ID: 1146086722

View in Genome Browser
Species Human (GRCh38)
Location 17:29837544-29837566
Sequence CCCTGTGGCCCATGTCCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 2, 2: 7, 3: 34, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146086722 Original CRISPR CCCTGTGGCCCATGTCCCCG AGG Intronic
900333742 1:2150438-2150460 CCCTGGGCCACATGTCCCTGTGG + Intronic
900370764 1:2331165-2331187 CCATGTGCCCCATGTCCACCTGG - Intronic
900506277 1:3031181-3031203 CGCTGTGGCCCCTGTGTCCGGGG + Intergenic
900688804 1:3966884-3966906 CCATGTGGCCCCTTGCCCCGTGG + Intergenic
901510576 1:9716377-9716399 CCCTGTGCCCCAGAACCCCGGGG + Intronic
901957528 1:12797377-12797399 GCCTGTGCTCCATGTCCCTGAGG + Intergenic
901988510 1:13093729-13093751 GCCTGTGCCCCATGTCCCTGAGG - Intergenic
901993302 1:13133038-13133060 GCCTGTGCCCCATGTCCCTGAGG + Intergenic
902892178 1:19452334-19452356 CCCTGGAGCCTATGTCCCAGTGG - Intronic
903952294 1:27003180-27003202 CACTGTGGCACATGTACCTGAGG - Intergenic
915323573 1:155069383-155069405 CCCTGTGGGCCTTTTCCCTGGGG + Exonic
915462126 1:156076550-156076572 CCCCGTGCCCCATGCCTCCGGGG - Exonic
915637227 1:157195458-157195480 GCCTGTGCCCCATGTCCCCAAGG + Intergenic
919315457 1:195966644-195966666 CACTGGGGCCCATGTCACTGTGG + Intergenic
919453780 1:197800509-197800531 CCATGTGCCCCAGGTCCCCAAGG + Intergenic
919513647 1:198495036-198495058 CCCTGTGCCCTCTGTCCCTGAGG - Intergenic
919813333 1:201422581-201422603 CCCTGTGGCTCCAGTCCCCTGGG - Intronic
920298868 1:204976332-204976354 CCATGAGGCCCATGACCCCAAGG - Intronic
920339658 1:205267930-205267952 CCCTGCTGGCCAGGTCCCCGAGG - Intronic
922488062 1:225991882-225991904 ACCTGGGGCCCATGGCCCCATGG + Intronic
923032902 1:230263983-230264005 CCAGGTGGCCCATGCCCCCTAGG + Intronic
923765296 1:236887695-236887717 CTCAGTGGCCCATGGCCCTGGGG - Intronic
924179105 1:241423927-241423949 CCCTGTGCGCCGTGTCCCCAAGG + Intergenic
1063458970 10:6203506-6203528 CGCTGTGGCCCTTGTCCCGGTGG + Intronic
1064262533 10:13797528-13797550 CCCTGGGGGCCATGTCTCGGAGG + Intronic
1064442908 10:15370431-15370453 CCCTGTGTCCCGGGGCCCCGAGG - Intronic
1064442965 10:15370595-15370617 CTCTGTCTCCCATGTCGCCGCGG - Intronic
1066064783 10:31754182-31754204 AGCTGTGCCCCATGTCCCCAGGG - Intergenic
1067233295 10:44426684-44426706 CACTATGGCCCATGTTCCAGTGG - Intergenic
1068083274 10:52346548-52346570 CCCCATGCCCCGTGTCCCCGAGG + Intergenic
1068788474 10:61001781-61001803 CCCTGTGGCCCCAGTGCCTGCGG + Intergenic
1071259905 10:83910251-83910273 CCCTGTGGCCCATGTCATTCTGG + Intergenic
1072659847 10:97357077-97357099 CCCTGAGGCCCAGGGCCCCTGGG - Exonic
