAGCAGGAAGAGG - Intronic
1014002189 6:116376440-116376462 TCTTCTTTGTGATCTCTAACAGG - Intronic
1016391138 6:143577239-143577261 TCTTTTTTGTTGCCTGGCACAGG - Intronic
1021038514 7:15831438-15831460 CCTTCTTTGTAACTTGGGACAGG - Intergenic
1022758830 7:33325855-33325877 TCTGCTGTGTTTCCTGGAGCTGG + Intronic
1024522706 7:50319996-50320018 TCTTCTGAGTTCCATGGAACTGG + Intronic
1024757071 7:52546705-52546727 TCTTCTTTTTAACATTGAACTGG - Intergenic
1028152669 7:87392353-87392375 TCTTATTTCTTTCCTGGAATAGG - Intronic
1028394161 7:90348913-90348935 TCTTCCTTGTTATCTGGCACTGG + Intronic
1029881365 7:103814467-103814489 TATTCTTGGTTTTCTGGAACAGG - Intronic
1030153756 7:106431212-106431234 CCTTATTTATTTCCTGGAACTGG + Intergenic
1032753082 7:134862221-134862243 TCTTGTTTGTTCCCTGAAATGGG + Intronic
1032805458 7:135349689-135349711 TTTTCTTTTTTTCCTTGAACTGG - Intergenic
1036680752 8:10871499-10871521 ACCTCTTTGTTGCCTGGAAAGGG - Intergenic
1036755863 8:11470740-11470762 TCTTCATTGCTGCCTGGAGCAGG - Intronic
1038240006 8:25799543-25799565 TCTGCCTTGTTATTTGGAACTGG + Intergenic
1038882957 8:31635053-31635075 ATTTCTTTGTTATCTGGAAAGGG + Intergenic
1039395373 8:37221012-37221034 CCATCTATGTTACCTGGATCAGG + Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1040455345 8:47592532-47592554 TCTGCTTTGATGCCAGGAACTGG + Intronic
1040894672 8:52353843-52353865 TATTCTCTGTTTCCTGCAACCGG - Intronic
1041221467 8:55655888-55655910 TCTTCTCTGTTACCTCCAAAAGG + Intergenic
1042078181 8:65019010-65019032 TTTTCTCTGTTACCTGGATAAGG + Intergenic
1044836983 8:96305428-96305450 CCTTGTTTGCTACCTGGAGCTGG + Intronic
1045339781 8:101243198-101243220 TTTGCTTTGTCTCCTGGAACAGG - Intergenic
1046114041 8:109764594-109764616 TGTGCTGAGTTACCTGGAACTGG + Intergenic
1047875527 8:129133015-129133037 TTTTTTTTTTTACTTGGAACTGG - Intergenic
1048137169 8:131757764-131757786 TCTTCTTTGTTCCCTGTAACAGG - Intergenic
1050010032 9:1176189-1176211 TTTTCTTGGTTATCTGGAAGGGG + Intergenic
1050882682 9:10722528-10722550 TCTTTTTTGTCACCTTTAACTGG - Intergenic
1051381005 9:16458463-16458485 TCTTCATTGTTGTCTGAAACTGG + Intronic
1055369503 9:75582147-75582169 TCCTTTTTGTTACCAGGAAAAGG + Intergenic
1056180787 9:84080323-84080345 TATTCAATTTTACCTGGAACTGG + Intergenic
1056798929 9:89677988-89678010 TCTTCATTGTTCTCTGGAGCAGG + Intergenic
1058649993 9:107166764-107166786 ACTTCATTGTCAGCTGGAACTGG - Intergenic
1059219475 9:112600163-112600185 TCTTTTCTGTGACTTGGAACTGG + Intronic
1059497370 9:114720804-114720826 TCTTCTGTGTTTCCTGGATGAGG - Intergenic
1186336869 X:8598968-8598990 TCTTCTTTATTAGCTGGATATGG + Intronic
1187996026 X:24927424-24927446 TCTGTTTTGATACCTGGCACAGG - Intronic
1189622943 X:42862870-42862892 TCAGGTTTGTTACCTTGAACAGG - Intergenic
1194398568 X:93415102-93415124 TCTTCTTAGCTACCTAGACCTGG - Intergenic
1194894925 X:99429028-99429050 CCTTCTCTGTCACCTGGAAGTGG + Intergenic
1195601865 X:106757862-106757884 TTTCCTTTAATACCTGGAACAGG + Intronic
1195995158 X:110724348-110724370 TCTTCTGAGTAACCTGGCACTGG + Intronic
1197997389 X:132392691-132392713 TCTTCTTTGTTTCCTTACACAGG + Intronic
1198033970 X:132782909-132782931 TCTTCTTTGGTTCCTGAATCTGG - Intronic
1198454648 X:136804343-136804365 TTTTATTTATTATCTGGAACAGG + Intergenic
1198694241 X:139318917-139318939 TCTTCTTTCTGACCTGACACTGG - Intergenic
1199070024 X:143465255-143465277 TATTCTTTGCTACCTGAAAGAGG + Intergenic
1199107211 X:143884155-143884177 TCTGCTTTGATGCCAGGAACTGG - Intergenic
1199202770 X:145112354-145112376 TAGTCTTTGGTACATGGAACAGG - Intergenic
1199590474 X:149463284-149463306 TCTTCTTAATTACCTGTAAGGGG - Intergenic
1199590482 X:149463357-149463379 TCTTCTTAATTACCTGTAAGGGG + Intergenic
1200312961 X:155098477-155098499 TTTCCTCTGTTACCTAGAACAGG + Intronic