ID: 1146089008

View in Genome Browser
Species Human (GRCh38)
Location 17:29857417-29857439
Sequence GTGTTGTAGAAGGGAAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146089008_1146089016 6 Left 1146089008 17:29857417-29857439 CCAGAGTTTCCCTTCTACAACAC 0: 1
1: 0
2: 0
3: 21
4: 219
Right 1146089016 17:29857446-29857468 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
1146089008_1146089014 2 Left 1146089008 17:29857417-29857439 CCAGAGTTTCCCTTCTACAACAC 0: 1
1: 0
2: 0
3: 21
4: 219
Right 1146089014 17:29857442-29857464 GGGAATTCAAGATGAGATTTGGG 0: 1064
1: 1054
2: 1098
3: 9399
4: 12414
1146089008_1146089015 5 Left 1146089008 17:29857417-29857439 CCAGAGTTTCCCTTCTACAACAC 0: 1
1: 0
2: 0
3: 21
4: 219
Right 1146089015 17:29857445-29857467 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
1146089008_1146089017 7 Left 1146089008 17:29857417-29857439 CCAGAGTTTCCCTTCTACAACAC 0: 1
1: 0
2: 0
3: 21
4: 219
Right 1146089017 17:29857447-29857469 TTCAAGATGAGATTTGGGTGGGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
1146089008_1146089013 1 Left 1146089008 17:29857417-29857439 CCAGAGTTTCCCTTCTACAACAC 0: 1
1: 0
2: 0
3: 21
4: 219
Right 1146089013 17:29857441-29857463 TGGGAATTCAAGATGAGATTTGG 0: 1104
1: 1080
2: 768
3: 3761
4: 12892

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146089008 Original CRISPR GTGTTGTAGAAGGGAAACTC TGG (reversed) Intronic
900865170 1:5263595-5263617 GTGTTGTGGAAGGGACCCTGTGG + Intergenic
901247040 1:7739850-7739872 GTGTTGTGGTAGGGAAACTGCGG - Intronic
902198602 1:14816968-14816990 ATTTTCTAGAAGGGAAACTGAGG + Intronic
902574405 1:17368216-17368238 GAGTTTTAAAAGGGAAACTCTGG + Intergenic
902672810 1:17986620-17986642 GTGCTGTGGTCGGGAAACTCTGG + Intergenic
905874059 1:41421201-41421223 ATTTTGTAGAAGGGATACTGAGG - Intergenic
906948624 1:50316655-50316677 GTGTTTTAGAAGGGCCACGCTGG + Intergenic
907385734 1:54124387-54124409 ATTTTGTAGAGGGGAAACTGAGG - Intergenic
907542834 1:55232108-55232130 GAGTTGAAGATTGGAAACTCTGG + Intergenic
907947937 1:59152928-59152950 GAGTTTTAGAAGGGTCACTCTGG - Intergenic
908926718 1:69264452-69264474 ATGTTTTAGAAGGCAAATTCAGG + Intergenic
909338815 1:74508699-74508721 GTCTGGTAGAAGGGAGGCTCAGG + Intronic
910581114 1:88826026-88826048 GGGTAGTAAAAGGGAATCTCTGG - Intronic
910622239 1:89268877-89268899 TTGTAATAGAAGAGAAACTCTGG + Intronic
911880354 1:103230091-103230113 GTGTTATAGTAGAAAAACTCAGG - Intergenic
912393471 1:109321229-109321251 GTGCTGTAATAGGGGAACTCTGG + Intronic
916416302 1:164595239-164595261 GAGTTGTACCAGGGAAGCTCTGG - Intronic
