ID: 1146087249

View in Genome Browser
Species Human (GRCh38)
Location 17:29841037-29841059
Sequence AATCACATGGTCAAGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146087246_1146087249 -6 Left 1146087246 17:29841020-29841042 CCTGATAGCCACATCAAAATCAC 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1146087249 17:29841037-29841059 AATCACATGGTCAAGAAGTCAGG 0: 1
1: 0
2: 0
3: 13
4: 220
1146087244_1146087249 11 Left 1146087244 17:29841003-29841025 CCCTCTAAAAAGCATAGCCTGAT 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1146087249 17:29841037-29841059 AATCACATGGTCAAGAAGTCAGG 0: 1
1: 0
2: 0
3: 13
4: 220
1146087245_1146087249 10 Left 1146087245 17:29841004-29841026 CCTCTAAAAAGCATAGCCTGATA 0: 1
1: 0
2: 2
3: 12
4: 162
Right 1146087249 17:29841037-29841059 AATCACATGGTCAAGAAGTCAGG 0: 1
1: 0
2: 0
3: 13
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146087249 Original CRISPR AATCACATGGTCAAGAAGTC AGG Intronic
905557016 1:38894540-38894562 GATCACAAGGTCAAGAGATCGGG - Intronic
908290838 1:62665482-62665504 GATCACGAGGTCAAGAAATCGGG + Intronic
908616037 1:65923839-65923861 ATTTACATATTCAAGAAGTCCGG - Intronic
908654843 1:66377373-66377395 GGTCACATAGTCAAAAAGTCTGG - Intergenic
911480207 1:98429486-98429508 CATCCCATGGTCAAGAAATTTGG + Intergenic
916288170 1:163133513-163133535 AATCACATGTGCAAGATATCTGG + Intronic
920540341 1:206773470-206773492 AATAACAAGGAAAAGAAGTCAGG + Intergenic
920881291 1:209882620-209882642 AAACACATGGCCAAAAACTCAGG + Intergenic
923600357 1:235397432-235397454 GATCACAAGGTCACGAGGTCAGG - Intronic
923816601 1:237386394-237386416 AATAAGATGGTCAAGATTTCTGG + Intronic
924354623 1:243158845-243158867 GATCACAAGGTCAAGAGATCGGG + Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
924883258 1:248186732-248186754 GATCACCTGGTCAAGTATTCAGG + Intergenic
1069999256 10:72364234-72364256 AATCACAAGGTCAGGAGATCGGG - Intergenic
1071225874 10:83527061-83527083 AAACACATGGTCTGAAAGTCTGG + Intergenic
1072061581 10:91817051-91817073 AATCATTTTCTCAAGAAGTCTGG - Intronic
1072381725 10:94879440-94879462 AAACACCTGGTTAAGAATTCAGG + Intergenic
1072557643 10:96534630-96534652 AATTACATGGTCTAGAAGAATGG + Intronic
1073701009 10:105926481-105926503 GATCACAAGGTCAAGAGATCAGG + Intergenic
1080368052 11:31600208-31600230 AATCACATGGTGAAGAAAAGAGG - Intronic
1081087162 11:38815283-38815305 AATCATATTGTAAAGAAGGCAGG + Intergenic
1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG + Intergenic
1083046072 11:59735981-59736003 AAACACATGGTCAAGAAGATTGG + Intronic
1083159211 11:60844268-60844290 GATCACTTGACCAAGAAGTCTGG + Intronic
1084093355 11:66893929-66893951 TACCATCTGGTCAAGAAGTCTGG + Intronic
1084229156 11:67738321-67738343 AATCACAAGGTCAGGAATTCAGG - Intergenic
1084514886 11:69631667-69631689 AATCTCATGTTCAAGAAGAGGGG - Intergenic
1086916562 11:92536417-92536439 CATCACATGGCCAAGAAGCTGGG - Intronic