1075961514 10:126571363-126571385 CCCGGTGGCCCAAGTCACCCAGG + Intronic
1076280821 10:129244431-129244453 TCCTGTGGCCCATGCCCATGGGG - Intergenic
1076549323 10:131267746-131267768 CCCTGTGCCCCATGTCCCCAAGG - Intronic
1076885397 10:133259905-133259927 TCCTGTGGCCACTGTGCCCGAGG + Intergenic
1077012326 11:384852-384874 CCCAGTGCCCCATGTCCCCAAGG + Intergenic
1077488571 11:2850199-2850221 CCCTGTGGGCCAGGGTCCCGGGG - Intergenic
1079305387 11:19317053-19317075 CTCTCTGGCCCATCTCCCCTGGG + Intergenic
1081099797 11:38987093-38987115 TCCAGTGGCCCATATCCCCAGGG - Intergenic
1081619653 11:44611766-44611788 CCCTGTGGCCATGGTCCCCGTGG + Intronic
1084310188 11:68312434-68312456 CCCAGCGGCGCAGGTCCCCGCGG - Intergenic
1089637472 11:119824565-119824587 CCCTGTGGCACATTCCCCCAGGG + Intergenic
1089755781 11:120685563-120685585 TGCTGTGCCCCATGTCCCTGGGG + Intronic
1090137322 11:124210816-124210838 CCCTGTCCCCCATGTCTCCAAGG - Intergenic
1090217719 11:124984485-124984507 CCCTGTGGCTAATGTCTCCTAGG + Intronic
1090965982 11:131597986-131598008 GCCTGTGGCTCCTGTCCCTGGGG - Intronic
1092129156 12:6096417-6096439 CCCTGTGCCCCATGGCACCTGGG + Intronic
1093262326 12:16954108-16954130 ACCTGTGGCCCATGGGCCCCAGG + Intergenic
1094355685 12:29574982-29575004 CCCTGGGGCCCATCTGCCTGGGG + Intronic
1096464468 12:51840778-51840800 CCTTGTGGTCCATGACCCTGAGG - Intergenic
1097141704 12:56908159-56908181 CCCTGTTGCCCACATCCCTGAGG + Intergenic
1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG + Intronic
1105892449 13:24691208-24691230 CATTGTGGCCAATGTGCCCGAGG + Exonic
1106111999 13:26785598-26785620 CCCTGTAGCACATGCCCACGGGG - Intergenic
1113908448 13:113830844-113830866 CCCTGGGGCCCTCCTCCCCGGGG + Intronic
1115392316 14:32866890-32866912 CCGTGTTGCACATGTCCCCATGG + Intergenic
1117469091 14:56024153-56024175 CCCTGTGGCCTCTGACTCCGGGG - Intergenic
1118473338 14:66094615-66094637 CCCTGTGACTCGCGTCCCCGAGG - Intergenic
1119035937 14:71230894-71230916 CCCTGTGCCCCACGTCCCTGAGG + Intergenic
1121775090 14:96585066-96585088 CGCTGTGCCCCAAGTTCCCGGGG - Intergenic
1122491037 14:102116499-102116521 CCCTGTGCTCCACGTTCCCGAGG + Intronic
1122576958 14:102748908-102748930 CCCTGTGGCCAATGTTTCCGGGG - Intergenic
1122577213 14:102750024-102750046 CCCTGTGGCCTCGGTCCCCGCGG + Intergenic
1122651197 14:103228165-103228187 CCCTGTGGCCAATGCCCTCCAGG - Intergenic
1122800869 14:104228938-104228960 CCCTGGTGCCCATTTCCCCATGG - Intergenic
1122980735 14:105191398-105191420 CCCTGAGACCCATCTCCCCCGGG + Intergenic