919084953 1:192910586-192910608 GTGTTGGAGAAGGGAGAGTGAGG + Intergenic
919818564 1:201457962-201457984 GTGATGGAGAAGGGAGACCCTGG - Intergenic
919844541 1:201633357-201633379 GTGTTATGGATAGGAAACTCAGG + Intronic
921120792 1:212135144-212135166 GTGTTATAAAAGGCAAACACAGG + Intergenic
921426800 1:215012014-215012036 TTGTTGTACCAGGGTAACTCTGG + Intronic
922204263 1:223432808-223432830 GTGTTGTAGAAAGGCAAATCTGG + Intergenic
1063568885 10:7196351-7196373 GTGTTTCAGAAAGGAAAGTCAGG - Intronic
1064876228 10:19996946-19996968 GTGTTGTGGGAGGGAAACAGTGG - Intronic
1066441158 10:35440277-35440299 GTGAGGCAGAAAGGAAACTCAGG + Intronic
1067035645 10:42914495-42914517 GTGTTGGGGATGGGAAACACTGG - Intergenic
1069119814 10:64555787-64555809 GTGCTGCAGAGGGGAAATTCTGG + Intergenic
1072265865 10:93727369-93727391 GTGTTGTGGAAGGGACCCTGTGG + Intergenic
1074053486 10:109900702-109900724 GGGTTGGAGAAAGGAGACTCTGG - Intronic
1074105777 10:110388778-110388800 GTGGGGTAGAAGGGAAAGTCGGG + Intergenic
1074120257 10:110488716-110488738 TTTTTGTAGAGGGGAAACTGAGG + Intergenic
1077479015 11:2804293-2804315 ATTTTGCAGAAGGGAAACTGAGG + Intronic
1078593883 11:12670228-12670250 GTGATGAAGAAGGAAAACACAGG - Intergenic
1079556069 11:21760220-21760242 GTGTTGTGGGAGGGACACTGTGG - Intergenic
1079886715 11:26000055-26000077 GTGTTGTAGGAGGGACACAGTGG - Intergenic
1080424831 11:32146008-32146030 GTGTTGTAGGAGGGACCCACTGG - Intergenic
1080920566 11:36704930-36704952 ATGTTGTAATAGGGAAACTGAGG - Intergenic
1081314947 11:41620759-41620781 ATGTTGTGGGAGGGACACTCTGG + Intergenic
1083559462 11:63661413-63661435 GTGCTTTGGTAGGGAAACTCTGG - Intronic
1084435371 11:69136408-69136430 GTGTTTGAGGAGGGACACTCAGG + Intergenic
1086036434 11:82420747-82420769 GTGTTATAGAAGTGAATTTCAGG - Intergenic
1087921907 11:103876428-103876450 GTGTTCTAGAAAGGTAACTCTGG + Intergenic
1089115948 11:116095276-116095298 GTGTTGTGGAAGGGACCCTGTGG - Intergenic
1092653148 12:10656034-10656056 GTGTTGTGGAAGGGACACAGTGG + Intronic
1092749075 12:11701710-11701732 GTCTTGTAGAAGAGAAAACCGGG + Intronic
1093851625 12:24046256-24046278 GTGATGTAAAAGCGAAACTTGGG + Intergenic
1093879180 12:24383897-24383919 GTGTTGCGGAAGGGAACCTGTGG + Intergenic
1094228808 12:28079308-28079330 TTGTGGTAGAAGGGTAAATCTGG + Intergenic
1095275032 12:40271527-40271549 GTGTTTTTCAAGTGAAACTCTGG - Intronic
1096240238 12:49955903-49955925 GGGTGGTAAGAGGGAAACTCTGG + Exonic
1096809454 12:54160362-54160384 GTCTTGAGGAATGGAAACTCTGG - Intergenic
1097227034 12:57483454-57483476 GTGTTTTAGAAAGGTCACTCTGG - Intronic
1099476143 12:83109514-83109536 GTGTTGCAGAAGAGAAAACCTGG - Intronic