1087236177 11:95721163-95721185 AATCTCATGGTCAGGAAGTAGGG + Intergenic
1087662920 11:101008838-101008860 AAGCAGATGGTCTAGAAGTATGG - Intergenic
1093055995 12:14556227-14556249 AAGCACATGGACAATATGTCTGG + Intronic
1095192996 12:39279831-39279853 GATCACAAGGTCAAGATATCAGG + Intergenic
1096363531 12:51008803-51008825 ATTCACATGGTTAAAAATTCAGG + Intronic
1097606128 12:61756876-61756898 AATAACAAGGTCATGAAGTAGGG + Intronic
1098028151 12:66227369-66227391 AATCACAAGGTCAGGAGTTCAGG + Intronic
1098954354 12:76673339-76673361 GATCACAAGGTCAGGAGGTCGGG + Intergenic
1098986506 12:77018184-77018206 AATCACAGGGGCAACAAGGCAGG - Intergenic
1100576245 12:95893997-95894019 GATCACAAGGTCAAGAGATCAGG + Intronic
1101533727 12:105598296-105598318 ACTCACATAATGAAGAAGTCCGG + Intergenic
1104276858 12:127336966-127336988 AAGCACATGGTCAAGGAGTGAGG - Intergenic
1105813231 13:24012111-24012133 AAACACACTGTCAAGAAGCCAGG + Intronic
1107583593 13:41819276-41819298 AAGAACATGGTTAAGAATTCTGG + Exonic
1109636803 13:65130444-65130466 AATTACCTCTTCAAGAAGTCTGG - Intergenic
1112426378 13:99305318-99305340 TATCACCTTCTCAAGAAGTCTGG - Intronic
1114539439 14:23443713-23443735 AATGACATTGCCTAGAAGTCCGG - Intergenic
1114905964 14:27126826-27126848 GATCACAAGGTCAGGAATTCAGG - Intergenic
1116095031 14:40356819-40356841 AATCACACTGTCAAAATGTCTGG + Intergenic
1116874828 14:50100545-50100567 AAAGACATGGTGAAGATGTCTGG + Intergenic
1122239402 14:100352337-100352359 GATCACAAGGTCAGGAGGTCAGG - Intronic
1202847528 14_GL000009v2_random:193937-193959 AATCACAAGGTCAACAGATCGGG + Intergenic
1202916996 14_GL000194v1_random:184495-184517 AATCACAAGGTCAACAGATCGGG + Intergenic
1125483412 15:40095694-40095716 ACTCACATGGTTTAGAAGGCAGG + Intronic
1125649403 15:41302272-41302294 GATCACAAGGTCAAGAGATCAGG + Intergenic
1126725139 15:51623634-51623656 AATCACAGGGTAAGGAAGTAGGG + Intergenic
1127249643 15:57219000-57219022 AAACACATGATCAAGTAATCAGG - Intronic
1127846167 15:62873411-62873433 AACCACAGGGGCAAGAAGCCTGG + Intergenic
1128869745 15:71145149-71145171 AAGCACCTGGTCAAGCAGACTGG - Intronic
1131429912 15:92378444-92378466 ATACACCTTGTCAAGAAGTCTGG + Intergenic
1131685997 15:94768325-94768347 ATTCACATAGTCTAGAAGTTGGG + Intergenic
1134787065 16:16953931-16953953 GATCACAAGGTCAAGAGATCAGG - Intergenic
1137746643 16:50825550-50825572 AATCACTGGGTCATGAGGTCAGG + Intergenic
1138690059 16:58758827-58758849 TATCACATAGTAATGAAGTCTGG + Intergenic
1139812091 16:69629501-69629523 AATCCCAGGGTCAAGGTGTCGGG + Intronic
1140240503 16:73195636-73195658 GATCACAAGGTCAGGAATTCAGG - Intergenic
1140244716 16:73237705-73237727 AACCTCATGGTGAAGAAGTGAGG - Intergenic
1140907772 16:79424113-79424135 AACCACATGGTCATCAAGGCAGG + Intergenic
1141775877 16:86122216-86122238 ACTCACGAGGTCAGGAAGTCTGG + Intergenic
1146087249 17:29841037-29841059 AATCACATGGTCAAGAAGTCAGG + Intronic
1148376257 17:47149289-47149311 GATCACAAGGTCAAGAGATCGGG + Intronic
