ID: 1146087973

View in Genome Browser
Species Human (GRCh38)
Location 17:29847876-29847898
Sequence GGGCAGGTTAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 6, 1: 11, 2: 23, 3: 46, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146087973_1146087979 4 Left 1146087973 17:29847876-29847898 CCTCAATTTGCATTAACCTGCCC 0: 6
1: 11
2: 23
3: 46
4: 157
Right 1146087979 17:29847903-29847925 ATTTACATGTAATTGAAAGTGGG 0: 7
1: 29
2: 149
3: 245
4: 638
1146087973_1146087978 3 Left 1146087973 17:29847876-29847898 CCTCAATTTGCATTAACCTGCCC 0: 6
1: 11
2: 23
3: 46
4: 157
Right 1146087978 17:29847902-29847924 AATTTACATGTAATTGAAAGTGG 0: 6
1: 26
2: 122
3: 268
4: 747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146087973 Original CRISPR GGGCAGGTTAATGCAAATTG AGG (reversed) Intronic
901459459 1:9383066-9383088 GGGCAGCTAAATGCACACTGAGG + Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
904346524 1:29875596-29875618 GGGCAGGTTGCTGCAGGTTGTGG - Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906244440 1:44263113-44263135 GGGAAGGTTAATGGAACTTCTGG - Intronic
906499874 1:46333820-46333842 AAGCAGGCTAATGCAAATTGAGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
915812011 1:158923131-158923153 GGGTAGGTGACTGCAAAGTGAGG + Intergenic
916700180 1:167284704-167284726 GGGCTTTTTAATGAAAATTGGGG + Intronic
916701765 1:167303112-167303134 GGGGAGGTTAATGTCAAATGTGG + Intronic
919345250 1:196367874-196367896 GGGCAGATTATTGCCAACTGAGG - Intronic
920552245 1:206872347-206872369 GGGCTGGTTGTTGCAGATTGTGG - Intergenic
920636741 1:207711584-207711606 GGGCACATCAATGCAAATTGAGG - Intronic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1064225311 10:13478351-13478373 ATGCAGGTTATTTCAAATTGTGG - Intronic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG + Intronic
1065950257 10:30645079-30645101 AGGCTGGTTAATGCAATTTGAGG - Intergenic
1068917125 10:62444563-62444585 GGGCAGGTTAAGGAAAAGTTAGG - Intronic
1069065857 10:63941339-63941361 GGGCAGCTGGATGCAGATTGTGG + Intergenic
1070035337 10:72716928-72716950 AGTCAGGGTAATGGAAATTGAGG + Intronic
1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG + Intronic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1077466309 11:2735315-2735337 GGACAGGCTAATGGCAATTGAGG + Intronic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1080956076 11:37097497-37097519 GGGCTGATTAATGCATATTCTGG + Intergenic
1081368269 11:42264065-42264087 AGGCAGATTAATGCCAATTGTGG - Intergenic
1086554424 11:88091926-88091948 AGGCACGTCAATGGAAATTGAGG + Intergenic
1090159931 11:124481997-124482019 CGGGAGGTTAATGGAAATTAAGG + Intergenic
1090562940 11:127952437-127952459 GGGCAAGATAATGTAAATGGAGG + Intergenic
1093941401 12:25058890-25058912 GCAAAGGTGAATGCAAATTGTGG + Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1094794597 12:33956543-33956565 GGGCTAGTTACTGCAGATTGAGG - Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096709524 12:53444982-53445004 GGGCAGTTAAATGTAAATGGAGG - Intronic
1098756503 12:74370295-74370317 GGGCTCGTTAATGCAAAGTTGGG + Intergenic
1100060208 12:90566074-90566096 GGGCATGCTGATGCAAAATGTGG + Intergenic
1100811092 12:98339029-98339051 GGGCAGGTGAAAGAAAAATGTGG + Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1107095828 13:36534044-36534066 GGGCAGGTTGCTGCAGATTGTGG + Intergenic
1107892596 13:44927346-44927368 GGGCAGGTTGCTGCAGGTTGCGG + Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1111508886 13:89233754-89233776 GGACAGGTGAAGGCAAATTCTGG - Intergenic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG + Intergenic