1123023412 14:105412526-105412548 CCCAGTGGACCATGTCCCACAGG - Exonic
1123102719 14:105816444-105816466 CCCAGTGGTCCATGTCCCCAAGG + Intergenic
1123708013 15:22964589-22964611 CCCTGTGTCTCAGGTGCCCGTGG - Intronic
1124237728 15:28004279-28004301 CCCTGTGGCAGCTGTCCCCGTGG + Intronic
1125436518 15:39651040-39651062 CTCTGTGGCCCATGCCCTCTGGG - Intronic
1125725756 15:41867342-41867364 CAGTGTGGCCCATCTCCCCCTGG + Intronic
1127551801 15:60045641-60045663 CCCTGTTGCCCATTTCTCCTTGG + Intronic
1127898300 15:63321810-63321832 GGCTGTGCCCCAGGTCCCCGCGG - Exonic
1128240100 15:66095904-66095926 CCCAGTGGGCCTTGACCCCGGGG + Intronic
1128356409 15:66930629-66930651 CCCTGTGGCCTACGTCTCTGGGG + Intergenic
1129416828 15:75388304-75388326 CGCAGTGGCCCATGGCCACGTGG + Intronic
1129871475 15:78944480-78944502 CCCTGTGTGCCAAGTCCCGGGGG + Intronic
1130224560 15:82046995-82047017 CGCTGTGGCCTGCGTCCCCGCGG - Intergenic
1131252622 15:90840177-90840199 CCCTGAGGCCTAGCTCCCCGTGG - Intergenic
1131437012 15:92431208-92431230 CCCTGAAGCCCAAGTCCTCGTGG + Intronic
1132350910 15:101139290-101139312 CCCTGAGGCCCCTGGCCCTGAGG + Intergenic
1132675072 16:1118136-1118158 CCCTGTAGCCCCAGCCCCCGGGG - Intergenic
1134036256 16:11033438-11033460 CCCTGAGGCCCAGGTGCCTGGGG + Intronic
1135057370 16:19241845-19241867 CCCTGTGCCCCACGTGCCCAAGG - Intronic
1135323367 16:21511493-21511515 CCCTGGGGCACATGTCCTCAGGG + Intergenic
1136334851 16:29604759-29604781 CCCTGGGGCACATGTCCTCAGGG + Intergenic
1136449804 16:30347496-30347518 CCCTGTGGAGCATACCCCCGAGG + Intergenic
1138529350 16:57626747-57626769 CCCTGTGGGCCTGGTCCCTGGGG + Intronic
1139431837 16:66914981-66915003 CCCTTAGGCCCAGGTCTCCGTGG + Intronic
1139615101 16:68084260-68084282 CCCTGTGGGCCCTATGCCCGGGG + Intergenic
1139967638 16:70754561-70754583 CCCTCTGTCCCCTCTCCCCGCGG - Intronic
1140205537 16:72929616-72929638 CCCTGTGGCTCTTGCCCCAGAGG + Intronic
1142035571 16:87860577-87860599 CCCTGGGGCACATGTCCTCAGGG + Intronic
1142145117 16:88489653-88489675 CCCTGTGGCCCAGGCCCCGCGGG - Intronic
1142304050 16:89275691-89275713 CGCACTGGCCCAGGTCCCCGTGG + Intronic
1144204398 17:12969165-12969187 CCATCTGGCCCATGTCACCTGGG - Intronic
1144897581 17:18552443-18552465 CACTGTGGCCCATGTATCAGAGG + Intergenic
1146086722 17:29837544-29837566 CCCTGTGGCCCATGTCCCCGAGG + Intronic
1146455118 17:33003898-33003920 CCCCCTGCCCCATGCCCCCGGGG + Intergenic
1146735761 17:35237527-35237549 CCCTGTGGCTCTAGTCCCGGTGG + Intergenic
1147893962 17:43738254-43738276 CCCTGTGGCCCTTGTGCTCAAGG + Intergenic
1147979380 17:44265229-44265251 CCCTGGGGTCCATGTCACCTCGG - Intronic