1099812683 12:87604983-87605005 GTGTTGTAGAAGGGACTCAATGG - Intergenic
1100396849 12:94193243-94193265 GTGTTTTAGAACGAGAACTCTGG + Intronic
1104177674 12:126348682-126348704 GTTTTGAAGAAGGGAAATTGAGG + Intergenic
1107431249 13:40342436-40342458 GTGTCGTAGAAGGGACACAGTGG - Intergenic
1107813902 13:44226902-44226924 GTGTTGTAGAAGCCAGAATCTGG + Intergenic
1108101700 13:46964052-46964074 GTGTTGCAGAAGAGGAACACAGG + Intergenic
1108619545 13:52168072-52168094 TTGTCATAGAAGGCAAACTCAGG + Intergenic
1108640294 13:52377529-52377551 TTGTCATAGAAGGCAAACTCAGG + Exonic
1108860666 13:54854573-54854595 GTGTTGTAGAAGGGACCCAGGGG + Intergenic
1110284933 13:73738912-73738934 GTTTTATAGAAAGGAAACTGAGG - Intronic
1112254429 13:97816516-97816538 GTGTTGGAGAAGGAGGACTCTGG + Intergenic
1112281740 13:98068868-98068890 GTGTTGTGGAAGGGAATCAGTGG + Intergenic
1114558014 14:23572802-23572824 GGGTTGTGGAAGGGAGACTAAGG - Intronic
1117172028 14:53110287-53110309 GTGTTGTAGAGTTGAAACTAGGG - Intronic
1117513219 14:56473443-56473465 GTGTGGTAGAAAGGAAATTCTGG - Intergenic
1122187777 14:100014796-100014818 GGGTTGTAGAAGTGAAACCAGGG + Intronic
1122649560 14:103218978-103219000 GTAATGAAGAAGGGAAATTCAGG - Intergenic
1128669292 15:69562408-69562430 GTGTTGTAAAGGGGAAACTAAGG + Intergenic
1128689412 15:69711903-69711925 GTTTTGCAGAAGGGAAACTGAGG + Intergenic
1134861135 16:17561520-17561542 GTGTTGGAGAAAGGAAAATAAGG - Intergenic
1137488861 16:48914077-48914099 AGGCTGTGGAAGGGAAACTCTGG + Intergenic
1138230502 16:55332463-55332485 GTGGTGAAGTAGGGCAACTCGGG - Intergenic
1138499756 16:57432970-57432992 ATGTTATAGAATGGAAACTAAGG - Intronic
1139058196 16:63213935-63213957 GTGTTTTAAAAAGGAAACTATGG - Intergenic
1141090758 16:81128824-81128846 GTGGTGTAGAAGGATCACTCTGG - Intergenic
1141902999 16:87005053-87005075 GGGTTGGAGAAAGGAACCTCTGG - Intergenic
1144816352 17:18038385-18038407 TTGTGGTAGGAGGGAAAGTCAGG + Intronic
1145835159 17:27949347-27949369 GTATTGGAGAAGGGTAACTGAGG - Intergenic
1146089008 17:29857417-29857439 GTGTTGTAGAAGGGAAACTCTGG - Intronic
1146369649 17:32257560-32257582 GTGTTTTGGAAGGGAAAATCAGG + Intergenic
1146455992 17:33010130-33010152 CTGGTGGAGAAGGGAGACTCAGG - Intergenic
1147308967 17:39582886-39582908 GTGTGGTAGAAGGGAAAGGCTGG - Intergenic
1147741917 17:42674846-42674868 GTGTGGAAGAAGGGAAAATGAGG - Intronic
1148517770 17:48237811-48237833 GTGTTGTGGATTGGAAACTTGGG - Intronic
1148860361 17:50601360-50601382 GTATCATAGAAGGGAAACTGAGG - Intronic
1150355423 17:64480150-64480172 GTTCTGTAAAAGGGAAACTGAGG + Intronic
1160022067 18:75188838-75188860 GTTTTGTAGGGGGGAAACTGAGG - Intergenic