1114850634 14:26378839-26378861 GAACAGGTCAGTGCAAATTGAGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1117896722 14:60495158-60495180 GGGCACGGTAATGCATTTTGAGG + Intronic
1120081014 14:80216297-80216319 GAGCCAGTTAATGCTAATTGTGG + Intronic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1123128190 14:105964774-105964796 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1123408713 15:20040930-20040952 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1123518044 15:21047640-21047662 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1123835205 15:24182977-24182999 GGGCAAGTCAAGGCAAATTGAGG + Intergenic
1123849961 15:24344332-24344354 GGGGCAGTCAATGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1132436825 15:101812997-101813019 AGGAAGGCTAAAGCAAATTGAGG + Intronic
1133475235 16:6114968-6114990 GGACAAGTTAATGCAAACTGAGG + Intronic
1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG + Intronic
1135861011 16:26056124-26056146 GGGGAAGTTAATTCAAATGGAGG - Intronic
1135995288 16:27243486-27243508 GGGCAGGTTGATGTAGATTTTGG - Intronic
1136771308 16:32844023-32844045 GGGAAAGGTAATGCAAAATGTGG - Intergenic
1136800097 16:33062053-33062075 GGGAAGTGTAATGCAAAATGTGG + Intergenic
1136899268 16:34017430-34017452 GGGAAGTGTAATGCAAAATGTGG + Intergenic
1136902497 16:34053317-34053339 GGGAAGCGTAATGCAAAATGCGG + Intergenic
1137577825 16:49615257-49615279 CGGCAGGCAAATGCAAATTTCGG + Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG + Intergenic
1140936371 16:79674307-79674329 AGGCAGGGTAATGCAATGTGTGG - Intergenic
1141334832 16:83144905-83144927 GGGTAGGTTAATGGAGACTGAGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1203073733 16_KI270728v1_random:1106133-1106155 GGGAAAGGTAATGCAAAATGTGG - Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1147344453 17:39779739-39779761 GGGCAGGTGAGGGCAAACTGTGG - Intronic
1151483855 17:74386505-74386527 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
1151638357 17:75369237-75369259 GGGTAAGTTGATGCAAAATGAGG - Intronic
1151905465 17:77045611-77045633 GGGTTGGTTAATGCAGAGTGAGG - Intergenic
1153347716 18:4046089-4046111 TGGCAGGTTAATGCCAGATGGGG - Intronic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1157482251 18:48062931-48062953 GAGCAGGTGAAGGCAAAATGCGG - Intronic
1158864571 18:61625787-61625809 AGGCAGGATAATGCAAAGCGGGG - Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159184449 18:64950445-64950467 GTGTAGGTTAATGCCAATTAAGG + Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1164586516 19:29479308-29479330 GGACAGCTTAATCCATATTGTGG - Intergenic
1165134738 19:33660703-33660725 AGGCAGGTTAATGCAAATCAAGG - Intronic
927027856 2:19088751-19088773 GGCAAGATTAAAGCAAATTGAGG - Intergenic
927209768 2:20631914-20631936 GGGCAGGTTACTGCAGACTGTGG - Intronic
927993244 2:27462985-27463007 GGGCAGGGTAAAGGAAACTGGGG + Intronic
930683221 2:54279989-54280011 GGGAAGATAAATGCAAGTTGTGG + Intronic
930683433 2:54282398-54282420 GGGCAGAGTAAAGCAAAATGTGG - Intronic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
932748645 2:74356562-74356584 AAACAGGTGAATGCAAATTGTGG + Intronic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
939624096 2:144455340-144455362 GTGCAGGTTGGTGGAAATTGAGG - Intronic
940367484 2:152864118-152864140 GGGCTGGTTGCTGCAATTTGTGG + Intergenic
940748452 2:157597212-157597234 GGGCAGGTTAATGCACATGCAGG - Intronic
942216421 2:173724312-173724334 GGCCAGGTAAATGTAAATTTTGG - Intergenic
1168909418 20:1435227-1435249 GGGCAAGCCAATGCAAACTGAGG - Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1169884856 20:10387991-10388013 GGGAATGTTAATGTAAATAGTGG + Intergenic