1149467043 17:56888212-56888234 AATCACATGGTCAGTCTGTCTGG + Exonic
1149802027 17:59578445-59578467 AATTAAATGGTGAACAAGTCAGG - Intronic
1149844463 17:59997040-59997062 AATTAAATGGTGAACAAGTCAGG + Intergenic
1149925037 17:60694279-60694301 GATCACAAGGTCAAGAGATCAGG + Intronic
1155432909 18:25780276-25780298 CGTCACATGGTCAAGCAGTAAGG + Intergenic
1155623392 18:27807293-27807315 AAACACCTTGTCAAGAAGTCAGG - Intergenic
1157828926 18:50838831-50838853 GATCACAAGGTCAAGAGATCAGG - Intergenic
1158273288 18:55739651-55739673 TATTATTTGGTCAAGAAGTCTGG + Intergenic
1159119662 18:64154001-64154023 AATAAAATGGTGAAGAAGTTAGG - Intergenic
1161599992 19:5176062-5176084 GATCACAAGGTCAAGAGATCGGG - Intronic
1168666422 19:58208397-58208419 ATTCACAGGGTCCAGGAGTCAGG - Intronic
925674434 2:6345683-6345705 AATCACATGAGCAAGAAATGAGG + Intergenic
926449499 2:12984868-12984890 TATTACATAGTCATGAAGTCTGG - Intergenic
926641382 2:15241349-15241371 ATTCACATGGGCAGGAAGTAGGG + Intronic
927347361 2:22061148-22061170 AATGTTATGGTCATGAAGTCTGG - Intergenic
927815112 2:26208903-26208925 AATAAAATGGATAAGAAGTCCGG - Intronic
928835104 2:35534090-35534112 GATCACAAGGTCAAGAGATCGGG - Intergenic
929040619 2:37741302-37741324 AATTACAGGTTAAAGAAGTCTGG - Intergenic
931932567 2:67156422-67156444 AATTACTGGGTCAAGAATTCTGG - Intergenic
932945330 2:76223024-76223046 AATCACATGATAAATAATTCTGG - Intergenic
932986539 2:76732503-76732525 AACCACCTGGTTAAGAACTCTGG - Intergenic
934759428 2:96845379-96845401 AATCACAAGGTCAGGAGTTCAGG - Intronic
936778617 2:116004310-116004332 GATCACAAGGTCAAGAGATCAGG - Intergenic
937051539 2:118895491-118895513 GATCACAAGGTCAAGAGATCGGG - Intergenic
937631258 2:124104145-124104167 GATCACTTGGTCAAGAAGTTTGG - Intronic
939296412 2:140270721-140270743 AACCACATGATCAAGTACTCTGG + Intronic
939317944 2:140577261-140577283 AATCACAAGGTCAAGAGATCCGG + Intronic
939598391 2:144156906-144156928 AGTCACCTGGTAAAGAAGTGTGG - Intronic
943728514 2:191276918-191276940 AATCATATTGTCCAGAAGTGAGG - Exonic
944416489 2:199484488-199484510 AATATCATGGTCAAGAATACAGG - Intergenic
944707528 2:202306200-202306222 AAATTGATGGTCAAGAAGTCAGG + Intergenic
944808159 2:203302910-203302932 GATCACAAGGTCAAGAGTTCAGG - Intronic
948315182 2:237023046-237023068 AATCACATGAGTAAGAAGGCTGG - Intergenic
1168893891 20:1310794-1310816 GAGCACATGGTCAAAAAGTAAGG - Exonic
1169615621 20:7440995-7441017 AATCACACAATCCAGAAGTCAGG + Intergenic
1169892809 20:10472021-10472043 AATCACAAGGTCAAGAGGAGAGG + Intronic
1171078986 20:22158473-22158495 AATCACTTGGCCAAGAAGGTGGG - Intergenic
1171853909 20:30327661-30327683 GATCACAAGGTCAAGAATTTGGG + Intergenic
1172849841 20:37953626-37953648 AATCACAAGGTCAGGAGATCGGG + Intergenic
1173782939 20:45771662-45771684 AACCAGATGGTCAAGAAGCAGGG + Intronic
1176637062 21:9256069-9256091 AATCACAAGGTCAACAGATCCGG - Intergenic