1148652498 17:49260151-49260173 CCCTGTGGGACAGGTCCCGGGGG - Intergenic
1152383169 17:79952679-79952701 GCATGTGGCCCAGGTCCACGCGG + Exonic
1152854368 17:82655790-82655812 CCCCGTGGACTTTGTCCCCGTGG + Exonic
1154110782 18:11566716-11566738 CCCAGTGGCCCAGGTCTCCTGGG + Intergenic
1158023585 18:52870294-52870316 CCCTGTGCCCCATGTCCCCAAGG - Intronic
1159004429 18:63000060-63000082 CTCTATGGCCCTTGTCCCCCAGG + Intergenic
1160212726 18:76895981-76896003 CCCTGTGGCCAGTGCCCACGTGG - Intronic
1160529563 18:79555521-79555543 CCGTGTGACCCCTGACCCCGCGG - Intergenic
1160707455 19:536171-536193 CCCAGTGCCCCAGGTCCCGGAGG - Intronic
1160894409 19:1395930-1395952 CCCTCTGGCCCATTTCCAGGCGG + Intergenic
1161046573 19:2138177-2138199 CCCTCTGGCCCGTTTCCCCGTGG - Intronic
1161428231 19:4216238-4216260 CCCTGTGGCCCAGGTCCCCAGGG + Intronic
1161428436 19:4217181-4217203 CCCTGTGGCCCTAGAGCCCGTGG - Exonic
1162958880 19:14114581-14114603 CCCTGTGGGCCAGCTCCCAGGGG + Intronic
1163108369 19:15141305-15141327 CTGTGTGGCCCACGTCACCGTGG - Intergenic
1163644980 19:18484062-18484084 CACTGTGGCCCAGGTGCCCATGG - Intronic
1166523882 19:43499050-43499072 CCCTGTAACCCATCTCCCAGAGG - Intronic
1167383359 19:49150763-49150785 CCCCGTGTCTCGTGTCCCCGGGG + Exonic
1168315024 19:55481271-55481293 CCCTGCGGCCCCTGCCCCGGCGG + Exonic
925085702 2:1105917-1105939 CCTGGTGGCCCCTGACCCCGAGG + Intronic
927225951 2:20766824-20766846 CCCTGTGCCCCACGTCCTTGAGG + Intronic
927267212 2:21163517-21163539 CACTGTGCCCCACGTCCCCAAGG - Intergenic
931300300 2:60973038-60973060 CCCTGTGCTCCACATCCCCGAGG + Intronic
932522214 2:72426915-72426937 ACCTATGCCCCATGTCCCCGAGG + Intronic
937120058 2:119434763-119434785 CCCTGTGCCCCATGCCCTCTTGG - Intronic
937205105 2:120231319-120231341 CCCTGTGGCCCTTGTTCCCAAGG + Intergenic
937252480 2:120533614-120533636 CCCTGGGACCCATCTCCCCACGG + Intergenic
938230409 2:129654322-129654344 CTCTGTGTCTGATGTCCCCGTGG - Intergenic
938305231 2:130248749-130248771 CACTGTGGCCAATGTGCCCAAGG + Intergenic
941043407 2:160648234-160648256 CCCTGTACCCCGCGTCCCCGAGG + Intergenic
941717276 2:168777231-168777253 CCCTGTAGCCTACGTCCCCCAGG - Intergenic
942316038 2:174697192-174697214 CACTCTGGCCCCTGACCCCGGGG + Intergenic
942319186 2:174721289-174721311 CCCTTGGCCCCATGTCCCCAAGG + Intergenic
943820603 2:192315439-192315461 CCCGATGCCCCGTGTCCCCGAGG - Intergenic
946410942 2:219514893-219514915 GCCTGTGGCCCAGGCCCCCACGG + Exonic
947461172 2:230306135-230306157 CCCTGTGCCCTGTGTCCCTGAGG + Intronic
948912677 2:241012191-241012213 CGCTGTGGCCGAGGTCCCTGGGG - Intronic
