ID: 1146086340

View in Genome Browser
Species Human (GRCh38)
Location 17:29833730-29833752
Sequence AAGAAGGAAGGGAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27860
Summary {0: 1, 1: 26, 2: 595, 3: 5518, 4: 21720}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146086340 Original CRISPR AAGAAGGAAGGGAGGGAAGT AGG (reversed) Intronic
Too many off-targets to display for this crispr