1179024643 21:37669347-37669369 AAGCACAGTCTCAAGAAGTCCGG - Intronic
1179289360 21:40005307-40005329 GATCACAAGGTCAAAAAATCAGG + Intergenic
1180150484 21:45944657-45944679 AACCACATGGTCAAGGCCTCGGG + Intergenic
1183897439 22:40980659-40980681 AATCACAAGGTCAAGAGATAGGG - Intergenic
1185122905 22:48983405-48983427 AATCACAAGGTCAGGAGTTCAGG + Intergenic
1203292895 22_KI270736v1_random:12902-12924 AATTACAGGTTAAAGAAGTCTGG - Intergenic
949130715 3:497260-497282 AATCACATGGCTAACAAATCAGG - Intergenic
950165515 3:10794413-10794435 AACCACATAGTGAAGAAGTGAGG + Intergenic
951586943 3:24224750-24224772 AATCACATGTTCATAAAGTAAGG - Intronic
951946641 3:28144627-28144649 AATGTCATGGTCAAGATGTTAGG + Intergenic
952173412 3:30834885-30834907 AATCCCATAGTCAACAGGTCTGG + Intronic
952598887 3:35054813-35054835 AACCACATGGTCAAGATATTGGG + Intergenic
952655748 3:35783300-35783322 AAACACATGAGCAAAAAGTCTGG - Intronic
955720457 3:61874854-61874876 AATGCCATGGTGAAGAAGTCTGG - Intronic
955724473 3:61918632-61918654 AATCACATGGCCAAGAAAGGTGG + Intronic
955985796 3:64572856-64572878 GATCACAAGGTCAAGAGATCAGG + Intronic
956696691 3:71924526-71924548 AAGCAGATGATCAAGAAGTGAGG + Intergenic
958601945 3:96305882-96305904 ACTCACATGGTCACGAGGTAAGG + Intergenic
958913394 3:100020984-100021006 GATCACAAGGTCAAGAGATCAGG - Intronic
959461647 3:106633442-106633464 TATTACATAGTCATGAAGTCTGG + Intergenic
959929268 3:111961109-111961131 GATCACAAGGTCAAGAGATCAGG + Intronic
960811817 3:121633441-121633463 GATCACGAGGTCAGGAAGTCAGG - Intronic
961572703 3:127811753-127811775 AACCACATGGACAAGAACTGAGG + Intronic
961626161 3:128265101-128265123 GATCACATGGTTAACAAGTGGGG + Intronic
961909998 3:130304604-130304626 AATAACATGGTGAAGAATTGAGG + Intergenic
964350223 3:155795657-155795679 AATCAAATGGTAATGAAGGCTGG + Intronic
964561147 3:157997923-157997945 AATCACATGAACTGGAAGTCTGG - Intergenic
965045333 3:163571188-163571210 TATCACAAGGCCTAGAAGTCGGG - Intergenic
965479937 3:169205857-169205879 AATCACATGAACAAAAAGTTGGG + Intronic
966278049 3:178199282-178199304 GATCACAAGGTCACGAGGTCAGG - Intergenic
1202749832 3_GL000221v1_random:148950-148972 AATCACAAGGTCAACAGATCCGG + Intergenic
968384784 4:125950-125972 GATCAGATGGTCCAGAAGCCTGG - Intronic
972595706 4:40528189-40528211 GATCACAAGGTCAAGAGATCAGG + Intronic
975639752 4:76488537-76488559 TATCACATTCTCAAGAAATCTGG - Intronic
976238875 4:82932315-82932337 AATCACGAGGTCAGGAGGTCGGG - Intronic
976330440 4:83825279-83825301 TGTTACATGGTCAATAAGTCAGG + Intergenic
976551756 4:86404040-86404062 AATCATATTGTCATGATGTCAGG + Intronic
976759083 4:88528802-88528824 AATCACATGCACAAGACTTCCGG + Intronic
979247182 4:118520805-118520827 GATCACAAGGTCAAGAGATCGGG - Intergenic
980471028 4:133251665-133251687 AATCACAAGGTCAGGATTTCGGG + Intergenic
982408618 4:155047410-155047432 AAACACATGGTCTAGAAACCAGG + Intergenic
983432441 4:167668765-167668787 AGTCACATGGTCAGGAAGGAAGG + Intergenic