948939070 2:241187311-241187333 CCCTGAGGCCCAGGGCCCCAAGG + Intergenic
1172595704 20:36149704-36149726 CCCTCTGGCCCAGCTCCCAGTGG + Intronic
1173085987 20:39918323-39918345 CCCTTTGGCCCATGCCACTGTGG + Intergenic
1174204197 20:48827552-48827574 ACCTGTGGCCGTGGTCCCCGTGG - Intronic
1174484976 20:50855462-50855484 CACTGTGCCCCCTGTCCCCCAGG + Intronic
1175289232 20:57862748-57862770 CCCTGTGGGCTATGTCCCCTTGG + Intergenic
1175931832 20:62497205-62497227 CCCTGAGGCCCGGGTCCCTGGGG - Intergenic
1175960177 20:62631820-62631842 CCCCGTGCCCCACGTCCCCGAGG - Intergenic
1176288984 21:5034262-5034284 CCCTGAGCCCACTGTCCCCGGGG - Intronic
1178244183 21:30935886-30935908 CCCTGTGCCCCATGTCCCCAAGG + Intergenic
1178467292 21:32859556-32859578 CCCTGTGCCCCATGTCCCTGAGG - Intergenic
1179868250 21:44229342-44229364 CCCTGAGCCCACTGTCCCCGGGG + Intronic
1181022432 22:20110526-20110548 CCAGGTGGCCCATGTGCCCAGGG + Exonic
1181406829 22:22690786-22690808 CCCTCTGCTCCATGTCCCAGGGG + Intergenic
1181811384 22:25405522-25405544 CCCAGCGGCCCGGGTCCCCGCGG + Intergenic
1181911992 22:26245493-26245515 CCAGGTGGCCCAAGTCCCCATGG - Intronic
1182122959 22:27798782-27798804 CGCCCTGGCCCACGTCCCCGGGG + Exonic
1184416100 22:44352686-44352708 ACCTGTGGCCCAGGTGCCCTGGG + Intergenic
1184706475 22:46217048-46217070 CCCTGTGGCCCAGGCCTCTGAGG - Intronic
1185089026 22:48755641-48755663 CCCTGTCCCCCATCTCCACGGGG - Intronic
950119509 3:10472340-10472362 CCCAGTGACCCATGTGCCAGGGG + Intronic
952408348 3:33025789-33025811 CCCTGTGCCCCATGTCCCCGAGG + Intronic
953403882 3:42650822-42650844 CCCTGTGGGCCAGGTCCACTGGG - Intergenic
953766251 3:45746286-45746308 CCCTGTGCCCCGTGTCCCTGTGG + Intergenic
954333510 3:49903272-49903294 GCCTGTGGCCCAGGACCCCACGG - Exonic
954458258 3:50611638-50611660 CGCAGAGGACCATGTCCCCGCGG + Exonic
954497821 3:50982502-50982524 CCCTGTGCCTCATGTCCCCAAGG + Intronic
954683894 3:52360260-52360282 CCCAGTGGCCCATTGCCCCATGG + Intronic
954959371 3:54550720-54550742 CCCCTTGGCTCATTTCCCCGTGG + Intronic
955228243 3:57078651-57078673 GCCTGAGGCCCTTGTCCCGGCGG - Intronic
955407957 3:58637381-58637403 CCCTGTAGCCCTTGTCCTAGGGG + Intronic
958632335 3:96700216-96700238 CCCTGTAGCACATGTCCACTGGG + Intergenic
959923070 3:111891202-111891224 GTCTGTGGCCCATGGCCCAGGGG - Intronic
960333523 3:116391300-116391322 CCCCGTGCCCCATGTCCCCGAGG + Intronic
961269660 3:125679776-125679798 ACCTGTGGCCCATGGACCAGGGG - Intergenic
961465186 3:127077067-127077089 CCATGGGGGCCATGTCCCTGGGG + Intergenic
964590988 3:158361454-158361476 CCCTGTGTCCCGTGTCCCCAAGG - Intronic
