ID: 1146089624

View in Genome Browser
Species Human (GRCh38)
Location 17:29863329-29863351
Sequence TGTTAGCCTGAGTACTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146089624 Original CRISPR TGTTAGCCTGAGTACTGGAC TGG (reversed) Intronic
904256108 1:29255923-29255945 TGTCATCCTGAGCTCTGGACTGG + Intronic
907874457 1:58472280-58472302 TGTTAGCCTCAGTCCTGAATAGG + Intronic
908006063 1:59730814-59730836 TGTTAGCCTGTATAGTGGAGAGG + Intronic
920495689 1:206453489-206453511 TGTGAGCCTCAGGACTGCACTGG - Intronic
1063368430 10:5505533-5505555 CGTGAGCCTGAACACTGGACAGG + Intergenic
1067778109 10:49177401-49177423 TGTTTGCCTGAGTGCTGACCCGG + Intronic
1069179335 10:65337114-65337136 TGGTAGCCTGAGTACAAGGCAGG - Intergenic
1069350639 10:67522183-67522205 TGTTAGAATGAGGACTGAACAGG - Intronic
1073215447 10:101833690-101833712 TGTGAGCCTGTGTATGGGACAGG - Intronic
1077221581 11:1420381-1420403 TGTTAGCCAGAGTGCAGGGCAGG - Intronic
1085759427 11:79229043-79229065 TGTTAGTGTGAGTATTGGAAAGG + Intronic
1086048379 11:82560195-82560217 AGAAAGCCTGAGTACTGGTCTGG - Intergenic
1087260493 11:96005682-96005704 TATTAGGCTGAATTCTGGACTGG + Intronic
1089588875 11:119527476-119527498 TGTTAGACTGAGTTCAGGACAGG - Intergenic
1091139071 11:133220003-133220025 TGTTAACCTGTGTCCTTGACAGG + Intronic
1091893320 12:4080432-4080454 TGTTTGGCTGAGTACTCCACAGG + Intergenic
1093925047 12:24901979-24902001 TGTTTGCCTGGGTCCTGGAGAGG - Intronic
1094475527 12:30837801-30837823 TGTTAGTCTGAGAAGAGGACAGG + Intergenic
1095582549 12:43816550-43816572 TTTTAGACTGGGTAGTGGACAGG - Intergenic
1100435629 12:94569043-94569065 TGCTAGGCTGAGCACTGGAATGG + Exonic
1103538615 12:121650978-121651000 TGTTAGGCTGAGAAGTGGTCAGG + Intergenic
1105746629 13:23383300-23383322 TGGTGGCCTGAGTAAGGGACAGG - Intronic
1112167500 13:96935282-96935304 ACTTAGCCTGACTACTGAACTGG + Intergenic
1112198856 13:97255487-97255509 GGGTAGACTGAGGACTGGACAGG + Intronic
1120485661 14:85110878-85110900 TGTAAGCCTGACTTATGGACAGG + Intergenic
1120885888 14:89451567-89451589 TGTCAGCTTGAGAACTGGTCAGG + Intronic
1125013695 15:34908635-34908657 TGGTAGAATGAGAACTGGACAGG - Intronic
1127120877 15:55771012-55771034 TGTCTGCCTGAGTCTTGGACAGG - Intergenic
1146089624 17:29863329-29863351 TGTTAGCCTGAGTACTGGACTGG - Intronic
1153765002 18:8366753-8366775 TGTTAGCCTGATTGATGGCCTGG + Intronic
1162906747 19:13828596-13828618 GGTTAGCCTGAGTCTTGGGCTGG - Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
938597242 2:132800673-132800695 TGTCATCCTGAATACTGAACAGG - Intronic
946167876 2:217876401-217876423 TGTTAGCCAGAGCACTGAGCCGG + Intronic
946331840 2:219013893-219013915 TGGGAGCCTGAGTCCTGGGCAGG - Exonic
946850876 2:223906160-223906182 TGTTGGCCTGAGGACAGGTCTGG - Intronic
