ID: 1146090689

View in Genome Browser
Species Human (GRCh38)
Location 17:29874399-29874421
Sequence TTCAAGATGAGATCTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36022
Summary {0: 184, 1: 7905, 2: 11315, 3: 9458, 4: 7160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146090689_1146090702 17 Left 1146090689 17:29874399-29874421 CCCCACCCAGATCTCATCTTGAA 0: 184
1: 7905
2: 11315
3: 9458
4: 7160
Right 1146090702 17:29874439-29874461 CCGATAAGGGAGAGACCAGGTGG 0: 1
1: 0
2: 1
3: 56
4: 596
1146090689_1146090694 3 Left 1146090689 17:29874399-29874421 CCCCACCCAGATCTCATCTTGAA 0: 184
1: 7905
2: 11315
3: 9458
4: 7160
Right 1146090694 17:29874425-29874447 TACTCCCTATAACCCCGATAAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1146090689_1146090695 4 Left 1146090689 17:29874399-29874421 CCCCACCCAGATCTCATCTTGAA 0: 184
1: 7905
2: 11315
3: 9458
4: 7160
Right 1146090695 17:29874426-29874448 ACTCCCTATAACCCCGATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1146090689_1146090698 14 Left 1146090689 17:29874399-29874421 CCCCACCCAGATCTCATCTTGAA 0: 184
1: 7905
2: 11315
3: 9458
4: 7160
Right 1146090698 17:29874436-29874458 ACCCCGATAAGGGAGAGACCAGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146090689 Original CRISPR TTCAAGATGAGATCTGGGTG GGG (reversed) Intronic