965310164 3:167116708-167116730 CCCTGTGTGCCACGTCCCTGAGG - Intergenic
966892465 3:184417344-184417366 CCCTGTCGCCCAAGGCCCAGAGG + Intronic
967658740 3:192079452-192079474 ACCTCTGGCCCATGTTCCCCTGG + Intergenic
968053519 3:195673231-195673253 CCCCGTGTCCCATGTTCCCGAGG - Intergenic
968102293 3:195975131-195975153 CCCCGTGTCCCATGTTCCCGAGG + Intergenic
968984447 4:3867483-3867505 TGCTGTGGCCCTTGTCCTCGGGG + Intergenic
969340338 4:6536575-6536597 CCCTGTGGCCCATACCCCGCAGG + Intronic
969692701 4:8712675-8712697 CCCTGTGTCCCTTGTTCCCAAGG - Intergenic
969842277 4:9891299-9891321 CCCTGTGCCCCTTGTCCACTTGG + Intronic
970645036 4:18109969-18109991 CACTGTGGCTCATGTTCCCCTGG + Intergenic
974894785 4:67926520-67926542 CCCTGTGTCCCACATCCCTGAGG + Intronic
975254549 4:72217084-72217106 CCCTGTGCCCCATGCCCCCAAGG - Intergenic
975320983 4:73010799-73010821 CCCTGTGCCCCATATCCCTGAGG + Intergenic
979649679 4:123115024-123115046 TCCTGTGTCCCATGTCCTCAAGG - Intronic
981614078 4:146628200-146628222 CCCAATGGCCCATCTCCCCAAGG - Intergenic
985499812 5:235846-235868 CCCCGTGTCCCATGTTCCCGGGG - Intronic
985737577 5:1593846-1593868 CCCCGTGTCCCATGTTCCCGGGG + Intergenic
985772934 5:1824486-1824508 CACCGTGGCCCCTGTGCCCGGGG + Intergenic
986285176 5:6353872-6353894 CCCCCTGCCCCATGTCCCTGAGG - Intergenic
988093442 5:26570103-26570125 CCCTATGCCCCGTGTCCCTGAGG - Intergenic
992693337 5:79260299-79260321 TCCTGTGCCCCATGTCCTGGAGG - Intronic
993187285 5:84636025-84636047 CCCTGTGCCCCACATCCCCGAGG - Intergenic
997198911 5:131997943-131997965 CTCTGAGGCCCATGTCCTCAGGG - Intronic
997352979 5:133244170-133244192 CCCTGTAGCCCCTGTCTCCTGGG - Intronic
999772212 5:154784245-154784267 CCCTGTGGTCCCTGCCCCCAGGG + Intronic
1001291817 5:170468945-170468967 CCCTTTGCCCCATTTCCCAGAGG + Intronic
1002445580 5:179288122-179288144 GCCTGTGGCCCAGGGACCCGGGG - Intronic
1002985912 6:2190859-2190881 CCCTGTGCCCCGTGTCCCCAAGG + Intronic
1003173747 6:3739555-3739577 CCCTGGGGCCTCTGTCCACGTGG + Intronic
1012169728 6:96002728-96002750 CCCTGTGCCCCATGTCCCTAAGG - Intergenic
1013188882 6:107785283-107785305 CCCTGTGTCCCTTGTCCTAGAGG + Intronic
1013276967 6:108594694-108594716 CCTTGTGCCCCATGGCCCTGTGG + Intronic
1019329433 7:455365-455387 CGCTGGGGCCCATCTCCACGTGG + Intergenic
1019515555 7:1438375-1438397 CCTGGTGGCCCAGGTCCCAGAGG - Intronic
1019554840 7:1624064-1624086 CATTGTACCCCATGTCCCCGTGG - Intergenic
1019649050 7:2146706-2146728 CACGGTGGCCCAGATCCCCGAGG - Intronic
1020092710 7:5350289-5350311 CCCCGGGGCCCATGTTCCCCTGG - Intronic