1169403265 20:5301990-5302012 TGATGCTCTGAGTACTGGACTGG + Intergenic
1169910456 20:10643899-10643921 TGGCAGCCAGAGTAATGGACTGG - Intronic
1170601049 20:17841936-17841958 TGTCAGCCTGAGCATGGGACTGG + Intergenic
1181626445 22:24125313-24125335 TGTGAGCCTGGGTAAAGGACAGG + Intronic
1182733860 22:32516722-32516744 TGTTAGCATGATCCCTGGACTGG + Intronic
1184202111 22:42977427-42977449 TGTTTTCCTGAGTACTGGTGAGG - Intronic
1184675019 22:46036851-46036873 TGTTAGCCTGTGTGCTGAGCCGG + Intergenic
1185391478 22:50563642-50563664 TGTTTGGCTGAGTGGTGGACAGG + Intergenic
949113479 3:291802-291824 TGTTAGCCAAGTTACTGGACTGG - Intronic
957705912 3:83783443-83783465 TGTTAGCCTCAGTGTTGGATAGG + Intergenic
963005792 3:140725165-140725187 TGTGAGCCTGAGAACTGAGCTGG + Intergenic
963597752 3:147349295-147349317 TGTTAGGCTGAGAATTGGCCTGG - Intergenic
964307156 3:155354214-155354236 TGTTGCACTGAGTACTGAACAGG - Intergenic
967022465 3:185534565-185534587 TGTTAGGCTGTGCACTGCACAGG - Intronic
972733891 4:41821155-41821177 AGTTAGGCTGAGATCTGGACTGG + Intergenic
975721824 4:77255670-77255692 GGATAGCCTGGCTACTGGACAGG - Intronic
983442273 4:167801833-167801855 TATTAGTGTGAGCACTGGACTGG - Intergenic
999192575 5:149759601-149759623 AGTTAGCCTGAGCCCTGGGCTGG + Intronic
1001629655 5:173165330-173165352 TGTGAGCCTGAGTTCTGTCCAGG + Intergenic
1004191435 6:13467399-13467421 TGTTGGCCAGAGAGCTGGACAGG - Intronic
1010534837 6:77013728-77013750 TATTATCCAGAGCACTGGACTGG + Intergenic
1015012951 6:128374511-128374533 TTTTAGCCTGAGCACTGGGAAGG - Intronic
1016340955 6:143060904-143060926 TGTTCGCCAGAGGCCTGGACCGG - Exonic
1027240232 7:76322619-76322641 TGTTATCCAGAGTATTGGAGAGG - Intergenic
1027427265 7:78073966-78073988 TCTTATCCTGAGGACTGGAGTGG + Intronic
1030082963 7:105793204-105793226 TGTTGGCCTGGGCACTGGCCTGG + Intronic
1037577753 8:20224049-20224071 TGTTAGCCTGGGGACTGTAAGGG + Intronic
1041087167 8:54267583-54267605 TGTTAGCCTGAGTCCTGGGCTGG + Intergenic
1041455260 8:58052123-58052145 TGTGAGGCTGGGCACTGGACAGG + Intronic
1046777674 8:118180927-118180949 TGTCAGCCTGAGTACTGTGGGGG + Intergenic
1047309021 8:123676725-123676747 TGAAAGCCTGAGTACTGGTGAGG + Intergenic
1049021538 8:139960693-139960715 TGTTAGCCAGAGTTGTGGAGAGG + Intronic
1051796626 9:20879034-20879056 TGTGAGTCTGAGTAGTGTACAGG - Intronic
1057233111 9:93337044-93337066 TGTCAGGCTGAGAACTGGACTGG + Intronic
1059194303 9:112356258-112356280 TGTGAGCCACAGTACCGGACTGG + Intergenic
1062609288 9:137366767-137366789 TGTGAGCGTGAGCACTGGCCGGG - Intronic
1185715461 X:2338466-2338488 TGTAAGCCTCAGTGCTGGATGGG + Intronic
1199133570 X:144224303-144224325 TGTAAGCCTGTATATTGGACAGG + Intergenic
1199818745 X:151423879-151423901 TCTTAGCCAGAGAACTGAACTGG - Intergenic