1160601328 18:80014773-80014795 GTGGTGCAGAAGGGAAATTTGGG - Intronic
1162082722 19:8228230-8228252 ATGTTGTAAAACTGAAACTCTGG - Intronic
1163796927 19:19343147-19343169 GTGTTGTGACAGGGACACTCGGG + Intronic
1164187308 19:22881622-22881644 GTTTTGTGGAAGGAAAACTGAGG - Intergenic
1166831845 19:45643930-45643952 GTTTTGCAGACGGGAAACTAAGG + Intronic
925527405 2:4818258-4818280 GTGTTGTAGGAGGGAACCGGTGG - Intergenic
925935103 2:8750113-8750135 CTGTTGTAGAAGGGATGCTGAGG + Exonic
926666212 2:15526346-15526368 TTGTTGAAGAAGAGAAACTGAGG - Intronic
927356760 2:22182230-22182252 GAGTTTTAGAGGGGATACTCAGG + Intergenic
929236487 2:39610554-39610576 GAGTTGGAGATGGGAAACTGGGG + Intergenic
929261175 2:39868106-39868128 GTGATGTAGAAGGCAAACAGAGG + Intergenic
929673361 2:43898140-43898162 TTGCTGGAGAAGGGAAATTCCGG - Intronic
931312601 2:61096389-61096411 GGTTTGGAGAAGGGAAACTGAGG - Intronic
931655085 2:64503460-64503482 GTCTTAAAGAAGAGAAACTCAGG + Intergenic
931685641 2:64789882-64789904 GTGTGGTGGCAGGCAAACTCTGG - Intergenic
932446720 2:71786135-71786157 CTGTTGTAGAGGGGAAACTGAGG + Intergenic
933285064 2:80376525-80376547 GTGTTTTAGCAGGGAACTTCTGG + Intronic
934131950 2:88956763-88956785 CTGGTGAGGAAGGGAAACTCAGG - Intergenic
934748323 2:96774521-96774543 GTGCTGTAGATGGGAAACTGAGG + Intronic
935687711 2:105698684-105698706 TTGTTCTAGAAGGAAAAGTCAGG - Intergenic
936244523 2:110815251-110815273 GTGTTGTAGGAGGGACACATTGG - Intronic
936713512 2:115160968-115160990 GTGTTGAAGAAAGGAAAGGCTGG + Intronic
936772086 2:115925790-115925812 GTGTTGTGGGAGGGACCCTCAGG + Intergenic
937595395 2:123666010-123666032 GTGTTGTAGGAGGGACCCTGTGG - Intergenic
938630773 2:133164818-133164840 GTGTTTTAGAAGAGAATCTTGGG + Intronic
939275936 2:139996243-139996265 GTGTTTTAACAGGGTAACTCTGG - Intergenic
939337838 2:140853784-140853806 GTGCAGTAGAAAGGAATCTCTGG - Intronic
940662054 2:156558472-156558494 GTGTTTTAGAAAGAAAATTCTGG - Intronic
940889254 2:159019074-159019096 GTTTTGCAGATGGGAAACTGAGG + Intronic
941315684 2:163989608-163989630 GTGTTTTACAAAGGAAACTTTGG - Intergenic
941348874 2:164406525-164406547 GGGTTATATAGGGGAAACTCAGG + Intergenic
942688139 2:178556024-178556046 ATCTTATAGAAGGGAAACTGAGG - Intronic
945718403 2:213387119-213387141 TTGTTGTAGAAGGGAAAAAAAGG + Intronic
946460888 2:219867747-219867769 GTGTTGTGGGAGGGATGCTCTGG + Intergenic
947783983 2:232798063-232798085 TTGGGGTAGAAGGGAAGCTCAGG - Intronic
1169342664 20:4808328-4808350 GTCTTGTAGGAGGGAAACTGAGG + Intronic
1169806973 20:9569499-9569521 GTGCTGTAGAAAGGAAACTAAGG + Intronic
1171974504 20:31585893-31585915 GGGTTGTAGAAGGGAATGTCTGG - Intergenic