1202751953 4_GL000008v2_random:14496-14518 AATCACAAGGTCAACAGATCCGG - Intergenic
987358698 5:17087213-17087235 AAGACCAAGGTCAAGAAGTCAGG - Intronic
987955679 5:24737026-24737048 AATCAGCTGGTAAAGAAGTTGGG - Intergenic
988143986 5:27280414-27280436 GATCACAAGGTCAGGAGGTCAGG - Intergenic
990560456 5:56978790-56978812 AATCACATTATAAGGAAGTCTGG + Intergenic
990807498 5:59681939-59681961 TATCACATGGGCAAGAAATAGGG - Intronic
990956922 5:61350689-61350711 AATCACATGGTCAGGAGCTTGGG + Intronic
992490148 5:77234716-77234738 AATCACCTGGTCTGGACGTCAGG - Intronic
994908507 5:105871288-105871310 CATCACATGGCTAGGAAGTCAGG - Intergenic
994945210 5:106379041-106379063 AATCACATGGGCAATATTTCTGG + Intergenic
995226447 5:109706516-109706538 GATCACATGGCCAATAAGTGCGG + Intronic
995689711 5:114810973-114810995 ATTCACATGTTCAACAAGTTAGG + Intergenic
997324812 5:133011401-133011423 GATCACAAGGTCAGGAATTCAGG + Intronic
997435905 5:133875297-133875319 ATACACATGGGCAAAAAGTCAGG + Intergenic
998055628 5:139074506-139074528 AAGGAAATGGTCCAGAAGTCTGG + Intronic
998700708 5:144696282-144696304 AATCACATGGTCAAAAACTAAGG + Intergenic
999142881 5:149374347-149374369 AATCACCTGGCCCAGAAGCCAGG - Exonic
999357513 5:150949983-150950005 AATCATATGGTTAATAAGCCTGG + Intergenic
1000286164 5:159827806-159827828 AAACACAGGGTAAAGAAGGCAGG - Intergenic
1001111577 5:168901037-168901059 CATCACAGGGTGATGAAGTCAGG - Intronic
1003479437 6:6517720-6517742 GATCACAAGGTCAAGAGATCAGG + Intergenic
1005005659 6:21284918-21284940 AATGAAATGGTCTAGAAGACAGG + Intergenic
1005569297 6:27129330-27129352 AATCACTTGGGCAATAAGTGGGG + Intronic
1006433418 6:34012848-34012870 GATCACAAGGTCAAGAGATCGGG + Intergenic
1007763022 6:44145053-44145075 AATCACAAGGTCAGGAGTTCAGG + Intronic
1008206972 6:48672164-48672186 CATCACATGGTCAGTATGTCAGG - Intergenic
1012568265 6:100688132-100688154 TATCACATGGTCAAAAAATATGG + Intronic
1012620820 6:101341266-101341288 ATTCACATGTTCAAGAAGCTAGG - Intergenic
1014498215 6:122154312-122154334 AATGACACTGTCAAGAACTCTGG - Intergenic
1018346083 6:162900349-162900371 AATCACAGGTTGAAGAAGTGAGG - Intronic
1018607914 6:165617928-165617950 AATTAAATGGTAGAGAAGTCAGG + Intronic
1018879847 6:167866663-167866685 ATCAACATGGACAAGAAGTCAGG - Intronic
1021609240 7:22441973-22441995 AATCCCATGGTCTAGAATTTGGG - Intronic
1022846925 7:34219657-34219679 AGTTACATGGTTAAGAAGCCAGG - Intergenic
1023192178 7:37594415-37594437 AAGCCCCTGGTCAAGAAGTGTGG + Intergenic
1026370568 7:69694456-69694478 AATGACATGGAAAGGAAGTCAGG + Intronic
1028904505 7:96137842-96137864 GATCACAAGGTCAAAAGGTCAGG - Intronic
1029994096 7:104989662-104989684 AATCAAATGGTAAAGAAGAGAGG + Intergenic
1030268413 7:107644837-107644859 AATCACATGTTGAACAAATCTGG - Intergenic
1031540459 7:122988945-122988967 AATTAAATGGTCAAGATGTCAGG + Intergenic
1032125883 7:129192535-129192557 CATCCCCTGGTCAAGAAGCCAGG - Intronic