1023978806 7:45053799-45053821 ACCCGTGGCCCATGTCCCTCAGG - Intronic
1024162360 7:46689789-46689811 CCCTGAGGGCCATGTGCCTGAGG - Intronic
1024965261 7:55018727-55018749 CCCTCTGGACCCGGTCCCCGCGG - Intergenic
1024988215 7:55213981-55214003 CCCCGGGGTGCATGTCCCCGGGG - Intronic
1025128577 7:56364089-56364111 CCCTGTGGCCCCTACCCCTGGGG + Intergenic
1025852047 7:65251868-65251890 CCCTGTCACCCGTGTTCCCGTGG + Intergenic
1034872276 7:154695231-154695253 CACTGTGGTCCAGGTACCCGGGG - Intronic
1035546149 8:483706-483728 CCCTGGGGACCATGTCCCAGTGG + Intergenic
1037150033 8:15626109-15626131 CCCTGTGCCCTGTGTCCCCAAGG + Intronic
1037877808 8:22556928-22556950 CCCTGGGCCCCATCTCTCCGTGG - Intronic
1037984863 8:23283773-23283795 CCCCTTGGCCCATGTTCACGTGG + Intronic
1040572905 8:48625476-48625498 CCCTGAGGCCCATGCCCCCGCGG + Intergenic
1042337248 8:67641021-67641043 CCCTGTACCCCATGTCCCTGAGG - Intronic
1042688057 8:71462806-71462828 CTCTGTGCCCCATGTCCCTGAGG - Intronic
1043568270 8:81571421-81571443 CCCTGTGCCCCACGTCTTCGAGG - Intergenic
1049845740 8:144800076-144800098 CCGGGTGCCCCAGGTCCCCGAGG + Intronic
1050094643 9:2051428-2051450 CACAGTGCCCCATCTCCCCGGGG + Intronic
1057336648 9:94160851-94160873 CCCTAAGGCCCGTGTCCCAGAGG - Intergenic
1058994656 9:110287866-110287888 CCCTTGGGCCCATGTGCCCTAGG - Intergenic
1060708098 9:125825704-125825726 AACTGTGGCCCAGGTACCCGTGG - Intronic
1060810613 9:126609920-126609942 CCCTTTGGCCCATGTGCCCTGGG + Intergenic
1061227393 9:129288683-129288705 CCCTGTGTCCGAGGTGCCCGTGG + Intergenic
1061256960 9:129459076-129459098 CCCTATAGCCCCTGCCCCCGGGG + Intergenic
1061608162 9:131727350-131727372 CTCTGTGGACCTTGTCCCCAGGG - Intronic
1062015554 9:134289453-134289475 CCCGGGTGCCCATGGCCCCGGGG + Intergenic
1062115527 9:134806240-134806262 CCCTGGGGCCCAGGTCTCCCTGG - Exonic
1062116718 9:134813598-134813620 CCCTCTGGCCTGTGTCCCTGAGG + Intronic
1062151679 9:135022534-135022556 CACAGTGGCCCAGGTCCCTGGGG + Intergenic
1062461812 9:136665543-136665565 TCCTGGGGCCCGAGTCCCCGCGG - Intronic
1185947274 X:4391387-4391409 CCATTTGGCCCATGTCTCCGAGG - Intergenic
1186643555 X:11482629-11482651 CCCTGTGGCAGATGTCCTTGGGG + Intronic
1187023071 X:15404958-15404980 CACTGTGGCCCATGGTCACGAGG + Intronic
1190369292 X:49726457-49726479 CCCTGTGCCCCATGTCCCCGAGG + Intergenic
1193087099 X:77456540-77456562 CTCTGTGACCCATGTACCCTGGG + Intronic
1196782978 X:119399549-119399571 CCCTGTGGCCCACGGTCCCCGGG - Exonic
1199594224 X:149493938-149493960 CCCTGTGCCCCATTTCTCAGTGG - Intronic
1200108652 X:153727706-153727728 CCCACTGGCTGATGTCCCCGTGG + Intronic