1172655045 20:36531732-36531754 GAGTTCTAGAAGGGAAACCTGGG - Intergenic
1175218978 20:57406183-57406205 CTGTTGCAGACGGGAAACTGAGG + Intronic
1175914215 20:62418307-62418329 ATGGTGCAGAAGGGAAACTGAGG - Intronic
1177763325 21:25427998-25428020 GTGATGTAGGAGGGAAAAGCGGG + Intergenic
1178199171 21:30383435-30383457 GTGCTGTAAGCGGGAAACTCAGG + Intronic
1184078557 22:42200818-42200840 GTGTTTTATAAAGGAAACTCAGG - Intronic
951048147 3:18064156-18064178 GTGTTGTCGGAGGGAACCTGTGG + Intronic
954187856 3:48932879-48932901 GTGGTGTAGAAGGGCAATGCAGG + Intronic
957273957 3:78066161-78066183 GTGTTAGAAAAGAGAAACTCTGG + Intergenic
958987569 3:100800121-100800143 TTGTGGTAGAAAGGAAACTAAGG - Intronic
959624100 3:108430679-108430701 GTGGTTAAGAAGGGAAACTGTGG - Intronic
959624470 3:108433561-108433583 GTGTTGTGGGAGGGAACCTGTGG + Intronic
960796000 3:121488667-121488689 GTATTGGAGAATGGAAAATCGGG + Exonic
961342714 3:126239399-126239421 GTGTTGTAGGAGGGACACAGTGG - Intergenic
962905300 3:139796010-139796032 ATGTTTGAGATGGGAAACTCAGG - Intergenic
964556611 3:157946325-157946347 GTGTGGTAGATGTGAAACTCTGG - Intergenic
965150074 3:164961920-164961942 ATGTTATAAAAGTGAAACTCTGG - Intergenic
965375949 3:167924248-167924270 GTGTGGAAGAAGGAAAACTGGGG - Intergenic
965515135 3:169613409-169613431 GTTTTTTGGAAGGGACACTCAGG + Intronic
967056180 3:185830360-185830382 GTGTTGGGGAAGGGAACATCAGG + Intergenic
967848027 3:194059565-194059587 ATTTTGGAGAAGGGAAACTGAGG - Intergenic
968709234 4:2101005-2101027 GTGTTGCAGAGGTGAAACACTGG + Intronic
969049001 4:4359385-4359407 GTGTTGTAGGAGGGACCCTGTGG + Intronic
971134733 4:23855824-23855846 GTGATGTAGGAGGGGAAGTCTGG + Intronic
971473979 4:27055499-27055521 GTGTTGTAAAAGGGGATCTCAGG - Intergenic
974219447 4:58947769-58947791 GTGTTGTAGAAGAGAAATATGGG - Intergenic
974478015 4:62407623-62407645 ATGTGGTAGAAGGGACATTCAGG + Intergenic
974501682 4:62712900-62712922 GTCTTGTAGAAGCGGAATTCTGG - Intergenic
975257322 4:72253799-72253821 GTGTTGTGGGAGGGAACCTGTGG + Intergenic
976111230 4:81676215-81676237 GTGTTTCAGGAGGGAAGCTCGGG + Intronic
976350450 4:84054410-84054432 GTGTTGGAGAAAGGAAGCTGAGG + Intergenic
976365628 4:84229759-84229781 GTGTTGTGGGAGGGACACACTGG - Intergenic
979160729 4:117457503-117457525 GAGTTGAAAATGGGAAACTCAGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
983320490 4:166190699-166190721 GTGTTGTAGGAGGGACACTGTGG + Intergenic
983463554 4:168057272-168057294 ATATTGTAGAAGGTAAGCTCAGG - Intergenic
988241743 5:28620519-28620541 ATGTAGTAAAAGGAAAACTCTGG + Intergenic
990460098 5:56023669-56023691 GTGCTGTGGAAGGGGAGCTCTGG - Intergenic
990673709 5:58161120-58161142 GTGTTGTTTAAAGGAAACACAGG + Intergenic
991183966 5:63786112-63786134 GTGTTGTGGAAGGGACCCTGTGG + Intergenic
992695093 5:79278244-79278266 GTGCTTTAGAATGGATACTCAGG - Intronic
993098433 5:83506978-83507000 GTGTTGTGGAAGGGACCCACGGG - Intronic
993130027 5:83884900-83884922 CTGTAGTAGAATGTAAACTCAGG - Intergenic
993561790 5:89418676-89418698 GTGTTGTAGAAGGGACCCAGTGG + Intergenic
996475782 5:123919098-123919120 GTGTTGTAGGAGGGACCCTGTGG + Intergenic
999107878 5:149089899-149089921 GTGTTGTAGGAGGGACCCACTGG + Intergenic
1000166745 5:158657209-158657231 GTGTTTTGGATGGTAAACTCTGG - Intergenic
1000168701 5:158680092-158680114 GTTTTGCAGAAGAGAAAATCTGG + Intergenic
1000426721 5:161099795-161099817 GAGTTGTAAAAGGGAGACTTAGG + Intergenic
1000766785 5:165301521-165301543 GTGTTGTAGGAGGGACTCTGTGG + Intergenic
1001180227 5:169513464-169513486 GTTTTGTAGTTGGGAAACTGAGG - Intergenic
1001716541 5:173821031-173821053 ATGTTACAGAAGGGAAACTGAGG - Intergenic
1001965752 5:175908722-175908744 GTGTTTTAGAAGGGTGCCTCCGG - Intergenic
1002251193 5:177930474-177930496 GTGTTTTAGAAGGGTGCCTCCGG + Intergenic
1002286581 5:178166366-178166388 GATGTGGAGAAGGGAAACTCTGG + Intergenic
1003867454 6:10376465-10376487 GTTTTGAAGCAGGGAAACTGAGG + Intergenic
1009508807 6:64521316-64521338 GTGATGGAGAAGTGAAAGTCAGG + Intronic
1009541263 6:64961968-64961990 GAGTTGAAGAATGAAAACTCTGG - Intronic
1011075743 6:83436789-83436811 GTTTTGTAGAAGGTATACTGTGG - Intergenic
1012060328 6:94470307-94470329 GTGTTCTTGACGGGAAACCCTGG + Intergenic
1013686467 6:112590388-112590410 GTTTTCTGGAAGGGAAATTCTGG + Intergenic
1014005746 6:116415938-116415960 GTTTTGTAGAAGTGTAACACAGG + Intronic
1014693509 6:124590855-124590877 GAGTGGCTGAAGGGAAACTCTGG + Intronic
1015831621 6:137376277-137376299 GTGTTGTGGAAGGGACTCACTGG + Intergenic
1017120577 6:151020185-151020207 GTCTTGTGGAAGGAAAACACCGG + Intronic
1017847576 6:158272727-158272749 GTGATTAAGAAGGGGAACTCAGG - Intronic
1019478908 7:1257072-1257094 GTTTTCTAGAAGGGAAAGCCGGG + Intergenic
1021324938 7:19255266-19255288 GTGTTGTGGAAGGGACACGGTGG - Intergenic
1024561470 7:50648683-50648705 GCCCTGAAGAAGGGAAACTCTGG - Intronic
1024792899 7:52986291-52986313 GTGTTGTGGAAGGGATGCTGTGG + Intergenic
1026433931 7:70376906-70376928 GTGTTGTTGAATGAAACCTCAGG + Intronic
1031595881 7:123648841-123648863 GTGTTTTAAAAGGTTAACTCTGG + Intergenic
1031656512 7:124362633-124362655 GTGTTGTGGAAGGGACCCACTGG + Intergenic
1031842525 7:126761562-126761584 GTGTTTTAGAAAAGAAACTATGG - Intronic
1035841614 8:2817930-2817952 GTGTTGTAGGAGGGACCCTGTGG + Intergenic