1171306760 20:24113255-24113277 GGGCAGCCTAATTCAAATCGTGG + Intergenic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173150834 20:40565425-40565447 GTGCAGGGGAATGCAAAGTGAGG + Intergenic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1173702287 20:45083369-45083391 GGGCAGGTTACTGCAGGTTGTGG + Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1180236772 21:46465607-46465629 GGGCACTTTAACGTAAATTGAGG + Intronic
1185005667 22:48275314-48275336 GGGCAGGTGTAAGCAAATCGTGG + Intergenic
949604589 3:5639136-5639158 GGGCAGGTTGCTGCAAGTTCTGG + Intergenic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
951294419 3:20916790-20916812 GGACAAGATAATGCAAAATGCGG + Intergenic
952013172 3:28925963-28925985 GAGCAGGTCAATGAAAATAGAGG - Intergenic
953571737 3:44076627-44076649 CGGCAGGTTAATGGAGATGGTGG + Intergenic
957295754 3:78330672-78330694 GATCTGGTTAATGCAAAGTGTGG + Intergenic
957443988 3:80291544-80291566 GGGCAGGATAATGCAAGGGGTGG + Intergenic
959090798 3:101900539-101900561 AGTCAGGTTATTGCAAATGGAGG + Intergenic
959171773 3:102852819-102852841 GTACAGGTTGATGCAAATTAAGG + Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
959876847 3:111393162-111393184 GGACAGGTCAATGCACACTGAGG - Intronic
960535862 3:118813689-118813711 GGGCAGGCAAATGGAAATGGGGG - Intergenic
965976482 3:174630008-174630030 GGGCAGGTTTATGTATATTATGG + Intronic
967507817 3:190272936-190272958 GGGCAGGTTGCTGCAAATCGTGG + Intergenic
967701179 3:192593882-192593904 AGGCAGAGTAATGCAATTTGAGG - Intronic
967983489 3:195079078-195079100 GGGCCGGGAGATGCAAATTGAGG - Intronic
969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG + Intronic
970522943 4:16903735-16903757 AGGCAGGTAAATGGAAATTAGGG - Intergenic
970673316 4:18419992-18420014 GGTCTGGGCAATGCAAATTGTGG - Intergenic
972441653 4:39099383-39099405 GGGGAGATCAATGCATATTGAGG - Intronic
973977226 4:56274319-56274341 TGGCAGTTTAATACAAAATGAGG + Intronic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
976775609 4:88702926-88702948 GGGCAGGTTGCTGCAGATTGTGG - Intronic
977672801 4:99715547-99715569 GGGCAGGTTTCTACAAGTTGTGG + Intergenic
980733942 4:136857931-136857953 GGGCAGGTTACTGGAAATGAGGG - Intergenic
981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG + Intronic
983811829 4:172072083-172072105 GGGCAGGTTGCTGCAGATTGTGG + Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
986209495 5:5657345-5657367 GGTGGGGTTATTGCAAATTGAGG - Intergenic
987744148 5:21948334-21948356 GGGCATGTTAATGCAAGGGGTGG - Intronic
988865569 5:35330876-35330898 GGTCTGGTTATTGCAAAGTGGGG + Intergenic
989311324 5:40022121-40022143 AGGCATGTCAATGCAAATTTAGG + Intergenic
991764352 5:69958471-69958493 GGGCATGTTAATGCAAGAGGTGG - Intergenic
991782976 5:70159676-70159698 GGGCATGTTAATGCAAGGGGTGG + Intergenic
991843584 5:70833543-70833565 GGGCATGTTAATGCAAGAGGTGG - Intergenic
991875417 5:71160003-71160025 GGGCATGTTAATGCAAGAGGTGG + Intergenic
992226520 5:74624305-74624327 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
992779356 5:80114027-80114049 GGGCAGGTCATTGTTAATTGAGG - Intronic
993162249 5:84307249-84307271 CTGCAGGCTAATGAAAATTGGGG + Intronic
994772554 5:104002011-104002033 GCACATGTTACTGCAAATTGAGG + Intergenic
994842110 5:104937909-104937931 GGAAATATTAATGCAAATTGAGG - Intergenic
996870519 5:128187178-128187200 GGGCAGGTTAATCAAAAATGGGG + Exonic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
997523223 5:134536584-134536606 AGGGAGGTTTATGCAAAGTGAGG + Intronic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
998740892 5:145199996-145200018 GGGAAGATTAATGAAAAATGAGG - Intergenic
998847482 5:146325074-146325096 AGGCAGGTGAATCCAGATTGAGG - Intronic