1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG + Intronic
1033199681 7:139358453-139358475 AATCAAATGTTTAAGAAGACAGG - Intronic
1035903861 8:3487688-3487710 AAACACATTGTCAAGAAGGCGGG + Intronic
1036241125 8:7081931-7081953 AATCACAAGGTCAGGAGTTCGGG + Intergenic
1036787036 8:11694794-11694816 AATCATATTATCAAGAACTCTGG + Intronic
1038278186 8:26139370-26139392 GATCACAAGGTCAAGAGATCGGG - Intergenic
1038592274 8:28850581-28850603 AAACACATGGGAAAGAAGACAGG - Intronic
1038619398 8:29125885-29125907 GATCACAAGGTCAGGAATTCGGG + Intronic
1038863810 8:31416460-31416482 AATAACCTGGTGAAGATGTCTGG - Intergenic
1039786276 8:40837296-40837318 AGCCACATGGTAAAGAAGGCAGG + Intronic
1040822960 8:51585387-51585409 CAGCACATGGGCAAGAACTCAGG + Intronic
1041117526 8:54554527-54554549 AATCCCATGGCCAGGGAGTCGGG - Intergenic
1041269576 8:56098381-56098403 GATCACAAGGTCAGGAATTCAGG - Intergenic
1045030435 8:98130125-98130147 TTTCATATGGTCAAGAAGTGGGG + Exonic
1045350894 8:101338673-101338695 GATCACAAGGTCAAGAGATCGGG - Intergenic
1046025122 8:108713040-108713062 AATAACATCGTCAATAACTCTGG - Intronic
1047228052 8:122973206-122973228 AACCACAGAGTCAAGATGTCAGG - Intronic
1047325645 8:123833494-123833516 AATCCAAGGGTCAAGAAATCTGG + Intergenic
1048399902 8:134055499-134055521 AATCTGATGGTCAAAATGTCAGG + Intergenic
1048616145 8:136077345-136077367 AATTTCCAGGTCAAGAAGTCTGG - Intergenic
1050037172 9:1449153-1449175 CATCACTTGTTCAAGAAGTCTGG - Intergenic
1055824112 9:80303417-80303439 GATCACAAGGTCAAGAGTTCAGG + Intergenic
1057660279 9:96995378-96995400 GATCACAAGGTCAAGAGATCGGG + Intronic
1058467230 9:105241734-105241756 AATCATGTGAACAAGAAGTCAGG + Intergenic
1058570217 9:106333776-106333798 CAACACATGGTTAAGAACTCAGG + Intergenic
1059707374 9:116837749-116837771 AATCATATGGTAAATAAGCCTGG + Intronic
1060818119 9:126646096-126646118 AATCACACTGCCAAGAAGGCAGG - Intronic
1203718474 Un_KI270742v1:179037-179059 AATCACAAGGTCAACAGATCCGG + Intergenic
1203652685 Un_KI270751v1:142730-142752 AATCACAAGGTCAACAGATCGGG + Intergenic
1187254438 X:17629554-17629576 CACCACATGGTCAAGAAATGGGG - Intronic
1187759412 X:22563906-22563928 AATCACATGGTCAAAGAGTTTGG + Intergenic
1194178505 X:90683963-90683985 AATAACATGGTTAAGAGTTCTGG + Intergenic
1194943084 X:100036135-100036157 AATCACCCGATTAAGAAGTCAGG - Intergenic
1196854411 X:119969543-119969565 CATCACAAGGTCAAGCAGTGGGG - Intergenic
1198362889 X:135913428-135913450 AATCACAAGGTCAGGAGTTCGGG + Intergenic
1198641870 X:138765018-138765040 AATAAAATGGTTAAGAACTCAGG + Intronic
1199269797 X:145869937-145869959 ATTCAAAAGGTCAACAAGTCAGG - Intergenic
1200525168 Y:4266128-4266150 AATAACATGGTTAAGAGTTCTGG + Intergenic
1201172624 Y:11283888-11283910 AATCACAAGGTCAACAGATCCGG + Intergenic
1201672682 Y:16541882-16541904 AATCATATAGTGATGAAGTCAGG + Intergenic
1202082740 Y:21101411-21101433 AAGCACATTATCAAGAATTCAGG - Intergenic