1036775444 8:11608830-11608852 GAGTTATTGGAGGGAAACTCTGG - Intergenic
1037019483 8:13951883-13951905 GTGTTGTAGAAGGGACCCACTGG - Intergenic
1037568623 8:20139882-20139904 GTGTTGTTGAAAGAAAATTCAGG + Intergenic
1040009222 8:42647422-42647444 GTGTTGTGGAAGGGACCCTGTGG - Intergenic
1042925908 8:73968340-73968362 GTGTTGTGGGAGGGCGACTCTGG - Intronic
1043254756 8:78120425-78120447 GTGATTTTGAAGGGCAACTCTGG - Intergenic
1043296835 8:78674552-78674574 GTGTTGGAGAAGGACAAGTCAGG + Intronic
1045373039 8:101544058-101544080 GTGTTGTGGGAGGGACACTGTGG - Intronic
1046264447 8:111813480-111813502 GTGTTGTGGGAGGGACACTGAGG - Intergenic
1046808937 8:118511481-118511503 GTTTTGTAGATTGGAAAATCTGG + Intronic
1047366987 8:124220867-124220889 GTGTGGTGAAAGGGAAACTATGG - Intergenic
1048734962 8:137488767-137488789 GTATTGCAGAAGTGCAACTCGGG + Intergenic
1051050801 9:12929650-12929672 CTTTTTTAGAAGGGAAACTGAGG + Intergenic
1051322972 9:15929739-15929761 GTGTTTTGGAAGGATAACTCTGG - Intronic
1052704441 9:31978027-31978049 GGGTTGTAGGCTGGAAACTCAGG - Intergenic
1055464761 9:76553614-76553636 GTGAAGTAGAAGGGAAAGTGTGG + Intergenic
1057548033 9:96032493-96032515 GTGTGGTGGGAGGCAAACTCTGG - Intergenic
1058415607 9:104785522-104785544 GTGTTCTAAAAGAGAAACACCGG - Exonic
1058861444 9:109120861-109120883 GTGTGGGGGAAGGGAAACTCTGG + Intergenic
1060620408 9:125060564-125060586 GTGTTGTGGGAGGGAACCACGGG + Intronic
1061715691 9:132517540-132517562 GTGTTTCAGAAGGGAGACTTGGG - Intronic
1185952833 X:4455479-4455501 GTGTTGTGGAAGGGACACAGTGG + Intergenic
1186410842 X:9343034-9343056 GAGTTGGGGAAGGGAAAATCAGG + Intergenic
1186727039 X:12368193-12368215 GTGTTGTGGGAAGGAAACTGAGG - Intronic
1188479550 X:30623056-30623078 CTGCTGGAGAAGGGAAAGTCGGG - Intergenic
1189705307 X:43753821-43753843 GTGTAGTAAAAGGGAAACCAGGG - Intergenic
1192932951 X:75827046-75827068 GTGTTGTGGGAGGGACACACTGG - Intergenic
1194175829 X:90647600-90647622 GAATTGGAAAAGGGAAACTCAGG - Intergenic
1194645550 X:96454390-96454412 GTGTTGTGGGAGGGACTCTCTGG - Intergenic
1194688422 X:96953258-96953280 GTATTATTGAGGGGAAACTCAGG - Intronic
1194766429 X:97848154-97848176 GTGTAGCAGAAGGGGAACTGGGG - Intergenic
1194973773 X:100372759-100372781 GTGTAGAAGAAAGGAGACTCTGG + Intronic
1195295836 X:103475903-103475925 TTTTTGTAGAAAGGAAACTGAGG + Intergenic
1196945688 X:120823143-120823165 GTCTTTTAGATGGGAAACTAAGG + Intergenic
1196972853 X:121128654-121128676 GTTTTGTAGACGGGAAAGTGAGG + Intergenic
1200008536 X:153104215-153104237 GTGTGGGAGAAGGTAAATTCTGG + Intergenic
1200522466 Y:4228560-4228582 GAATTGGAAAAGGGAAACTCAGG - Intergenic