999531165 5:152464924-152464946 GGGCAGGTTGCTGCAGCTTGTGG + Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1004174671 6:13329022-13329044 GGGCAGGTTGCTGCAGGTTGTGG + Intergenic
1004302386 6:14470232-14470254 GGGCAGATTCCTGCAGATTGTGG - Intergenic
1004684594 6:17930628-17930650 GGGAAGGTTATGGCAAAGTGTGG - Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1008914063 6:56767707-56767729 GAGCAGGTTAAGAGAAATTGAGG + Intronic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1009763496 6:68038630-68038652 GGGCAGGCTAATGCAAGGGGTGG + Intergenic
1010616605 6:78020566-78020588 GGGCAGGTTAATATGAATTGAGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1013462632 6:110389910-110389932 GGGCAGGTTGCTGCAGCTTGTGG + Intergenic
1014480363 6:121928372-121928394 GGGCTGATTAATGCTAATTGTGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1016849336 6:148601157-148601179 GGGCTGGTTACTCCAAGTTGTGG - Intergenic
1018623260 6:165751802-165751824 GGACAGGTGCATGCAAATTGAGG - Intronic
1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG + Intergenic
1024675945 7:51638074-51638096 GGGCTGGTTAAAGCAGCTTGCGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG + Intronic
1026143058 7:67722557-67722579 GGGCAGGTTGAGGCAAATAAGGG - Intergenic
1026700053 7:72633172-72633194 GGGCAGGCCAATGCAAATAAAGG - Intronic
1028035407 7:85975474-85975496 GGGCAGCTCAATGCAAAGTGAGG + Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1028835328 7:95368368-95368390 GGGCACTTTGATGCAAATTAAGG + Intronic
1030050582 7:105533450-105533472 TGGCAGGTTATTGCAAATCAAGG + Intronic
1030136028 7:106249623-106249645 GGGCAGGTTAATAAACATTTTGG + Exonic
1030776765 7:113543307-113543329 GGACGAGTCAATGCAAATTGAGG - Intergenic
1031795584 7:126170269-126170291 GGGCTGGTTGCTGCAGATTGCGG + Intergenic
1038375206 8:27033164-27033186 GGGTAGGTTAATATGAATTGAGG + Intergenic
1039157654 8:34579691-34579713 TGGCAGATCAATGTAAATTGAGG - Intergenic
1039790610 8:40872760-40872782 GGGATGGTTGATGCCAATTGGGG + Intronic
1041777243 8:61536830-61536852 GGGCAGGTTACTGCAGGTTGTGG + Intronic
1042064539 8:64859340-64859362 GGGGAGGTTAATCTGAATTGGGG - Intergenic
1043157469 8:76801913-76801935 GTGCAGGTTAATAGAGATTGAGG + Intronic
1043524978 8:81086742-81086764 AGCCAGGGAAATGCAAATTGAGG + Intronic
1045288943 8:100815584-100815606 GGGCAGTTTAATGTAAGTTGGGG - Intergenic
1048809968 8:138276770-138276792 GGGCAGGATATTCAAAATTGGGG + Intronic
1050584132 9:7092450-7092472 GGTCAGATTAATGCAAAATGAGG - Intergenic
1052245434 9:26328603-26328625 GGGGTGGTTAATTCAAATTTGGG - Intergenic
1054799728 9:69335365-69335387 GGGCAGGTGACTGCTAAATGGGG + Intronic
1054962470 9:70983931-70983953 GGGGTGGTTACTGCAGATTGTGG + Intronic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1058638676 9:107061559-107061581 GTGCTGGTTGATGGAAATTGGGG + Intergenic
1061752675 9:132791743-132791765 GGGCAGGTTGCTGCAGGTTGTGG - Intronic
1203613606 Un_KI270749v1:30465-30487 GGGAAGTGTAATGCAAAATGTGG + Intergenic
1186781095 X:12912766-12912788 AAGCAGCTTAAAGCAAATTGTGG - Intronic
1187361915 X:18636449-18636471 GGGCAGGTTAATGTCAAGTATGG - Intronic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190628666 X:52363570-52363592 AGTCAGTTTAACGCAAATTGAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1191882614 X:65857655-65857677 GGACTGGTCAATGCAAAGTGTGG + Intergenic
1192804803 X:74499151-74499173 TGCCAGATTACTGCAAATTGGGG - Intronic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1198441367 X:136666612-136666634 GGGAAGGTCACTGGAAATTGAGG - Exonic
1199313140 X:146345049-146345071 AGGCAGTGTAATGTAAATTGAGG - Intergenic
1199561899 X:149172194-149172216 GGGCATGATAATGCAAATGGTGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic